TranscriptionTranscription

Chapter 8Chapter 8

The ProblemThe Problem

Information must be transcribed from Information must be transcribed from DNA in order function further.DNA in order function further.

REMEMBER:REMEMBER:

DNADNARNARNAProteinProtein

Tanscription in ProkaryotesTanscription in Prokaryotes Polymerization catalyzed by RNA Polymerization catalyzed by RNA

polymerasepolymerase Can initiate synthesis Can initiate synthesis Uses rNTPsUses rNTPs Requires a templateRequires a template Unwinds and rewinds DNAUnwinds and rewinds DNA

4 stages4 stages Recognition and bindingRecognition and binding InitiationInitiation ElongationElongation Termination and release Termination and release

RNA PolymeraseRNA Polymerase 5 subunits, 449 kd (~1/2 size of DNA 5 subunits, 449 kd (~1/2 size of DNA

pol III)pol III) Core enzymeCore enzyme

2 2 subunits---hold enzyme together subunits---hold enzyme together --- links nucleotides together--- links nucleotides together ’’---binds templates---binds templates

---recognition---recognition Holoenzyme= Core + sigmaHoloenzyme= Core + sigma

RNA Polymerase FeaturesRNA Polymerase Features Starts at a Starts at a promoterpromoter sequence, sequence,

ends at ends at termination signaltermination signal Proceeds in 5’ to 3’ directionProceeds in 5’ to 3’ direction Forms a temporary DNA:RNA Forms a temporary DNA:RNA

hybridhybrid Has complete processivityHas complete processivity

RNA PolymeraseRNA Polymerase X-ray studies reveal a X-ray studies reveal a

“hand”“hand” Core enzyme closedCore enzyme closed Holoenzyme openHoloenzyme open Suggested mechanismSuggested mechanism NOTE: when sigma NOTE: when sigma

unattached, hand is unattached, hand is closedclosed

RNA polymerase stays RNA polymerase stays on DNA until on DNA until termination. termination.

Recognition Recognition Template strandTemplate strand Coding strandCoding strand PromotersPromoters

Binding sites for RNA pol on template Binding sites for RNA pol on template strandstrand

~40 bp of specific sequences with a ~40 bp of specific sequences with a specific order and distance between specific order and distance between them.them.

Core promoter elements for E. coliCore promoter elements for E. coli -10 box (Pribnow box)-10 box (Pribnow box) -35 box-35 box

Numbers refer to distance from Numbers refer to distance from transcription start site transcription start site

Template and Coding Template and Coding StrandsStrands

5’–TCAGCTCGCTGCTAATGGCC–3’3’–AGTCGAGCGACGATTACCGG–5’

5’–UCAGCUCGCUGCUAAUGGCC–3’

Sense (+) strandDNA coding strandNon-template strand

DNA template strandantisense (-) strand

RNA transcript

transcription

Typical Prokaryote PromoterTypical Prokaryote Promoter

Pribnow box located at –10 (6-7bp) Pribnow box located at –10 (6-7bp) -35 sequence ~(6bp)-35 sequence ~(6bp) Consensus sequences: Strongest Consensus sequences: Strongest

promoters match consensuspromoters match consensus Up mutation: mutation that makes Up mutation: mutation that makes

promoter more like consensuspromoter more like consensus Down Mutation: virtually any mutation Down Mutation: virtually any mutation

that alters a match with the consensusthat alters a match with the consensus

Consensus sequences

In Addition to Core Promoter In Addition to Core Promoter ElementsElements

UP (UP (uupstream pstream ppromoter) elementsromoter) elements Ex. E. coli rRNA genesEx. E. coli rRNA genes

Gene activator proteinsGene activator proteins Facilitate recognition of weak promoterFacilitate recognition of weak promoter

E. coli can regulate gene E. coli can regulate gene expression in many waysexpression in many ways

Stages of Stages of TranscriptionTranscription

Template recognitionTemplate recognition RNA pol binds to DNARNA pol binds to DNA DNA unwoundDNA unwound

InitiationInitiation ElongationElongation

RNA pol moves and RNA pol moves and synthesizes RNAsynthesizes RNA

Unwound region moves Unwound region moves TerminationTermination

RNA pol reaches endRNA pol reaches end RNA pol and RNA releasedRNA pol and RNA released DNA duplex reformsDNA duplex reforms

Transcription InitiationTranscription Initiation StepsSteps

Formation of closed promoter (binary) Formation of closed promoter (binary) complex complex

Formation of open promoter complexFormation of open promoter complex Ternary complex (RNA, DNA, and Ternary complex (RNA, DNA, and

enzyme), abortive initiation enzyme), abortive initiation Promoter clearance (elongation ternary Promoter clearance (elongation ternary

complex)complex) First rnt becomes unpaired First rnt becomes unpaired Polymerase loses sigmaPolymerase loses sigma NusA bindsNusA binds

Ribonucleotides added to 3’ endRibonucleotides added to 3’ end

HoloenzymeHoloenzyme Core + Core +

Closed (Promoter) Closed (Promoter) Binary ComplexBinary Complex

Open binary Open binary complexcomplex

Ternary complexTernary complex

Promoter clearancePromoter clearance

Back

Sigma (Sigma () Factor ) Factor Essential for recognition of promoterEssential for recognition of promoter Stimulates transcriptionStimulates transcription Combines with holoenzymeCombines with holoenzyme

““open hand” conformationopen hand” conformation Positions enzyme over promoterPositions enzyme over promoter

Does NOT stimulate elongationDoes NOT stimulate elongation Falls off after 4-9 nt incorporatedFalls off after 4-9 nt incorporated ““Hand” closesHand” closes

Variation in SigmaVariation in Sigma Variation in promoter sequence affects Variation in promoter sequence affects

strength of promoterstrength of promoter Sigmas also show variabilitySigmas also show variability Much less conserved than other RNA Much less conserved than other RNA

pol subunitspol subunits Several variants within a single cell. EX:Several variants within a single cell. EX:

E. coli has 7 sigmasE. coli has 7 sigmas B. subtilis has 10 sigmasB. subtilis has 10 sigmas

Different Different respond to different respond to different promoterspromoters

Sigma Variability in E. coliSigma Variability in E. coli Sigma70 (-35)TTGACA (-10)TATAAT

Primary sigma factor, or housekeeping sigma factor.

Sigma54 (-35)CTGGCAC (-10)TTGCA alternative sigma factor involved in transcribing

nitrogen-regulated genes (among others). Sigma32

heat shock factor involved in activation of genes after heat shock.

SigmaS (sigma38) stationary phase sigma factor. Activates genes involved in long term survival, eg.

peroxidase.

Sigma and Phage SP01Sigma and Phage SP01 Early promoter—recognized by Early promoter—recognized by

bacterial sigma factor. Transcription bacterial sigma factor. Transcription includes product, includes product, gp28gp28. .

gp28gp28 recognizes a phage promoter for recognizes a phage promoter for expression of mid-stage genes, expression of mid-stage genes, includingincluding

gp33/34gp33/34, which recognizes promoters , which recognizes promoters for late gene expression.for late gene expression.

Promoter Clearance and Promoter Clearance and ElongationElongation

Occurs after 4- 10 nt are addedOccurs after 4- 10 nt are added First rnt becomes unpaired from antisense First rnt becomes unpaired from antisense

(template) strand.(template) strand.DNA strands re-annealDNA strands re-anneal Polymerase loses sigma, sigma recycledPolymerase loses sigma, sigma recycled

Result “Closed hand” surrounds DNAResult “Closed hand” surrounds DNA NusA binds to core polymeraseNusA binds to core polymerase As each nt added to 3’, another is melted As each nt added to 3’, another is melted

from 5’, allowing DNA to re-anneal. from 5’, allowing DNA to re-anneal. RNA pol/NusA complex stays on until RNA pol/NusA complex stays on until

termination. Rate=20-50nt/second.termination. Rate=20-50nt/second.

TerminationTermination Occurs at specific sites on template Occurs at specific sites on template

strand called Terminatorsstrand called Terminators Two types of terminationTwo types of termination

Intrinsic terminatorsIntrinsic terminators Rho (Rho () dependent treminators) dependent treminators

Sequences required for termination Sequences required for termination are in transcribed regionare in transcribed region

Variation in efficiencies.Variation in efficiencies.

Intrinsic TerminatorsIntrinsic Terminators DNA template contains inverted repeats (G-C DNA template contains inverted repeats (G-C

rich)rich) Can form hairpinsCan form hairpins

6 to 8 A sequence on the DNA template that 6 to 8 A sequence on the DNA template that codes for Ucodes for U

Consequences of poly-U:poly-A stretch?Consequences of poly-U:poly-A stretch?

UUUUU

Intrinsic Intrinsic Termination Termination

RNA pol passes over RNA pol passes over inverted repeatsinverted repeats

Hairpins begin to Hairpins begin to form form in the in the transcripttranscript

Poly-U:poly-A Poly-U:poly-A stretch meltsstretch melts

RNA pol and RNA pol and transcript fall offtranscript fall off

Rho (Rho () Dependent ) Dependent TerminatorsTerminators

rho factor is ATP dependent rho factor is ATP dependent helicasehelicase

catalyses unwinding of RNA: DNA catalyses unwinding of RNA: DNA hybridhybrid

(17 bp)Rho Rho Dependent Dependent TerminatioTerminatio

nn rho factor rho factor is ATP is ATP dependent dependent helicasehelicase

catalyzes catalyzes unwinding unwinding of RNA: of RNA: DNA DNA hybridhybrid

50~90 50~90 nucleotidenucleotides/secs/sec

hexamer

Rho: Mechanism

Rho binds to transcript at loading site (up stream of terminator)

Hairpin forms, pol stalls

Rho helicase releases transcript and causes termination

Abortive initiation, elongation

mRNAmRNA Function—Transcribe message from DNA to Function—Transcribe message from DNA to

protein synthesis machineryprotein synthesis machinery CodonsCodons Bacterial—polycistronicBacterial—polycistronic Eukaryotic– monocistronicEukaryotic– monocistronic Leader sequence—non-translated at 5’ endLeader sequence—non-translated at 5’ end

May contain a regulatory region (attenuator)May contain a regulatory region (attenuator) Also untranslated regions at 3’ end.Also untranslated regions at 3’ end. Spacers (untranslated intercistronic Spacers (untranslated intercistronic

sequences)sequences) Prokaryotic mRNA—short livedProkaryotic mRNA—short lived Eukaryotic mRNA-can be long livedEukaryotic mRNA-can be long lived

Stable RNAStable RNA rRNA -Structural component of rRNA -Structural component of

ribosomesribosomes tRNA-Adaptors, carry aa to ribosometRNA-Adaptors, carry aa to ribosome SynthesisSynthesis

Promoter and terminatorPromoter and terminator Post-transcriptional modification (RNA Post-transcriptional modification (RNA

processing)processing) EvidenceEvidence

Both have 5’ monophospatesBoth have 5’ monophospates Both much smaller than primary transcriptBoth much smaller than primary transcript tRNA has unusual bases. EX pseudouridinetRNA has unusual bases. EX pseudouridine

Eukaryotic Eukaryotic TranscriptionTranscription

3 classes RNA pol (I-III)3 classes RNA pol (I-III) Many mRNA long livedMany mRNA long lived 5’ and 3’ ends of 5’ and 3’ ends of

mRNA modified. EX. mRNA modified. EX. 5’ cap5’ cap Poly-A tailPoly-A tail

Primary mRNA Primary mRNA transcript large, transcript large, introns removedintrons removed

MonocistronicMonocistronic

Eukaryotic TranscriptionEukaryotic Transcription Regulation very complexRegulation very complex Three different pols distinguished by Three different pols distinguished by

-amanitin sensitivity-amanitin sensitivity Pol I—rRNA, least sensitivePol I—rRNA, least sensitive Pol II– mRNA, most sensitivePol II– mRNA, most sensitive Pol III– tRNA and 5R RNA moderately Pol III– tRNA and 5R RNA moderately

sensitivesensitive Each polymerase recognizes a Each polymerase recognizes a

distinct promoterdistinct promoter

Eukaryotic RNA Eukaryotic RNA Polymerases Polymerases

RNA Pol. Location Products -Amanitin Sensitivity

Promoter

II NucleolusNucleolus Large rRNAs Large rRNAs (28S, 18S, (28S, 18S, 5.8S)5.8S)

InsensitiveInsensitive bipartite bipartite promoterpromoter

IIII NucleusNucleus Pre-mRNA, Pre-mRNA, some snRNAssome snRNAs

Highly Highly sensitivesensitive

UpstreamUpstream

IIIIII NucleusNucleus tRNA, small tRNA, small rRNA (5S), rRNA (5S),

snRNAsnRNA

Intermediate Intermediate sensitivitysensitivity

Internal Internal promoter and promoter and terminatorterminator

RNA Pol.RNA Pol. LocationLocation ProductsProducts--Amanitin Amanitin sensitivitysensitivity

II NucleolusNucleolusLarge rRNAs Large rRNAs

(28S, 18S, 5.8S)(28S, 18S, 5.8S)InsensitiveInsensitive

IIII NucleusNucleusPre-mRNA, some Pre-mRNA, some

snRNAs, snRNAs, snoRNAssnoRNAs

Highly Highly sensitivesensitive

IIIIII NucleusNucleustRNA, small tRNA, small rRNA (5S), rRNA (5S),

snRNAsnRNA

Intermediate Intermediate sensitivitysensitivity

Eukaryotic RNA PolymerasesEukaryotic RNA Polymerases