of October 4, 2017.This information is current as

Staphylococcus aureusRetinal Muller Glia to TLR2 Mediates the Innate Response of

Nazeem Shamsuddin and Ashok Kumar

http://www.jimmunol.org/content/186/12/7089doi: 10.4049/jimmunol.1100565May 2011;

2011; 186:7089-7097; Prepublished online 20J Immunol 

Referenceshttp://www.jimmunol.org/content/186/12/7089.full#ref-list-1

, 21 of which you can access for free at: cites 56 articlesThis article

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2011 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

The Journal of Immunology

TLR2 Mediates the Innate Response of Retinal Muller Glia toStaphylococcus aureus

Nazeem Shamsuddin* and Ashok Kumar*,†

Muller cells, the principal glia of the retina, play several key roles in normal and various retinal diseases. To date, their direct

involvement in retinal innate defense against bacterial pathogens has not been investigated. In this article, we show that Muller

cells express TLR2, a key sensor implicated in recognizing Gram-positive bacteria. We found that intravitreal injection of TLR2

agonist Pam3Cys and Staphylococcus aureus activated Muller glia in C57BL/6 mouse retina. Similarly, Pam3Cys or S. aureus

elicited the expression of TLR2 and activated the NF-kB and p38 MAPK signaling cascade. Concomitant with the activation of

signaling pathways, transcriptional expression and secretion of various proinflammatory cytokines (IL-6, TNF-a, and IL-1b),

chemokines (IL-8), and antimicrobial peptide (LL-37) were also induced in Muller glia. Importantly, the culture media derived

from TLR2-activated Muller glia exhibited robust bactericidal activity against S. aureus. Furthermore, use of neutralizing Ab,

small interfering RNA, and pharmacological inhibitors revealed that Muller glial innate response to S. aureus is mediated via the

TLR2–NF-kB axis. Collectively, this study for the first time, to our knowledge, establishes that the retinal Muller glia senses

pathogens via TLR2 and contributes directly to retinal innate defense via production of inflammatory mediators and antimicro-

bial peptides. The Journal of Immunology, 2011, 186: 7089–7097.

Staphylococci are a major constituent of extraocular flora,and they often gain access to the intraocular compartmentsdue to trauma or ocular surgery, leading to the development

of endophthalmitis (1). Among staphylococci, Staphylococcusaureus causes severe endophthalmitis, resulting in greatly di-minished or complete loss of visual acuity, despite therapeuticintervention (2). The overall incidence of endophthalmitis hasbeen reported to be between 0.056 and 1.3% after cataract surgery(3–5) and as high as 30% after trauma in a rural setting (6). Be-cause staphylococci are the primary organisms associated withpostoperative endophthalmitis and the potential cause for severevision loss, animal models of experimental staphylococcal endo-phthalmitis have been developed to investigate the pathogenesisand treatment of this disease (7, 8).The host–pathogen interaction in the retina has been the subject

of extensive research for the last several years (7), and studieshave been performed to define the role of various bacterial viru-lence factors (toxins, cell wall components) in the pathogenesisof endophthalmitis (9). In contrast, very few studies have in-vestigated the host response in this disease (2, 10). This is prob-ably because classically, the retina has been viewed as an immune-privileged tissue (i.e., when infectious organisms or tumor cells

are placed into the eye); the destructive immune response is at-tenuated, thus allowing for the preservation of vision (11). How-ever, recent new approaches and models have led to the increasedunderstanding of the mechanisms of ocular inflammation and in-nate immunity that are operative in the abrogation of immuneprivilege postinfection (12). The major protective mechanism thatcontrols the infiltration of inflammatory cells and macromoleculesinto the posterior segment of the eye is the blood–retina barrier(BRB) (13). Because the production of proinflammatory cytokinesand chemokines has been shown to contribute to BRB dysfunc-tion in uveitis (14, 15), the increased BRB permeability in endo-phthalmitis may also be a consequence of pathogen-inducedproduction of proinflammatory mediators (16). Thus, when BRBfunction is compromised, it will allow the infiltration of immunecells into the retina, resulting in massive inflammation as seen inpatients with infectious endophthalmitis (17). This inflammation,if not controlled, could lead to tissue destruction and vision loss(16). How pathogens are recognized and inflammation is initiatedin the retina are still not well defined. The retina, being a part ofthe CNS, must employ its resident glial cells (microglia, Mullerglia, or astroglia) for initial recognition and response to invadingpathogens. We hypothesized that retinal cells use TLRs for earlydetection and initiation of innate responses and recently showedthat TLR2 is an important component in providing retinal innatedefense against S. aureus by demonstrating that pretreatment ofthe mice with TLR2 ligands prevented the development of staph-ylococcal endophthalmitis (18).Because we have found that multiple cells (microglia, Muller

glia, and retinal pigment epithelium) in the retina express TLR2(18), they should be capable of responding toward S. aureus. Todate, the relative contribution of each cell type in retinal innatedefense is not known. Muller cells are the most abundant glial celltype in the retina. They span the entire thickness of the retina andhave secondary processes that closely wrap around neuronal cellbodies and dendrites. Muller cell gliosis has been proposed to beneuroprotective in the early stages after retinal injury, perhapsreflecting a cellular response to protect the tissue from furtherdamage (19, 20). Muller cells have also been shown to act as

*Department of Ophthalmology, Kresge Eye Institute, Wayne State University,Detroit, MI 48201; and †Department of Anatomy and Cell Biology, Wayne StateUniversity, Detroit, MI 48201

Received for publication February 24, 2011. Accepted for publication April 16, 2011.

This work was supported by National Institutes of Health Grant RO1 EY19888 (toA.K.), the Alliance for Vision Research (to A.K.), Research to Prevent Blindness (tothe Department of Ophthalmology, Kresge Eye Institute), and a vision core grant(P30 EY04068) from the National Eye Institute.

Address correspondence and reprint requests to Dr. Ashok Kumar, Department ofOphthalmology, Kresge Eye Institute, Wayne State University School of Medicine,4717 Saint Antoine, Detroit, MI 48201. E-mail address: akuma@med.wayne.edu

Abbreviations used in this article: AMP, antimicrobial peptide; BRB, blood–retinabarrier; GFAP, glial fibrillary acidic protein; HKSA, heat-killed Staphylococcus au-reus; Nod, nucleotide-binding oligomerization domain; Pam3Cys, Pam3Cys-Ser-(Lys)4 hydrochloride; PBST, PBS with Tween-20; siRNA, small interfering RNA.

Copyright� 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1100565

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

modulators of immune and inflammatory responses by producingproinflammatory cytokines (21). General signs of Muller cell ac-tivation are cellular hypertrophy, upregulation of glial fibrillaryacidic protein (GFAP), and the intermediate filament vimentin(22). Although some studies have shown that GFAP is increased inthe retina during bacterial endophthalmitis (23) and viral retinitis(24), no study has reported hitherto the direct involvement ofMuller glia in pathogen recognition. Thus, the current study wasaimed to assess the innate responses of Muller glia to S. aureus ora specific TLR2 ligand. Furthermore, we investigated the effect ofTLR2 activation on the innate defense against bacterial growth.Our findings demonstrate an active role of the retinal Muller gliaagainst bacterial infection and that TLR2-activated Muller glia-derived factors possess strong bactericidal properties.

Materials and MethodsBacterial strain and reagents

S. aureus strains RN 6390 and NCTC 8325 were maintained in tryptic soyabroth (Sigma-Aldrich, St. Louis, MO). Bacterial lipopeptide Pam3Cys-Ser-(Lys)4 hydrochloride (Pam3Cys), a synthetic lipopeptide that acts as anexclusive TLR2 agonist, was purchased from Invivogen (San Diego, CA).The NF-kB inhibitor isohelenin and p38 MAPK inhibitor SB203580 werepurchased from Calbiochem (Gibbstown, NJ). A mouse TLR2-neutralizingmAb (clone 2392) was a gift from Genentech (San Francisco, CA). Anti–phospho-p38 MAPK mAb, anti-p38 Ab, anti–phospho-IkBa, anti–IkBa,anti-TLR2, and HSP-90 Abs were purchased from Cell Signaling Tech-nology (Beverly, MA). A mouse monoclonal anti–b-actin Ab was pur-chased from Sigma-Aldrich. Polyclonal anti–LL-37 Ab was obtained fromPANATecs. Secondary HRP-conjugated anti-mouse or anti-rabbit IgG Abswere purchased from Bio-Rad (Hercules, CA).

Cell culture, treatment, and transfection

Spontaneously immortalized Human Muller Cell Line (MIO-M1), kindlyprovided by Dr. G. Astrid Limb, was maintained in DMEM (Hyclone, SouthLogan, UT) supplemented with L-glutamax (10%), FBS (10%; Bio-AbChem, Ladson, SC, and antibiotic mixture in a humidified 5% CO2

incubator at 37˚C (25). At the time of treatment, the culture medium wasreplaced with antibiotic-free and growth factor-free fresh DMEM withoutphenol red (Hyclone). At the indicated times (as shown in figures), cellswere processed for RNA extraction and protein preparation, and theconditioned media were collected for cytokine assays and antimicrobialassays. In blocking experiments, cells were incubated with 10 mg/mlTLR2-neutralizing or isotype-matched negative control Abs for 1 h at37˚C prior to stimulation with ligand or bacteria. In some experiments,cells were pretreated with NF-kB and p38 MAPK pathway inhibitors for30 min before challenge.

For small interfering RNA (siRNA) transfection, MIO-M1 cells platedon six-well dishes were transfected with nonspecific targeted or TLR2-specific siRNA (Dharmacon, Lafayette, CO) with Lipofectamine RNAi-MAX (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruc-tions. After 48 h of transfection, cells were kept in DMEM containingL-glutamax (10%) and FBS (10%) overnight, followed by challengewith bacteria.

RNA extraction and RT-PCR analysis

Total RNA was isolated from MIO-M1 cells using the TRIzol solutionaccording to the manufacturer’s instructions (Invitrogen), and 2 mg totalRNA was reverse-transcribed with a first-strand synthesis system for RT-PCR (SuperScript; Invitrogen). cDNA was amplified using human specificprimers (Table I). The PCR products and internal control GAPDH weresubjected to electrophoresis on 1.2% agarose gels containing ethidiumbromide. Stained gels were captured using a digital camera (EDAS 290system; Eastman Kodak, Rochester, NY), and band intensity was quanti-fied using ImageJ analysis software (National Institutes of Health).

Flow cytometry analysis

MIO-M1 cells treated with or without ligands were dispensed in Eppendorftubes and were centrifuged at 100 3 g at 4˚C for 5 min. Cells were thenresuspended in PBS containing 1% BSA. The cells were then blocked in10% serum for 30 min at room temperature. The cells were then washed,resuspended in PBS containing anti-TLR2 Ab or isotype-matched IgG(Santa Cruz Biotechnology, Santa Cruz, CA) (1:20 dilution) and were

incubated overnight at 4˚C. Cells were washed and incubated with thecorresponding secondary FITC-conjugated Ab (Invitrogen) (1:200 di-lution) for 30 min. A BD LSR II flow cytometer (ImmunocytometrySystems; BD Biosciences, San Jose, CA) was used for cytometric analysis.

Western and dot blot analysis

MIO-M1 cell lysates were prepared with radioimmunoprecipitation assaybuffer (150 mM NaCl, 100 mM Tris-HCl [pH 7.5], 1% deoxycholate, 0.1%SDS, 1% Triton X-100, 50 mM NaF, 100 mM sodium pyrophosphate, 3.5mM sodium orthovanadate, proteinase inhibitor cocktails [Sigma-Aldrich],and 0.1 mM PMSF), and protein concentration was determined using theBCA assay (micro BCA; Pierce, Rockford, IL). Proteins (30–40 mg/well)were separated by SDS-PAGE in Tris/glycine/SDS buffer (25 mM Tris,250 mM glycine, and 0.1% SDS) and electroblotted onto nitrocellulosetransfer membranes (Bio-Rad). After blocking for 1 to 2 h in PBS withTween-20 (PBST) (20 mM Tris-HCl, 150 mM NaCl, and 0.5% Tween)containing 5% nonfat milk, the blots were probed overnight at 4˚C withdesired Abs as described by the manufacturers (Cell Signaling Technol-ogy; Sigma-Aldrich). NF-kB activation was determined in terms of in-hibitory IkBa phosphorylation and degradation using anti-IkBa and anti–phospho-IkBa Abs. After washing three times in PBST, membranes wereincubated with secondary HRP-conjugated anti-mouse or anti-rabbit IgGAbs (Bio-Rad) for 1 h. After washing with PBST four times for 10 mineach, proteins were visualized with Super Signal reagents from Pierce.

Accumulation of LL-37 in the culture media of TLR2 ligand andbacteria-treated MIO-M1 cells was detected by immunoblotting as de-scribed previously (26). Briefly, culture media were collected posttreat-ment, centrifuged, and 100 ml was applied to a nitrocellulose membrane(0.2 mm; Bio-Rad) by vacuum using a dot blot apparatus (Bio-Rad). Themembrane was fixed by incubating with 10% formalin for 2 h at roomtemperature followed by blocking in TBS containing 5% nonfat powderedmilk for 1 h at room temperature. The membrane was then incubatedovernight at 4˚C with rabbit anti-LL-37 diluted 1:4000 in TBS containing5% nonfat powdered milk, 5% goat serum, 0.05% Tween-20, and 0.02%sodium azide. After washing, the membrane was incubated for 1 h at roomtemperature with goat anti-rabbit IgG conjugated to HRP diluted 1:2000with 5% nonfat powdered milk. Immunoreactivity was visualized withSuper Signal reagents from Pierce.

ELISA for cytokine analysis

MIO-M1 cells were plated (53 106 cells per well) in six-well plates. Aftergrowth factor starvation, cells were challenged with Pam3Cys or live/heat-killed S. aureus (HKSA) for various times, and culture media were col-lected for measurement of human TNF-a, IL-1b, IL-6, and IL-8 byELISA. The cells were lysed, and protein concentration was determined. Insome experiments prior to stimulation, MIO-M1 cells were pretreated withTLR2-neutralizing Ab or NF-kB/P-38 MAPK pathway inhibitors as de-scribed above. ELISAs were performed according to the manufacturer’sinstructions (R&D Systems, Minneapolis, MN). The amounts of cytokinesin culture media were expressed as picograms per milligram of cell lysate.All values were expressed as mean 6 SD. Statistical analysis was per-formed using the Student t test.

Immunofluorescence staining

Retinal cryosections were rinsed in PBS and blocked for 1 h in blockingbuffer (10% [v/v] normal goat serum, 0.3% [v/v] Triton X-100 in PBS) atroom temperature. The slides were then incubated overnight with anti-GFAP (DakoCytomation) or anti-vimentin (Sigma-Aldrich) Ab at 4˚C.Following removal of the primary Abs, slides were extensively washed andincubated for 1 h in fluorescent-conjugated secondary Abs (FITC) at roomtemperature. After several washing steps in PBS, the slides were mountedin Vectashield antifade mounting medium (Vector Laboratories, Burlin-game, CA) and visualized using a confocal system (Leica Microsystems,Wetzlar, Germany).

For in vitro staining, MIO-M1 cells cultured on glass chamber slides(Fisher Scientific, Rochester, NY) were stimulated with Pam3Cys or live/heat-killed bacteria for indicated time periods. Cells were washed threetimes with PBS and then fixed for 15 min in PBS with 4% para-formaldehyde. After washing with gentle shaking, cells were permeabilizedfor 5 min with ice-cold methanol and washed. The fixed cells were thenblocked in 5% (w/v) serum for 1 h at room temperature followed by in-cubation with TLR2 (Santa Cruz Biotechnology) (1:200 dilution), LL-37(PANATecs) (1:100 dilution), and vimentin (Sigma-Aldrich) (1:200 di-lution) Abs overnight at 4˚C. In control experiments, cells were incubatedwith nonimmune IgG as isotype controls (Santa Cruz Biotechnology;Imgenex, San Diego, CA). Following removal of the primary Abs, the cells

7090 TLR2 AND RETINAL MULLER GLIA

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

were then extensively washed with PBS and incubated for 1 h with specificFITC-conjugated secondary Abs (1:200 dilution) at room temperature.Finally, the cells were washed extensively with PBS, and the slides weremounted in Vectashield antifade mounting medium (Vector Laboratories)and visualized using a confocal system (Leica Microsystems).

Zone of inhibition assay

The antibacterial activity of conditioned media derived from control orTLR2-activated MIO-M1 cells was tested against S. aureus strains (RN6390 and NCTC 8325) by measuring the zone of inhibition using the discdiffusion method (27). Briefly, bacterial inoculum was prepared from brothcultures, and ∼1 3 106 CFU/ml were applied as a lawn using platespreader. The sterile discs soaked with 10 ml culture media derived from 1million MIO-M1 cells grown in 1 ml media were placed on the surface ofbacterial lawn culture. Gentamicin (10 mg/disc) was used as standardantibiotic positive control. The plates were incubated overnight at 37˚C,and diameters of inhibition zones were measured. The p values werecalculated using the Student t test.

ResultsS. aureus and TLR2 ligand activate Muller glia in C57BL/6mouse retina

GFAP-positive staining in Muller cells has been used as a reliableindicator of acute and chronic retinal pathology (19). Under normalconditions, Muller glia express GFAP only in their endfeet. Butwhen pathologic events occur, they alter their characteristics tobecome reactive glial cells and express GFAP in cell bodies andprocesses. To assess whether TLR2 activation influences GFAPlevels in vivo, mice were given intravitreal injection of a TLR2ligand, Pam3Cys, or S. aureus. The cell bodies and radially ori-ented processes (arrows in Fig. 1) of the Muller cells were notstained with GFAP Ab in the control, PBS-injected mice. Incontrast, Muller glial processes became GFAP positive in micechallenged with Pam3Cys or S. aureus. Moreover, the responsewas concentration dependent, as increasing Pam3Cys dosage in-creased GFAP expression accordingly in Muller glia processes.

S. aureus and Pam3Cys induce TLR2 expression in Muller glia

TLR2 along with TLR1 and TLR6 plays a key role in innatedefense against Gram-positive bacteria. To determine whetherMuller glia expresses these receptors, RT-PCR analysis was per-formed using the human retinal Muller glia cell line, MIO-M1. Asshown in the Fig. 2A, compared with the control (untreated) cells,the expression of TLR2 mRNAwas significantly increased in bothPam3Cys and S. aureus-stimulated cells at 4 h and remained el-evated up to 24 h (data not shown). In contrast, the expressionlevels of TLR1 and TLR6 did not change during the course ofthe study. We also performed the semiquantitative densitometric

analysis by normalizing induced TLR2 mRNA to internal controlGAPDH mRNA. Clearly, stimulation of MIO-M1 cells by both S.aureus and Pam3Cys for 4 h upregulated TLR2 expression by.2.5-fold (Fig. 2B). The induced expression of TLR2 at theprotein level was detected by Western blotting using an anti-TLR2Ab (Fig. 2C); the exposure of MIO-M1 cells to S. aureus orPam3Cys for 4 and 8 h resulted in an increase in the levels ofTLR2. To provide further evidence of induced TLR2 expression,we also performed immunohistochemistry (Fig. 2C) and flowcytometry (Fig. 2D) on MIO-M1 cells, which showed that bothPam3Cys and S. aureus stimulation augmented TLR2 expression.

S. aureus and Pam3Cys induce NF-kB and MAPK signaling inMuller glia

The expression of TLR2 in Muller glia cells suggests that thesecells would be responsive to TLR2 agonist-mediated signaling. Totest this hypothesis, we measured the ability of Pam3Cys and S.aureus to activate NF-kB and MAPK (Fig. 3). First, we challengedthe MIO-M1 cells with increasing concentrations of Pam3Cys andshowed that these cells were responsive to Pam3Cys at levels aslow as 0.01 mg/ml as measured by IkBa phosphorylation, an in-dicator of NF-kB activation. Treatment of MIO-M1 cells with 1 or10 mg/ml Pam3Cys resulted in the maximum phosphorylation ofIkBa (Fig. 3A). A similar concentration-dependent trend wasobserved on the phosphorylation of p38, a member of the MAPKfamily.Time-course studies of the Muller glia response to Pam3Cys

(Fig. 3B) and S. aureus (Fig. 3C) were also performed. MIO-M1cells stimulated with 10 mg/ml Pam3Cys resulted in IkBa phos-phorylation detectable at 15 min, and its levels remained elevatedat 90 min poststimulation. Accompanying the increase in IkBaphosphorylation, IkB-degradation was observed 30 min post-stimulation and was maximal at 90 min (Fig. 3B). Time-dependentIkBa phosphorylation and degradation was also observed in MIO-M1 cells challenged with live S. aureus (Fig. 3C). The time courseof p38 phosphorylation was similar to that of IkBa, with maximalactivation detected 90 min after stimulation. Together, thesefindings demonstrate that TLR2 stimulation of Muller glia inducesphosphorylation of IkBa and MAPKs within a similar time frame.

Muller glia produces inflammatory mediators in response toS. aureus and Pam3Cys challenge

To assess the biological relevance of induced NF-kB and p38MAPK signaling, we determined the effects of S. aureus andPam3Cys on the expression and secretion of proinflammatorycytokines using RT-PCR. Compared to the controls (Fig. 4, laneC, Table I), both Pam3Cys and S. aureus induced the expression ofIL-6, IL-8, TNF-a, and IL-1b in a time-dependent manner (Fig.4). The mRNA levels of GAPDH (internal control) remainedlargely unchanged in both control and stimulated cells (Fig. 4).The protein levels of induced cytokines were assessed by ELISA.Significantly increased amounts of IL-6, IL-8, TNF-a, and IL-1baccumulated in the culture media (Fig. 5) of MIO-M1 cellschallenged with Pam3Cys and live or HKSA. The response is timedependent and compared with Pam3Cys, S. aureus (live and heat-killed) appeared to be a stronger inducer of cytokine secretion inMIO-M1 cells. Taken together, these results indicate that theMuller glia is responsive to TLR2 agonists via the expression andproduction of proinflammatory cytokines and chemokines.

S. aureus-induced inflammatory response in Muller glia ismediated by TLR2 and NF-kB

Having shown that both Pam3Cys and S. aureus activated down-stream signaling pathways and induced the production of

FIGURE 1. S. aureus and TLR2 agonist enhance GFAP levels in mouse

retina. C57BL/6 mice were given intravitreal injections of PBS (vehicle),

TLR2 agonist (Pam3Cys), or S. aureus (SA). After 16 h, eyes were enu-

cleated, embedded in OCT, and cryosections were stained with rabbit

polyclonal anti-GFAPAb. Immunoreactivities are increased in Pam3 or SA

challenged retina compared with the PBS controls. Moreover, Muller cell

bodies and radial running processes (arrowheads) in the INL and ONL

were immunopositive. H&E staining was used as a guide to the retinal

layers (original magnification 320). ELM, external limiting membrane;

GCL, ganglion cell layer; INL, inner nuclear layer; IPL, inner plexiform

layer; ONL, outer nuclear layer; OPL, outer plexiform layer.

The Journal of Immunology 7091

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

inflammatory mediators, we next determined whether TLR2 isrequired for this response. In the presence of functional blockingAb against TLR2, the production of IL-8 was reduced 62 and 82%in cells challenged with live S. aureus (Fig. 6A) or HKSA (Fig.6B), respectively. In addition to Ab-mediated inhibition of TLR2signaling, we also used the siRNA approach to knock down TLR2expression. MIO-M1 cells were transfected with TLR2 siRNA ornontargeted (scrambled) siRNA control and then challenged withS. aureus or HKSA for 8 h. As shown in Fig. 6C, the siRNAspecifically knocked down the TLR2 expression with no effect onthe mRNA levels of the housekeeping gene GAPDH. Consistentwith reduced TLR2 expression, siRNA-transfected cells secretedsignificantly reduced levels of IL-8 compared with nontransfectedor scrambled siRNA control (Fig. 6A, 6B). A similar trend was

observed for the levels of IL-6 (Fig. 6C, 6D). These results in-dicate that functional blocking of TLR2 inhibits S. aureus-inducedproduction of inflammatory mediators by Muller glia.TLR2 engagement leads to the activation of both NF-kB and

p38 MAPK signaling pathways (Fig. 3). To evaluate the relativecontribution of NF-kB and MAPK signaling, MIO-M1 cells werepretreated with the NF-kB (isohelenin) or p38 MAPK (SB203580)inhibitors followed by S. aureus challenge. NF-kB inhibitor ef-fectively blocked both live S. aureus and HKSA-induced pro-duction of IL-8 by 85 and 92%, respectively. In contrast, p38MAPK inhibitor partially attenuated IL-8 secretion by 60 and 70%in Muller glia challenged with live S. aureus (Fig. 6A) or HKSA,respectively (Fig. 6B). These results confirm the roles of NF-kBand p38 in S. aureus-induced inflammatory response in Mullerglia.

TLR2 activation induces the expression of the antimicrobialpeptide LL-37 in Muller glia

Besides inducing proinflammatory mediator release, anotherconsequence of TLR activation is the production of antimicrobialpeptides (AMPs) (18). Thus, we next sought to determine theexpression and production of LL-37 in TLR2-activated Mullerglia. As shown in Fig. 7A, both Pam3Cys and S. aureus challengeresulted in a time-dependent expression of LL-37 mRNA detected

FIGURE 2. S. aureus and Pam3Cys upregulate

TLR2 expression in cultured retinal Muller glia. Hu-

man retinal Muller glia cell line (MIO-M1) was

challenged with Pam3Cys (10 mg/ml), live S. aureus

(SA), or HKSA for indicated time points. A, Total

RNAwas extracted, reverse-transcribed, and subjected

to PCR analysis with primers specific for various TLRs

and GAPDH as the control. PCR products were sep-

arated by electrophoresis and stained with ethidium

bromide. B, The band intensity of PCR products was

quantitated by densitometric analysis and presented as

relative band intensity of TLR2 versus GAPDH. C,

MIO-M1 cells challenged with Pam3Cys or SA were

lysed for Western blotting analysis using anti-TLR2

and b-actin (control) Abs. Immunostaining (D) and

flow cytometry (E) evidence of induced TLR2 ex-

pression in stimulated MIO-M1 cells (see Materials

and Methods for detail). Original magnification 320.

Results are representative of two independent experi-

ments. MFI, mean fluorescent intensity.

FIGURE 3. NF-kB and p38 MAPK signaling is activated in Pam3Cys or

S. aureus-challenged Muller glia. MIO-M1cells were stimulated with

Pam3Cys (A, B) or live S. aureus (C) for the indicated concentration or

time points. The cells were lysed for Western blot analysis using Abs

against phospho-IkBa (P-IkB) and phospho-p38 (P-p38). Abs against

nonphosphorylated IkB and p38 were used to detect their total levels and

Hsp-90 was used as an equal protein loading control. MIO-M1 cells

challenged with Pam3Cys or SA showed significant activation of NF-kB

and p-38 signaling pathways, both in a concentration- and time-dependent

manner. The data shown are representative of duplicate experiments.

FIGURE 4. TLR2-activated Muller glia express proinflammatory cyto-

kine genes. MIO-M1 cells were stimulated with Pam3Cys (10 mg/ml) or

live S. aureus (SA; 50 multiplicity of infection) for the indicated times. A,

Total RNAwas extracted, reverse transcribed, and amplified using specific

primers (Table I), with GAPDH as the control. PCR products were sepa-

rated by electrophoresis and stained with ethidium bromide. B, The band

intensity of PCR products were quantitated by densitometric analysis and

presented as relative band intensity of cytokines versus GAPDH. MIO-M1

cells expressed the proinflammatory cytokines/chemokines IL-6, IL-8,

TNF-a, and IL-b in response to S. aureus and TLR2 agonist. Results

shown are representative of three independent experiments.

7092 TLR2 AND RETINAL MULLER GLIA

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

by RT-PCR. Consistent with upregulation of LL-37 mRNA, thedot blot assay revealed that the secreted (active) form of LL-37accumulated in the culture media of stimulated MIO-M1 cells ina time-dependent manner (Fig. 7B). S. aureus induced a rapid(within 1 h) increase in LL-37 peptide, whereas Pam3 stimulationincreased levels of LL-37 after 4 h. To further ascertain the ex-pression of LL-37, we performed immunohistochemistry of cul-tured Muller glia using an anti–LL-37 Ab. Consistently, ourimmunofluorescence data also show the expression and upregu-lation of LL-37 in Muller glia (Fig. 7C).

Conditioned medium of TLR2-activated Muller glia possessesbactericidal activity

Because Pam3Cys and S. aureus-challenged Muller glia produceAMPs, we speculated that TLR2-activated Muller glia wouldexhibit more inherent antibacterial activity than unstimulatedcells. To test the bactericidal activity of Muller glia-conditionedmedia, we used a qualitative zone of inhibition assay (28). Theconditioned media derived from Pam3Cys, HKSA, or S. aureus-

treated MIO-M1 cells significantly inhibited the growth of two S.aureus strains NCTC 8325 and RN 6390 (Fig. 8). Importantly,stimulation with Pam3Cys exhibited the strongest antistaphylo-coccal activity, followed by HKSA and live S. aureus.

DiscussionMuller cells constitute a functional link between neurons and bloodvessels and are responsible for maintaining the homeostasis of theretinal extracellular milieu (29, 30). Despite the important role ofMuller glia in various retinal diseases (31), their role in bacterialendophthalmitis is largely unknown. In this study, for the firsttime, to our knowledge, we report that Muller glia actively par-ticipate in retinal innate defense against bacterial pathogens viathe action of TLRs. We demonstrated that S. aureus and TLR2ligand challenge upregulate TLR2 expression in Muller glia.Moreover, exposure of Muller glia to S. aureus or Pam3Cysresulted in the activation of NF-kB and p38 MAPK signalingpathways and an increased expression and secretion of variousproinflammatory cytokines and chemokines (IL-6, IL-8, TNF-a,

Table I. Sequences and product sizes of PCR primers

Gene Primer Sequence (59–39) Product Size (bp) Temp (˚C)

TLR1 F: TTACTCCCGGAGGCAATGCTGCT 662 55R: TAAGTGTGTGGTGCTCAACCCCA

TLR2 F: GTGGCCAGCAGGTTCAGGATG 641 55R: AGGACTTTATCGCAGCTCTCAG

TLR6 F: CCTCAACCACATAGAAACGAC 531 55R: CACCACTATACTCTCAACCCAA

TNF-a F: GAAAGCATGATCCGGGACGTG 510 55R: GATGGCAGAGAGGAGGTTGAC

IL-1b F: AAACAGATGAAGTGCTCCTTCCAGG 390 55R: TGGAGAACACCACTTGTTGCTCCA

IL-6 F: CTCCTTCTCCACAAGCGCCTTC 583 55R: GCGCAGAATGAGATGAGTTGTC

IL-8 F: GCAGTTTTGCCAAGGAGTGCTA 347 55R: GCATCTGGCAACCCTACAACAAG

LL-37 F: ATCATTGCCCAGGTCCTCAG 251 62R: GTCCCCATACACCGCTTCAC

GAPDH F: CACCACCAACTGCTTAGCAC 515 55R: CCCTGTTGCTGTAGCCAAAT

F, forward; R, reverse.

FIGURE 5. S. aureus and Pam3Cys induced cytokine secretion in Muller glia. MIO-M1 cells were stimulated with Pam3Cys (10 mg/ml), live S. aureus

(SA), or HKSA for indicated time points. Culture supernatants were used to quantitate indicated cytokines/chemokines accumulation by ELISA, and cells

were lysed to determine protein concentration. The levels of cytokines are expressed in picograms per milligrams of cell lysate, and the results represent

data (mean 6 SD) from three independent experiments performed in triplicate. Statistical analysis was performed using the Student t test, and indicated

statistical differences are comparisons of stimulated versus unstimulated control (C). *p , 0.05, **p , 0.001.

The Journal of Immunology 7093

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

and IL-1b). To better understand the involvement of TLRs in theMuller glial innate immune response, we used TLR2-neutralizingAb and siRNA approaches and showed that the Muller glial innateresponse to S. aureus is TLR2 dependent. The novel finding in thisstudy is that TLR2-activated Muller glia produced the AMP LL-37, and their conditioned media exhibited profound bactericidalactivity against S. aureus. To the best of our knowledge, this is thefirst study to demonstrate this phenomenon.Three types of glial cells (Muller, astrocytes, and microglia) are

found in the retina. Compared to other cell types, Muller cells arespecialized radial glial cells that span the entire thickness of theretina and contact/ensheath all retinal neurons and capillaries (32).Because the Muller cell endfeet (Fig. 1) lie in the inner limitingmembrane (33) next to the vitreous and in close proximity to in-vading pathogens, we reasoned that Muller glia should possess theability to sense and quickly respond to infectious stimuli. Our datademonstrated that intravitreal injection of Pam3Cys- or S. aureus-enhanced GFAP expression in the mouse retina, an indicative ofthe responsiveness of Muller glia in vivo. However, it should benoted that retinal astrocytes also express GFAP. Thus, the abun-dant GFAP immunoreactivity, as seen in the ganglion cell layer,may also be contributed by astrocytes, due to the intertwining ofastrocyte processes with the endfeet of the Muller cells (Fig. 1).Although the radial pattern of GFAP immunoreactivity is sug-

gestive of retinal Muller cells, to confirm their identity, we alsoperformed additional immunohistochemical studies using an anti-vimentin Ab and found that GFAP colocalizes with vimentin (datanot shown). Furthermore, using cultured Muller glial cells, themajor finding of our study is that these cells recognize and respondto S. aureus by expressing and secreting proinflammatorycytokines/chemokines and the cathelicidin (LL-37) AMP. LL-37may eliminate the invading bacteria through their direct antimi-crobial action; the cytokines released by the Muller glia may re-cruit immune cells to the retina. Hence, our findings suggest anactive role of Muller glia in innate defense against bacterial in-fection in the retina.S. aureus produces a variety of virulence factors that are either

cell wall-associated molecules or secreted bacterial proteins(toxins), and their coordinated action leads to the manifestation ofstaphylococcal infections (34). Previous studies by Booth et al.(35, 36) showed the importance of the toxins in the pathogenesisof staphylococcal endophthalmitis. Because the toxins are pro-duced during the stationary phase of bacterial growth, the earlyinnate immune response must be initiated by cell wall-associatedcomponents (37). Consistent with these studies, our data showedthat both Pam3Cys (a synthetic bacterial lipopeptide) and HKSAinduced an inflammatory response in Muller glia, indicating therole of cell wall components. How do retinal cells recognize these

FIGURE 6. S. aureus-induced inflammatory response is attenuated by inhibition of TLR2 and NF-kB signaling. MIO-M1 cells were pretreated for 1 h

with isotype (10 mg/ml), anti-TLR2 (10 mg/ml), p38 MAPK (5 mM) and NF-kB (25 mM) pathway inhibitors followed by challenge with live S. aureus (SA;

A, C) or HKSA (B, D). After 8 h of stimulation, culture supernatants were collected, and IL-8 and IL-6 levels were quantitated by ELISA. For siRNA

transfection, MIO-M1 cells were transfected with nontargeted siRNA (NT-siRNA) or TLR2-siRNA for 48 h, followed by challenge with SA or HKSA for 8

h. TLR2 knockdown was assessed by RT-PCR (E). Data are means 6 SD of triplicate cultures and representative of three independent experiments.

Statistical analysis was performed using the Student t test, and indicated statistical differences are comparisons of isotype versus TLR2 Ab, NT-siRNA

versus TLR2-siRNA, and untreated versus inhibitor treated cells: *p , 0.05, **p , 0.001.

7094 TLR2 AND RETINAL MULLER GLIA

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

bacterial cell wall components? Based on previous studies fromour laboratory (26, 38, 39) and others (40–42), we postulated thatTLR2 may be a major receptor involved in responses to Gram-positive bacterial infections and demonstrated that Muller gliaexpress TLR2 and its coreceptors TLR1 and -6. Considering thefact that the retina is usually not exposed to the outside environ-ment, one might expect TLRs to be expressed at basal levels innormal retinal cells, and their activation will result in the upreg-ulation of the same or different TLRs. Indeed, we observed up-regulation of TLR2 expression in Muller glia following S. aureusand TLR2 agonist stimulation. This increased TLR2 expressionmay facilitate more efficient pathogen recognition and rapid ini-tiation of the innate immune response. Thus, our data suggest thatTLR2 expression by Muller glia may be involved in the host de-fense against S. aureus infection.

TLR2 is an important receptor for the recognition of staphy-lococcal cell wall components. However, based on the observationthat astrocytes or macrophages from TLR2-deficient mice stimu-lated by S. aureus still produce proinflammatory mediators (42,43), it was suggested that other receptors might also be involved inS. aureus recognition. In this study, we showed that treatment ofMuller glia with either TLR2-neutralizing Ab or siRNA knock-down of TLR2 almost completely (80–90%) abrogated the pro-duction of inflammatory cytokines induced by HKSA- andPam3Cys- (data not shown) but not live S. aureus-challenged cells(Fig. 6), suggesting the involvement of other receptors for liveS. aureus. One potential candidate receptor could be nucleotide-binding oligomerization domain (Nod)-like receptors, specificallyNod2, which has been shown to regulate the innate immune re-sponse against bacterial pathogens in a TLR-independent manner(44). Moreover, studies have reported the expression of Nod2 inocular tissues (45) and its role in uveitis (46, 47). Because TLRsare involved in the recognition of pathogens in the extracellularcompartment, whereas Nod-like receptors detect the microbialligands intracellularly (48), we propose that TLR2 is the majorreceptor for detection of S. aureus in Muller glia, and the earlyinnate response is generated by this receptor. Whether Nod2 playsa role in the Muller glial innate response toward S. aureus war-rants further investigation.The outcome of host–pathogen interactions frequently leads to

the release of proinflammatory mediators that play a key role inthe recruitment of immune cells to control infection. In addition tothe inflammatory response, TLR activation also leads to the pro-duction of AMPs. The two best-characterized families of AMPsare defensins (49) and cathelicidins (50, 51). Cathelicidins areconstitutively expressed at high levels by neutrophils (52), andtheir expression at the mucosal surfaces is induced in response toinfection or injury (53, 54). In the current study, we showed thatstimulation of Muller glia by S. aureus and the TLR2 ligandsignificantly upregulated the expression of LL-37 mRNA andprotein. Furthermore, detection of the LL-37 (the active secretedform) in the conditioned media of TLR2-activated Muller gliasuggests that the mechanism for processing cathelicidin to LL-37peptide is also activated in Muller glia. This corroborates theresults we observed in our recent study whereby intravitreal

FIGURE 8. Conditioned medium from TLR2-activated Muller glia

possess bactericidal activity against S. aureus. Filter discs, soaked with 10

ml conditioned media from unstimulated (Cont; disc number 1), Pam3Cys

(disc number 3), HKSA (disc number 4), and SA (disc number 5), chal-

lenged MIO-M1 cells were placed on the agar plates containing lawn

culture of S. aureus strains RN6390 or NCTC 8325. Disc containing 10 mg

gentamicin (Gen; disc number 2) was used as a positive control. A, After

overnight incubation, the diameters of inhibition zones around the media-

soaked filters were measured and presented as means 6 SD (n = 5). B,

Representative plates showing inhibition zone. Student t test was used, and

indicated statistical differences are comparisons of unstimulated (Cont)

versus TLR2 agonist-stimulated cells. *p , 0.001.

FIGURE 7. S. aureus- and Pam3Cys-stimulated Muller glia express AMP LL-37. MIO-M1 cells were challenged with Pam3Cys (10 mg/ml), live S.

aureus (SA), or HKSA for indicated time points. A, Total RNAwas extracted, reverse-transcribed, and subjected to PCR analysis with primers specific for

LL-37 and GAPDH. PCR products were separated by electrophoresis and stained with ethidium bromide. The secretion of LL-37 in culture supernatant was

detected by dot blot (B), and the intensity of the dots were quantitated by densitometric analysis (C) and presented as fold increase by using a value of 1 for

the control (0 h) sample. D, Immunostaining evidence of induced LL-37 expression in Pam3Cys- or HKSA-stimulated MIO-M1 cells (see Materials and

Methods for details). Original magnification 320. Shown are representative of two independent experiments.

The Journal of Immunology 7095

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

injection of Pam3Cys induced Camp (murine homolog of humanLL-37) expression in mouse retina (18). In this study, we alsoshowed that the culture media derived from TLR2-activatedMuller glia profoundly inhibited S. aureus growth. Because LL-37 is a multifunctional protein (55), it is not clear at this stagewhether the observed bactericidal effect is primarily due to LL-37or in synergism with other antimicrobial agent (56). To the best ofour knowledge, this is the first demonstration that retinal Mullerglia secretes AMPs.In summary, our findings suggest that in response to Gram-

positive bacterial infection, Muller glia cells upregulate TLR2expression. The increased expression of TLR2 may result in anincreased Muller glial reactivity toward proliferating bacteria in thevitreous, leading to the secretion of AMPs that may directly kill theinvading pathogen, and the expression of inflammatory mediatorsmay induce infiltration of neutrophil and other immune cell into theretina. Thus, with respect to infectious endophthalmitis, potentialprophylactic and/or therapeutic strategies may include enhance-ment of retinal innate immunity by activating TLR signalingpathways.

AcknowledgmentsWe thank Dr. G. Astrid Limb (Institute of Ophthalmology and Moorfields

Eye Hospital, London, U.K.) for providing MIO-M1 cells and Drs. Fu-shin

Yu, Jia Yin, and Gi Sang Yoon (Kresge Eye Institute) for reading the man-

uscript. We also thank Jacob Blair and Travis Kochan for providing tech-

nical support in this study.

DisclosuresThe authors have no financial conflicts of interest.

References1. Graham, J. E., J. E. Moore, X. Jiru, J. E. Moore, E. A. Goodall, J. S. Dooley,

V. E. Hayes, D. A. Dartt, C. S. Downes, and T. C. Moore. 2007. Ocular pathogenor commensal: a PCR-based study of surface bacterial flora in normal and dryeyes. Invest. Ophthalmol. Vis. Sci. 48: 5616–5623.

2. Whiston, E. A., N. Sugi, M. C. Kamradt, C. Sack, S. R. Heimer, M. Engelbert,E. F. Wawrousek, M. S. Gilmore, B. R. Ksander, and M. S. Gregory. 2008.alphaB-crystallin protects retinal tissue during Staphylococcus aureus-inducedendophthalmitis. Infect. Immun. 76: 1781–1790.

3. Montan, P. G., G. Koranyi, H. E. Setterquist, A. Stridh, B. T. Philipson, andK. Wiklund. 1998. Endophthalmitis after cataract surgery: risk factors relating totechnique and events of the operation and patient history: a retrospective case-control study. Ophthalmology 105: 2171–2177.

4. Zhang, Y., M. N. Zhang, C. H. Jiang, Y. Yao, and K. Zhang. 2010. Endoph-thalmitis following open globe injury. Br. J. Ophthalmol. 94: 111–114.

5. Javitt, J. C., S. Vitale, J. K. Canner, D. A. Street, H. Krakauer,A. M. McBean, and A. Sommer. 1991. National outcomes of cataract ex-traction. Endophthalmitis following inpatient surgery. Arch. Ophthalmol.109: 1085–1089.

6. Boldt, H. C., J. S. Pulido, C. F. Blodi, J. C. Folk, and T. A. Weingeist. 1989.Rural endophthalmitis. Ophthalmology 96: 1722–1726.

7. Callegan, M. C., M. S. Gilmore, M. Gregory, R. T. Ramadan, B. J. Wiskur,A. L. Moyer, J. J. Hunt, and B. D. Novosad. 2007. Bacterial endophthalmitis:therapeutic challenges and host-pathogen interactions. Prog. Retin. Eye Res. 26:189–203.

8. Giese, M. J., and B. J. Mondino. 2001. Experimental staphylococcal endoph-thalmitis. Ophthalmologica 215: 321–336.

9. Callegan, M. C., D. C. Cochran, S. T. Kane, R. T. Ramadan, J. Chodosh,C. McLean, and D. W. Stroman. 2006. Virulence factor profiles and antimi-crobial susceptibilities of ocular bacillus isolates. Curr. Eye Res. 31: 693–702.

10. Engelbert, M., and M. S. Gilmore. 2005. Fas ligand but not complement iscritical for control of experimental Staphylococcus aureus Endophthalmitis.Invest. Ophthalmol. Vis. Sci. 46: 2479–2486.

11. Streilein, J. W. 2003. Ocular immune privilege: therapeutic opportunities froman experiment of nature. Nat. Rev. Immunol. 3: 879–889.

12. Hazlett, L. D., and R. L. Hendricks. 2010. Reviews for immune privilege in theyear 2010: immune privilege and infection. Ocul. Immunol. Inflamm. 18: 237–243.

13. Gregory, M., M. C. Callegan, and M. S. Gilmore. 2007. Role of bacterial andhost factors in infectious endophthalmitis. Chem. Immunol. Allergy 92: 266–275.

14. Luna, J. D., C. C. Chan, N. L. Derevjanik, J. Mahlow, C. Chiu, B. Peng, T. Tobe,P. A. Campochiaro, and S. A. Vinores. 1997. Blood-retinal barrier (BRB)

breakdown in experimental autoimmune uveoretinitis: comparison with vascularendothelial growth factor, tumor necrosis factor alpha, and interleukin-1beta-mediated breakdown. J. Neurosci. Res. 49: 268–280.

15. Xu, H., M. Chen, and J. V. Forrester. 2009. Para-inflammation in the aging retina.Prog. Retin. Eye Res. 28: 348–368.

16. Moyer, A. L., R. T. Ramadan, B. D. Novosad, R. Astley, and M. C. Callegan.2009. Bacillus cereus-induced permeability of the blood-ocular barrier duringexperimental endophthalmitis. Invest. Ophthalmol. Vis. Sci. 50: 3783–3793.

17. Doshi, R. R., J. F. Arevalo, H. W. Flynn, Jr., and E. T. Cunningham Jr. 2010.Evaluating exaggerated, prolonged, or delayed postoperative intraocular in-flammation. Am. J. Ophthalmol. 150: 295–304.e291.

18. Kumar, A., C. N. Singh, I. V. Glybina, T. H. Mahmoud, and F. S. Yu. 2010. Toll-like receptor 2 ligand-induced protection against bacterial endophthalmitis. J.Infect. Dis. 201: 255–263.

19. Karl, M. O., and T. A. Reh. 2010. Regenerative medicine for retinal diseases:activating endogenous repair mechanisms. Trends Mol. Med. 16: 193–202.

20. de Melo Reis, R. A., A. L. Ventura, C. S. Schitine, M. C. de Mello, and F. G. deMello. 2008. Muller glia as an active compartment modulating nervous activityin the vertebrate retina: neurotransmitters and trophic factors. Neurochem. Res.33: 1466–1474.

21. Zong, H., M. Ward, A. Madden, P. H. Yong, G. A. Limb, T. M. Curtis, andA. W. Stitt. 2010. Hyperglycaemia-induced pro-inflammatory responses by ret-inal Muller glia are regulated by the receptor for advanced glycation end-products (RAGE). Diabetologia 53: 2656–2666.

22. Lindqvist, N., Q. Liu, J. Zajadacz, K. Franze, and A. Reichenbach. 2010. Retinalglial (Muller ) cells: sensing and responding to tissue stretch. Invest. Ophthalmol.Vis. Sci. 51: 1683–1690.

23. Ramadan, R. T., R. Ramirez, B. D. Novosad, and M. C. Callegan. 2006. Acuteinflammation and loss of retinal architecture and function during experimentalBacillus endophthalmitis. Curr. Eye Res. 31: 955–965.

24. Drescher, K. M., and J. A. Whittum-Hudson. 1997. Evidence for induction ofinterferon-alpha and interferon-beta in retinal glial cells of Muller. Virology 234:309–316.

25. Limb, G. A., T. E. Salt, P. M. Munro, S. E. Moss, and P. T. Khaw. 2002. In vitrocharacterization of a spontaneously immortalized human Muller cell line (MIO-M1). Invest. Ophthalmol. Vis. Sci. 43: 864–869.

26. Kumar, A., J. Zhang, and F. S. Yu. 2006. Toll-like receptor 2-mediated expressionof beta-defensin-2 in human corneal epithelial cells. Microbes Infect. 8: 380–389.

27. Barry, A. L., C. Thornsberry, R. N. Jones, and T. L. Gavan. 1985. Aztreonam:antibacterial activity, beta-lactamase stability, and interpretive standards andquality control guidelines for disk-diffusion susceptibility tests. Rev. Infect. Dis.7(Suppl 4): S594–S604.

28. Jorgensen, J. H., and M. J. Ferraro. 2009. Antimicrobial susceptibility testing:a review of general principles and contemporary practices. Clin. Infect. Dis. 49:1749–1755.

29. Garcıa, M., and E. Vecino. 2003. Role of Muller glia in neuroprotection andregeneration in the retina. Histol. Histopathol. 18: 1205–1218.

30. Jadhav, A. P., K. Roesch, and C. L. Cepko. 2009. Development and neurogenicpotential of Muller glial cells in the vertebrate retina. Prog. Retin. Eye Res. 28:249–262.

31. Bringmann, A., T. Pannicke, J. Grosche, M. Francke, P. Wiedemann,S. N. Skatchkov, N. N. Osborne, and A. Reichenbach. 2006. Muller cells in thehealthy and diseased retina. Prog. Retin. Eye Res. 25: 397–424.

32. Bringmann, A., S. N. Skatchkov, T. Pannicke, B. Biedermann, H. Wolburg,R. K. Orkand, and A. Reichenbach. 2000. Muller glial cells in anuran retina.Microsc. Res. Tech. 50: 384–393.

33. Wolburg, H., E. Willbold, and P. G. Layer. 1991. Muller glia endfeet, a basallamina and the polarity of retinal layers form properly in vitro only in thepresence of marginal pigmented epithelium. Cell Tissue Res. 264: 437–451.

34. Fournier, B., and D. J. Philpott. 2005. Recognition of Staphylococcus aureus bythe innate immune system. Clin. Microbiol. Rev. 18: 521–540.

35. Booth, M. C., R. V. Atkuri, S. K. Nanda, J. J. Iandolo, and M. S. Gilmore. 1995.Accessory gene regulator controls Staphylococcus aureus virulence in endoph-thalmitis. Invest. Ophthalmol. Vis. Sci. 36: 1828–1836.

36. Booth, M. C., A. L. Cheung, K. L. Hatter, B. D. Jett, M. C. Callegan, andM. S. Gilmore. 1997. Staphylococcal accessory regulator (sar) in conjunctionwith agr contributes to Staphylococcus aureus virulence in endophthalmitis.Infect. Immun. 65: 1550–1556.

37. Callegan, M. C., M. C. Booth, B. D. Jett, and M. S. Gilmore. 1999. Pathogenesisof gram-positive bacterial endophthalmitis. Infect. Immun. 67: 3348–3356.

38. Li, Q., A. Kumar, J. F. Gui, and F. S. Yu. 2008. Staphylococcus aureus lip-oproteins trigger human corneal epithelial innate response through toll-like re-ceptor-2. Microb. Pathog. 44: 426–434.

39. Kumar, A., J. Zhang, and F. S. Yu. 2004. Innate immune response of cornealepithelial cells to Staphylococcus aureus infection: role of peptidoglycan instimulating proinflammatory cytokine secretion. Invest. Ophthalmol. Vis. Sci. 45:3513–3522.

40. Sun, Y., A. G. Hise, C. M. Kalsow, and E. Pearlman. 2006. Staphylococcusaureus-induced corneal inflammation is dependent on Toll-like receptor 2 andmyeloid differentiation factor 88. Infect. Immun. 74: 5325–5332.

41. Ribeiro, C. M., T. Hermsen, A. J. Taverne-Thiele, H. F. Savelkoul, andG. F. Wiegertjes. 2010. Evolution of recognition of ligands from Gram-positivebacteria: similarities and differences in the TLR2-mediated response betweenmammalian vertebrates and teleost fish. J. Immunol. 184: 2355–2368.

42. Takeuchi, O., K. Hoshino, and S. Akira. 2000. Cutting edge: TLR2-deficient andMyD88-deficient mice are highly susceptible to Staphylococcus aureus in-fection. J. Immunol. 165: 5392–5396.

7096 TLR2 AND RETINAL MULLER GLIA

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from

43. Esen, N., F. Y. Tanga, J. A. DeLeo, and T. Kielian. 2004. Toll-like receptor 2(TLR2) mediates astrocyte activation in response to the Gram-positive bacteriumStaphylococcus aureus. J. Neurochem. 88: 746–758.

44. Brodsky, I. E., and D. Monack. 2009. NLR-mediated control of inflammasomeassembly in the host response against bacterial pathogens. Semin. Immunol. 21:199–207.

45. Rodrıguez-Martınez, S., M. E. Cancino-Dıaz, L. Jimenez-Zamudio, E. Garcıa-Latorre, and J. C. Cancino-Dıaz. 2005. TLRs and NODs mRNA expressionpattern in healthy mouse eye. Br. J. Ophthalmol. 89: 904–910.

46. Rosenzweig, H. L., T. Kawaguchi, T. M. Martin, S. R. Planck, M. P. Davey, andJ. T. Rosenbaum. 2009. Nucleotide oligomerization domain-2 (NOD2)-induceduveitis: dependence on IFN-gamma. Invest. Ophthalmol. Vis. Sci. 50: 1739–1745.

47. Rosenzweig, H. L., T. M. Martin, M. M. Jann, S. R. Planck, M. P. Davey,K. Kobayashi, R. A. Flavell, and J. T. Rosenbaum. 2008. NOD2, the gene re-sponsible for familial granulomatous uveitis, in a mouse model of uveitis. Invest.Ophthalmol. Vis. Sci. 49: 1518–1524.

48. Shaw, P. J., M. Lamkanfi, and T. D. Kanneganti. 2010. NOD-like receptor (NLR)signaling beyond the inflammasome. Eur. J. Immunol. 40: 624–627.

49. Ganz, T. 1999. Defensins and host defense. Science 286: 420–421.50. Schauber, J., and R. L. Gallo. 2009. Antimicrobial peptides and the skin immune

defense system. J. Allergy Clin. Immunol. 124(Suppl 2): R13–R18.51. Zanetti, M. 2004. Cathelicidins, multifunctional peptides of the innate immunity.

J. Leukoc. Biol. 75: 39–48.52. Cowland, J. B., A. H. Johnsen, and N. Borregaard. 1995. hCAP-18, a cathelin/

pro-bactenecin-like protein of human neutrophil specific granules. FEBS Lett.368: 173–176.

53. Redfern, R. L., and A. M. McDermott. 2010. Toll-like receptors in ocular surfacedisease. Exp. Eye Res. 90: 679–687.

54. Bals, R., D. J. Weiner, A. D. Moscioni, R. L. Meegalla, and J. M. Wilson. 1999.Augmentation of innate host defense by expression of a cathelicidin antimi-crobial peptide. Infect. Immun. 67: 6084–6089.

55. Gao, N., A. Kumar, J. Jyot, and F.-S. Yu. 2010. Flagellin-induced corneal anti-microbial peptide production and wound repair involve a novel NF-kappaB-independent and EGFR-dependent pathway. PLoS ONE 5: e9351.

56. Bals, R., and J. M. Wilson. 2003. Cathelicidins—a family of multifunctionalantimicrobial peptides. Cell. Mol. Life Sci. 60: 711–720.

The Journal of Immunology 7097

by guest on October 4, 2017

http://ww

w.jim

munol.org/

Dow

nloaded from