title page anti-inflammatory mechanism of compound k in...

JPET #189035

1

Title Page

Anti-inflammatory mechanism of compound K in activated microglia

and its neuroprotective effect on experimental stroke in mice

Jin-Sun Park, Jin A. Shin, Ji-Sun Jung, Jin-Won Hyun, Thi Kim Van Le,

Dong-Hyun Kim, Eun-Mi Park, Hee-Sun Kim

Department of Molecular Medicine and Tissue Injury Defense Research Center, Ewha

Womans University Medical School, Seoul, Republic of Korea (J.-S.P., J.-S.J., H.-S.K.),

Department of Pharmacology, Ewha Womans University Medical School, Seoul,

Republic of Korea (J.A.S., E.-M.P.), Department of Biochemistry, College of Medicine,

Cheju National University, Jeju, Republic of Korea (J.-W.H), Department of Life and

Nanopharmaceutical Sciences, College of Pharmacy, Kyung Hee University, Seoul,

Republic of Korea (T.K.V. L, D.-H.K.)

JPET Fast Forward. Published on December 29, 2011 as DOI:10.1124/jpet.111.189035

Copyright 2011 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on December 29, 2011 as DOI: 10.1124/jpet.111.189035

at ASPE

T Journals on January 3, 2020

jpet.aspetjournals.orgD

ownloaded from

http://jpet.aspetjournals.org/

JPET #189035

2

Running Title Page

Running title: Anti-inflammatory and neuroprotective effects of compound K

Corresponding Author:

Hee-Sun Kim

Department of Molecular Medicine, Ewha Womans University Medical School, Mok-6-

dong 911-1, Yangchun-Ku, Seoul 158-710, Korea

Tel: 82-2-2650-5823

Fax: 82-2-2653-8891

Email: [email protected]

Text pages: 32

Tables: 0

Figures: 7

References: 42

Abstract: 197 words

Introduction: 393 words

Discussion: 1200 words

Abbreviations:

AP-1, activator protein-1; ARE, antioxidant response element; CRE, cyclic-AMP

responsive element; CREB, CRE-binding protein; ERK, extracellular signal-regulated

kinase; GR, glucocorticoid receptor; HO-1, heme oxygenase-1; IL-6, interleukin-6;

iNOS, inducible nitric oxide synthase; JNK, c-Jun N-terminal kinase; LPS,

lipopolysaccharide; MAPK, mitogen-activated protein kinase; MCP, monocyte

chemotactic protein-1; MMP, matrix metalloproteinase; NADPH, nicotinamide adenine

dinucleotide phosphate; NF-κB, nuclear factor-κB; Nrf2, nuclear factor E2-related

factor-2; ROS, reactive oxygen species; TNF, tumor necrosis factor

Section: Neuropharmacology


at ASPE



ownloaded from


JPET #189035

3

Abstract

Microglial activation plays a pivotal role in the pathogenesis of various neurologic

disorders, such as cerebral ischemia, Alzheimer’s disease and Parkinson’s disease. Thus,

controlling microglial activation is a promising therapeutic strategy for such brain

diseases. In the present study, we found that a ginseng saponin metabolite, compound K,

inhibited the expressions of inducible nitric oxide synthase, proinflammatory cytokines,

monocyte chemotactic protein-1, and matrix metalloproteinase-3 and -9 in

lipopolysaccharide (LPS)-stimulated BV2 microglial cells and primary cultured

microglia. Subsequent mechanistic studies revealed that compound K suppressed

microglial activation via inhibiting reactive oxygen species, mitogen-activated protein

kinases, and NF-κB/AP-1 activities with enhancement of HO-1/ARE signaling. To

address the anti-inflammatory effects of compound K in vivo, we used two brain disease

models of mice: sepsis (systemic inflammation) and cerebral ischemia. Compound K

reduced the number of Iba1-positive activated microglia and inhibited the expressions

of tumor necrosis factor-alpha and interleukin-1 beta in the LPS-induced sepsis brain.

Furthermore, compound K reduced the infarct volume of ischemic brain induced by

middle cerebral artery occlusion, and suppressed microglial activation in the ischemic

cortex. The results collectively suggest that compound K is a promising agent for

prevention and/or treatment of cerebral ischemia and other neuroinflammatory disorders.


at ASPE



ownloaded from


JPET #189035

4

Introduction

Microglia are major immune cells in the central nervous system, which are readily

activated following brain injury or during neurodegenerative processes, and secrete

growth factors, pro-/anti-inflammatory cytokines, reactive oxygen species (ROS), nitric

oxide (NO), and glutamate (Block and Hong, 2005; Stolp and Dziegielewska, 2009).

While microglial activation is necessary and important for host defense, overactivation

of microglia is neurotoxic. Microglia are also activated after ischemic stroke and

produce cytokines, triggering neuronal death in response to ischemic injury (Wang et al.,

2007). Within 3 days of a stroke, various inflammatory molecules are concomitantly up-

regulated in the brain, cerebrospinal fluid (CSF), and blood, and thus continuous brain

loss is expected during that time. If inflammation can be suppressed, progressive brain

loss following a stroke may be prevented and the clinical outcome improved (Wang et

al., 2007). Thus, development of agents that reduce microglial activation and their

proinflammatory responses are considered to be an important therapeutic strategy for

neuroinflammatory disorders such as cerebral ischemia, Alzheimer’s disease, and

Parkinson’s disease (Block and Hong, 2005; Stolp and Dziegielewska, 2009; Wang et al.,

2007).

Compound K (20-O-D-glucopyranosyl-20(S)-protopanaxadiol) is one of the major

metabolites of ginseng, which are formed by the intestinal bacteria after oral

administration of ginseng extract in humans and rats. The ginseng saponin metabolite,

compound K, is absorbed from the gastrointestinal tract to the blood (Akao et al., 1998).

Compound K has a variety of pharmacological activities, including anti-tumor, anti-

diabetic, anti-allergic and anti-inflammatory effects (Jia et al., 2009; Radad et al., 2010).

Our group has recently reported that compound K suppresses glioma invasion via


at ASPE



ownloaded from


JPET #189035

5

inhibition of MMP-9 expression (Jung et al., 2006). Compound K also suppressed

inflammation in colitic mice via inhibition of interleukin-1 receptor-associated kinase-1

(IRAK-1) activation (Joh et al., 2011).

We have previously reported that ginseng extracts and total saponins exert anti-

inflammatory effects in lipopolysaccharide (LPS)- and/or β-amyloid-stimulated

microglial cells (Park et al., 2009). Among the individual ginsenosides tested,

compound K suppressed LPS-induced NO production. However, the anti-inflammatory

effects of compound K in activated microglia and its’ underlying molecular mechanisms

have not been clearly demonstrated. In the present study, we examined the effects of

compound K on various inflammatory molecules in LPS-stimulated microglial cells and

analyzed the detail molecular mechanisms. Subsequently, we demonstrated the anti-

inflammatory and/or neuroprotective effects of compound K in brain disease models of

mice such as sepsis (systemic inflammation) and cerebral ischemia.


at ASPE



ownloaded from


JPET #189035

6

Methods

Reagents

Compound K (20-O-D-glucopyranosyl-20(S)-protopanaxadiol) was prepared as

previously described (Joh et al., 2011). In brief, protopanaxadiol-type ginsenosides were

incubated with Bacteroides JY-6, a human intestinal bacterium in a general anaerobic

medium for 24 h at 37ºC. The incubated medium was extracted with BuOH. The

supernatant was concentrated in vacuum and was processed using silica gel column

chromatography with CHCl3-MeOH-H2O (65:35:10 [v/v]). The isolated compound K

was characterized by mass spectroscopy and 1H-and 13C-nuclear magnetic resonance

(NMR) spectrometry. The chemical structure of compound K is shown in Fig. 1. All

reagents used for cell culture were purchased from Gibco BRL (Grand Island, NY,

USA). Antibodies against MAP kinases or HO-1 were purchased form Cell Signaling

Technology (Beverly, MA, USA). All other chemicals were obtained from Sigma-

Aldrich (St. Louis, MO, USA), unless otherwise stated.

Microglial cell cultures

Immortalized murine BV2 microglial cells (Bocchni et al., 1992) were grown and

maintained in Dulbecco’s modified Eagle’s medium supplemented with 10 % heat-

inactivated FBS, streptomycin (10 μg/ml), and penicillin (10 U/ml) at 37°C. Primary

microglial cells were cultured from the cerebral cortices of 1-2-day-old Sprague-Dawley

rat pups, as described previously (Park et al., 2009). The purity of microglial cultures

was > 95%, which was determined by isolectin B4 staining (data not shown).

Measurement of cytokine, nitrite, and intracellular ROS levels


at ASPE



ownloaded from


JPET #189035

7

Microglial cells (1 x 105 cells per well in a 24-well plate) were pre-treated with

compound K (25, 50, 75 μM) for 30 min and stimulated with LPS (0.1 μg /ml). The

supernatants of the cultured microglia were collected 24 h after LPS stimulation and the

concentrations of TNF-α and IL-1β were measured by an enzyme-linked

immunosorbent assay (ELISA). Accumulated nitrite was measured in the cell

supernatant using the Griess reagent (Promega, Madison, WI, USA). The intracellular

accumulation of ROS was measured with H2DCF-DA (Sigma-Aldrich) by modifying a

previously reported method (Qin et al., 2005).

RT-PCR

BV2 cells (7.5 ×105 cells on a 6-cm dish) and rat primary microglia (7 × 106 cells on

a 6-cm dish) were treated with LPS in the presence of compound K (25, 50, 75 μM) and

total RNA was extracted with TRI reagent (Sigma-Aldrich). For RT-PCR, total RNA (1

μg) was reverse-transcribed in a reaction mixture containing 1 U RNase inhibitor, 500

ng random primers, 3 mM MgCl2, 0.5 mM dNTP, 1 X RT buffer, and 10 U reverse

transcriptase (Promega). The synthesized cDNA was used as a template for the PCR

reaction using GoTaq polymerase (Promega) and primers, as below (Table).

Forward Primer (5’→3’) Reverse Primer (5’→3’) Size

iNOS CCCTTCCGAAGTTTCTGGCAGCAGC GCCTGTCAGAGCCTCGTGGCTTTGG 450 bp

TNF-α CCTATGTCTCAGCCTCTTCT CCTGGTATGAGATAGCAAAT 354 bp

IL-1β GGCAACTGTTCCTGAACTCAACTG CCATTGAGGTGGAGAGCTTTCAGC 447 bp

IL-6 CCACTTCACAAGTCGGAGGCTT CCAGCTTATCTGTTAGGAGA 395 bp

MCP-1 ACTGAAGCCAGCTCTCTCTTCCTC TTCCTTGGGGTCAGCACAGAC 276 bp

MMP-3 ATTCAGTCCCTCTATGGA CTCCAGTATTTGTCCTCTAC 375 bp

MMP-9 GTGATCCCCACTTACTATGGAAAC GAAGCCATACAGTTTATCCTGGTC 352 bp

GAPDH ATGTACGTAGCCATCCAGGC AGGAAGGAAGGCTGGAAGAG 420 bp


at ASPE



ownloaded from


JPET #189035

8

Electrophoretic mobility shift assay (EMSA)

Nuclear extracts from treated microglia were prepared, as described previously

(Woo et al., 2003). The double-stranded DNA oligonucleotides containing the NF-κB,

AP-1, ARE, or CRE consensus sequences (Promega) were end-labeled by [γ-32P]ATP.

EMSA was performed using 30,000 to 50,000 cpm of labeled probe and nuclear

proteins (5 μg) in a final volume of 20 μl of 12.5% glycerol and (in mM): 12.5 HEPES

(pH 7.9), 4 Tris-HCl (pH 7.9), 60 KCl, 1 EDTA, and 1 DTT with 1 μg of poly(dI-dC) as

nonspecific competitor. The reaction was incubated at room temperature for 20 min.

The DNA-protein was resolved on high ionic strength, nondenaturing 6%

polyacrylamide gel followed by autoradiography with an intensifying screen. For the

supershift assay, antibodies to the p65 or p50 subunits of NF-κB (Santa Cruz, CA) were

co-incubated with the nuclear protein in the reaction mixture for 30 min at 4°C prior to

adding the radiolabeled probe.

Transient transfection and luciferase assay

Transfection of the reporter genes into BV2 cells was performed using

GeneporterTM 2 transfection reagent (Gene Therapy Systems, San Diego, CA, USA).

The NF-κB reporter plasmid contains three copies of the κB–binding sequence fused to

the firefly luciferase gene (Clontech, Mountain View, CA, USA). The ARE-luciferase

(ARE-Luc) reporter plasmid contains enhancer 2 (E2) and a minimal promoter sequence

of the mouse HO-1 gene fused to the luciferase gene (So et al., 2006). BV2 cells (2 X

105 cells per well in a 12-well plate) were transfected with 1 μg of the reporter construct

mixed with Geneporter. After 48 h, cells were harvested and luciferase assay was

performed, as previously described (Woo et al., 2003). To determine the effect of


at ASPE



ownloaded from


JPET #189035

9

compound K on reporter gene activity, cells were pre-treated with the agent before

treating with LPS (0.1 μg/ml) and incubated for 6 h prior to harvesting cells.

In vivo administration of compound K

Experiments were performed in male C57BL/6 mice (10-11 weeks old; Orient Bio

Inc., Seongnam, Republic of Korea). All experiments were performed in accordance

with the NIH and Ewha Womans University guidelines for Laboratory Animals Care

and Use, and the study was approved by the Institutional Animal Care and Use

Committee in the Medical School of Ewha Womans University. Compound K was

dissolved in 3% cremophore (Sigma-Aldrich) in normal saline. Mice were randomly

divided into control and treatment groups, and vehicle (3% cremophore in normal

saline) or compound K (30 mg/kg ip) was administered 4 days before LPS (5 mg/kg ip)

treatment or transient MCAO. The doses of LPS and compound K were based on a

previous study (Park et al., 2009).

Transient middle cerebral artery occlusion (MCAO)

Procedures for transient MCAO have been established and published previously

(Shin et al., 2009). Briefly, mice were anesthetized and a fiber optic probe was attached

to the right parietal bone (2 mm posterior and 5 mm lateral to the bregma) and

connected to a laser-Doppler flowmeter (Periflux System 5010; Perimed, Sweden).

Cerebral blood flow (CBF) was continuously recorded during MCAO and reperfusion

periods using a computer-based data acquisition system (Perisoft, Perimed). A 6-0

silicon-coated black monofilament surgical suture (Doccol Cooperation, Redlands, CA,

USA) was inserted into the exposed right external carotid artery, advanced into the


at ASPE



ownloaded from


JPET #189035

10

internal carotid artery, and wedged into the circle of Willis to obstruct the origin of the

MCA. The filament was left in place for 30 min, then withdrawn to re-establish CBF.

Only animals that exhibited a reduction in CBF >85% during MCA occlusion and in

which CBF recovered by >80% after 10 min of reperfusion were included in the study.

Infarct volume measurement

Infarct volume was measured according to procedures described previously (Lin et

al., 1993). Mice were sacrificed 3 days after MCAO, and brains were removed, frozen,

and sectioned (30 µm thick) using a cryostat. Brain sections were collected serially at

600-µm intervals, and stained with cresyl violet. Infarct volume was determined using

an image analyzer (Axiovision LE 4.1; Carl Zeiss, Jena, Germany). Values were

reported after correcting for post-ischemic swelling, as previously described (Lin et al.,

1993).

Immunohistochemistry

Three hour after LPS treatment or 24 h after MCAO, the animals were anesthetized

with sodium pentobarbital (120 mg/kg ip) and perfused transcardially with normal

saline containing heparin (5 U/ml), followed by 4% formaldehyde in 0.1 M sodium

phosphate buffer (pH 7.2). The brains were removed and incubated overnight in

fixatives and stored in a 30% sucrose solution. Serial coronal brain sections (20 µm

thick, at 600-µm intervals) were collected in a cryostat in regions containing the

striatum (between + 1.4 and - 1.0 mm from the bregma). Brain sections were incubated

in TBS containing 0.1% Triton X-100, 5% normal serum, and 1% bovine serum

albumin for 1 h, then subsequently incubated with Iba1 antibody (1:500; Wako Pure


at ASPE



ownloaded from


JPET #189035

11

Chemical Industries, Osaka, Japan). On the following day, the secondary antibody

conjugated to FITC (anti-rabbit, 1:200; Serotec, Raleigh, NC, USA) was applied to

sections for 1 h. TBS was used to wash sections between all steps. The sections were

mounted with Vectashield mounting medium (Vector Laboratories, Inc., Burlingame,

CA, USA), and fluorescence microcopy images were obtained (Axiovert 200; Carl

Zeiss). Densely-stained, round, Iba1-positive cells were quantified using the Axiovison

LE program (Carl Zeiss). Two serial brain sections from each animal were used, and

quantification was performed in three different areas (500 μm2 in size) in the lateral

cortex and striatum of the right hemisphere per brain section. The mean cell number

from six 500 μm2 areas per animal was calculated.

Western blot analysis

Whole cell protein lysates of BV2 cells were prepared in lysis buffer and protein

samples were separated by 12% SDS-PAGE and transferred to nitrocellulose

membranes (Amersham, Piscataway, NJ, USA). The membranes were blocked with 5%

skim milk in 10 mM Tris-HCl containing 150 mM NaCl and 0.5% Tween 20 (TBST),

then incubated with primary antibodies (1:1000) against phospho- or the total form of

MAP kinases, HO-1 (Cell Signaling Technology) or p-p47phox [anti-phospho-(Ser345)-

p47phox Ab, kindly provided by Dr. J.L. Benna (Universite Paris, France)] (Dang et al.,

2006). The cortical tissues from each animal were subjected to simultaneous Western

blot hybridization, as previously described (Shin et al., 2010a), and the protein-

transferred membrane was incubated overnight with antibodies against IL-1β or TNF-α

(1:200; R&D, Minneapolis, MN, USA). After thorough washing with TBST, HRP-

conjugated secondary antibodies (1:3000 dilution in TBST; New England Biolabs,


at ASPE



ownloaded from


JPET #189035

12

Beverly, MA, USA) were applied and the blots were developed using an enhanced

chemiluminescence detection kit (Pierce Biotechnology, Rockford, IL, USA).

Statistical Analysis

The data of in vitro and in vivo studies are expressed as the mean ± S.E.M.

Comparisons of in vivo data between two groups were analyzed with an unpaired

Student’s t-test. Multiple comparisons were evaluated with one-way analysis of variance

(ANOVA), followed by a post-hoc Fisher’s protected least significant difference

(PLSD) test with Statview (Statview version 5, SAS Institute Inc., Cary, NC, USA). For

in vitro data, statistical comparisons between groups were performed using one-way

ANOVA, followed by Student’s t-test. A p-value < 0.05 was considered significant.


at ASPE



ownloaded from


JPET #189035

13

Results

Compound K inhibited iNOS, cytokines, MCP-1 and MMP-3/-9 expression in LPS-

stimulated microglial cells

To investigate the anti-inflammatory effects of compound K, BV2 cells and

primary microglia were treated with compound K for 30 min before stimulation with

LPS. As shown in Fig. 2A, compound K inhibited LPS-induced production of NO,

TNF-α, and IL-1β in a dose-dependent manner. Subsequent RT-PCR analysis revealed

that compound K suppressed iNOS, TNF-α, and IL-1β expression at the mRNA level

(Fig. 2B). Compound K also inhibited the expression of IL-6, MCP-1, MMP-3 and

MMP-9, which also play an important role in LPS-induced inflammatory reactions.

Compound K inhibited NF-κB and AP-1 activities, while it increased nuclear

protein binding to CRE

To investigate the anti-inflammatory mechanism of compound K, we examined the

effect of compound K on NF-κB and AP-1, which are important transcription factors

modulating cytokines, MMP/MCP-1, and iNOS gene expression in microglia (Lee and

Kim, 2009; Smale, 2010). As shown in Fig. 3, stimulation of BV2 cells with LPS

resulted in strong NF-κB and AP-1 bindings, which were significantly inhibited by

compound K. In addition, compound K inhibited NF-κB-mediated transcriptional

activity, as shown by the κB-luc reporter gene assay (Fig. 3B). Next, we examined the

effect of compound K on CREB, which is known to be involved in anti-inflammatory

mechanisms of activated microglia (Jung et al., 2010; Woo et al., 2003). As shown in

Fig. 3D, compound K significantly enhanced nuclear protein binding to CRE. The data

collectively suggest that compound K may inhibit the expression of various


at ASPE



ownloaded from


JPET #189035

14

inflammatory molecules by modulating NF-κB, AP-1, and CREB.

Compound K inhibits LPS-induced ROS production, phosphorylation of p47phox of

NADPH oxidase, and three types of MAP kinases

Excessive ROS generation by microglia contributes to the aggravation of neuronal

damage after a stroke (Sorce and Krause, 2009). In addition, ROS are known as second

messengers in inflammatory reactions (Sayre et al., 2008). In the present study,

compound K significantly attenuated LPS-induced ROS production in BV2 cells and

primary microglia (Figs.4A-B). Moreover, compound K suppressed the phosphorylation

of p47phox, a major component of NADPH oxidase (Nox2) responsible for microglial

ROS release (Fig. 4C) (Sorce and Krause, 2009). Thus, the antioxidant effect of

compound K may partly attribute to reduced NADPH oxidase activity. Furthermore,

compound K inhibited the LPS-induced phosphorylation of three types of MAPKs,

which are also important upstream signaling molecules in inflammatory reactions (Fig.

4D).

Compound K up-regulated HO-1 expression via ARE

Next, we examined the effect of compound K on the expression of HO-1, which is

known as a key molecule in the resolution of oxidative stress and inflammation (Min et

al., 2006). RT-PCR and Western blot analyses showed that compound K increased HO-1

expression at the mRNA and protein levels (Figs. 5A & B). Because the AREs on the

HO-1 promoter are critical for HO-1 transcription, we examined the effect of compound

K on nuclear protein binding to ARE. As shown in Fig. 5C, compound K significantly


at ASPE



ownloaded from


JPET #189035

15

increased the ARE-nuclear protein complex. Moreover, compound K increased ARE-

driven luciferase activity (Fig. 5D).

Compound K repressed inflammatory responses in the septic brain of mice

To determine whether compound K also reduced microglial activation in in vivo,

we measured the immunoreactivity of Iba1, which is a marker for activation of

microglia (Ito et al., 2001), in the mouse cortex and striatum 3 h after systemic

administration of LPS. In the brain of LPS-injected mice, the number of Iba1-positive

cells with a densely-stained round shape, indicative of activated cells, was increased

compared to controls. However, pre-treatment with compound K (30 mg/kg) reduced

the number of activated microglia, as seen following the quantification of activated

microglia both in the cortex and the striatum (p < 0.01 compared to vehicle; Fig. 6A). In

addition, compound K significantly reduced the expression of LPS-induced IL-1β and

TNF-α protein in the cortex 6 h after LPS injection (Figs. 6B).

Neuroprotective and anti-inflammatory effects of compound K on ischemic brain

injury in mice

Inflammation plays important roles in ischemic brain damage (Wang et al., 2007).

Based on above results, we further examined the therapeutic potential of compound K

on ischemic stroke induced by transient MCAO in mice. As shown in Fig. 7A,

pretreatment of compound K (30 mg/kg) significantly decreased the total infarct volume

compared to vehicle treatment (46% reduction, p = 0.012). The reduction in infarct

volume was prominent in the cortex (-56% compared to vehicle, p = 0.049), the area of

ischemic penumbra, but not in the striatum, which is the ischemic core. These findings


at ASPE



ownloaded from


JPET #189035

16

are consistent with the previous reports that the penumbra is salvageable area by

neuroprotective therapeutics (Ginsberg, 2003; Shin et al., 2009 and 2010b). Next, we

examined the effects of compound K on microglial activation in the ischemic brain by

using Iba1 antibody. Iba1 expression was assessed by immunofluorescence labeling in

the ipsilateral brain 24 h after MCAO. As shown in Fig. 7B, MCAO led to the

appearance of numerous densely-stained, activated microglial cells in the cortex and

striatum in vehicle-treated mice. Pre-treatment of compound K significantly reduced the

number of activated microglia in the cortex, but not in the striatum (Fig. 7B). The

results are correlated with the data in Fig. 7A, which show a reduction in infarct volume

in the cortex, but not in the striatum. The data suggest that microglial inactivation is at

least partly responsible for the neuroprotective effects of compound K against an

ischemic insult.


at ASPE



ownloaded from


JPET #189035

17

Discussion

In the present study, we demonstrate the anti-inflammatory effects of compound K

in activated microglia in vitro and in vivo. Compound K suppressed the expression of

various inflammatory molecules in LPS-stimulated BV2 cells and primary microglia.

The anti-inflammatory effects of compound K were supported by two animal models:

systemic inflammation and cerebral ischemia. Compound K suppressed microglial

activation induced by systemic LPS administration in vivo. In addition, compound K

showed neuroprotective effects with reduction of microglial activation in the ischemic

brains of mice. Detail mechanistic studies by using in vitro cell culture systems revealed

that compound K suppresses inflammatory molecules via modulating ROS, MAPKs,

NF-κB/AP-1 as well as HO-1/ARE signaling pathways.

A number of studies have reported on the beneficial effects of ginsenosides

(ginseng saponins) in the CNS. Ginsenosides potentiate brain functions by promoting

neurogenesis and affecting neurotransmission (Liu et al., 2007; Shen and Zhang, 2007).

Ginsenosides, such as Rh1, Rh2, Rb1, and Rg1, support memory and learning (Wang et

al., 2009; Zhao et al., 2009). Among the ginsenosides, Rb1 is most thoroughly studied

for its neuroprotective effects in cerebral ischemia. Several groups have reported that

Rb1 prevents ischemic neuronal death by up-regulating the expression of anti-apoptotic

Bcl-2, Bcl-XL proteins, and glial-derived neurotrophic factor (GDNF) in rats subjected to

MCAO (Yuan et al., 2007; Zhang et al., 2006). Because Rb1 is metabolized into

compound K by intestinal microflora before absorption in the body (Akao et al., 1998;

Bae et al., 2004), the in vivo anti-ischemic effect of ginsenoside Rb1 might be due to the

metabolites. In support of this notion, the present study demonstrates that compound K

exerts protective effects against ischemic stroke. We found that compound K reduced


at ASPE



ownloaded from


JPET #189035

18

ischemic brain injury in the cortex, but not in the striatum, which is destined to be the

necrotic core (Fig. 7A), indicating that compound K can be a effective therapeutic to

rescue the salvageable penumbra from ischemic insults. In addition, we found that

compound K repressed microglial activation, which contributes to ischemic brain

damage by releasing proinflammatory cytokines and free radicals (Wang et al., 2007).

The number of morphologically activated microglia that were detected prominently at

24 h after MCAO (Shin et al., 2010b) was decreased in the ischemic cortex of mice

pretreated with compound K (Fig. 7B). The repression of microglia is not likely a result

of reduced infarct volume because cortical infarction was not definitely visible at 24 h

after MCAO, the time point that Iba-1 expression was examined. The reason that

compound K repressed microglial activation only in the cortex might be explained by

the different pathophysiology between the core and the penumbra. It has been shown

that molecules released from damaged neurons, such as ATP and glutamate, activate

microglia (Volonte et al, 2003), and the activated microglia can again increase neuronal

death by releasing cytotoxic agents such as cytokines, ROS, proteases and glutamate

(Kato and Kogure, 1999). Therefore, more prominent activation of microglia in the

striatum may indicate more severe cytotoxic responses in the core of infarction, and the

dose or treatment timing of compound K may not be enough to repress microglial

activation in the core area. Although a direct link between microglial activation and

neuroprotection by compound K remains to be further investigated in ischemic stroke

models, we suggest that the reduction of infarct volume by compound K is associated

with repression of microglial activation, and the data support the concept that the

penumbra is salvageable area by suitable protective drugs.


at ASPE



ownloaded from


JPET #189035

19

Effects of compound K on microglial activation was further supported by studies

using mice exposed to systemic administration of LPS, an acute model of infection

causing inflammation in global area of the brain (Qin et al., 2007; Shin et al., 2010a).

Compound K reduced microglial activation not only in the cortex but also in the

striatum because there was no regional difference of injury severity between the cortex

and the striatum in this model. Furthermore, compound K also reduced the expression

of proinflammatory cytokines IL-1β and TNF-α (Fig. 6). Collectively, the data support

the view that anti-inflammatory action may be one of the factors contributing to the

neuroprotective effects afforded by compound K.

In BV2 microglial cells and primary cultured microglia, compound K inhibited not

only the expression of pro-inflammatory molecules (iNOS, TNF-α, IL-1β, IL-6, MCP-1,

and MMP-3/-9) but also ROS production. A recent paper reported on in vitro

antioxidant properties of compound K (Lee et al., 2011). Compound K exhibits strong

radical scavenging activities against DPPH (1,1-diphenyl-2-picrylhydrazyl), hydroxyl,

superoxide and ABTS (2,2’-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid).

Compound K also inhibited lipid peroxidation. Another paper reported that compound

K regulates zymosan-induced inflammatory signaling through inhibition of ROS

(Cuong et al., 2009). Therefore, the results suggest that compound K may be a useful

antioxidant agent against reactive oxygen species.

In the present study, we found that compound K increased HO-1, which is known

to have antioxidant, anti-apoptotic, and anti-inflammatory functions (Naidu et al., 2009).

Previous studies have shown a link between HO-1 activity and reduction in iNOS

expression (Min et al., 2006). In addition, HO-1 inhibits LPS-induced TNF-α and IL-1β

expression through suppression of NF-κB (Rushworth et al., 2008). Furthermore,


at ASPE



ownloaded from


JPET #189035

20

carbon monoxide (CO), one of the products of HO-1, inhibits NADPH oxidase and

TLR4, which are involved in LPS signaling (Nakahira et al., 2006). Thus, the induction

of HO-1 may provide the basis not only for the anti-inflammatory activity of compound

K, but also the antioxidant activity.

When we examined the effects of compound K on various transcription factors

involved in the regulation of inflammatory molecules, compound K was shown to

inhibit NF-κB and AP-1 activities, while increasing nuclear protein binding to CRE and

ARE in LPS-stimulated microglia. Recent studies indicate that CREB, as well as Nrf2

(ARE binding protein), play a role in the regulation of ROS detoxification (Lee et al.,

2009). In addition, the anti-oxidant enzyme, HO-1, has been shown to be under the

influence of the CREB/CRE transcriptional pathway (Lee et al., 2009; Min et al., 2006).

Therefore, CREB, in concert with HO-1, appears to play an important role in compound

K-mediated anti-inflammation/ anti-oxidant effects in microglia.

A recent study reported that compound K acts as an agonist of glucocorticoid

receptor (GR) and induces tolerance to endotoxin-induced lethal shock (Yang et al.,

2008). They suggested that the therapeutic effect of compound K on lethal sepsis is

mediated through the modulation of TLR4-associated signaling via GR. Thus, the GR

agonist function might be also related with the anti-inflammatory effects of compound

K in our neuroinflammatory model systems. Further studies will be necessary to clarify

this issue.

In conclusion, we report for the first time the anti-inflammatory effects of

compound K in microglial cell culture systems and two in vivo models of brain disease

in which inflammation plays important roles. Furthermore, the neuroprotective effect of

compound K was demonstrated in a mouse model of ischemic brain injury. Detailed


at ASPE



ownloaded from


JPET #189035

21

mechanistic studies indicate that the inhibition of ROS, MAPKs, and NF-κB/AP-1, and

the enhancement of the CREB and Nrf2/HO-1 signaling axis are responsible for strong

anti-inflammatory/antioxidant effects of compound K in activated microglia.

Therefore, compound K is a promising therapeutic agent for prevention and/or

treatment of ischemic brain injuries and other neurodegenerative diseases, which are

accompanied by microglial activation.


at ASPE



ownloaded from


JPET #189035

22

Authorship Contributions

Participated in research design: E.M. Park, and H.S. Kim

Conducted experiments: J.S. Park, Shin, Jung, and E.M. Park

Contributed new reagents or analytical tools: Hyun, Le, and D.H. Kim

Performed data analysis: E.M. Park, and H.S. Kim

Wrote or contributed to the writing of the manuscript: J.S. Park, E.M. Park, and H.S.

Kim


at ASPE



ownloaded from


JPET #189035

23

References

Akao T, Kanaoka M, and Kobashi K (1998) Appearance of compound K, a metabolite

of ginsenoside Rb1 by intestinal bacteria, in rat plasma after oral administration-

measurement of compound K by enzyme immunoassay. Biol Pharm Bull 21:245-249.

Bae EA, Hyun YJ, Choo MK, Oh JK, Ryu JH, and Kim DH (2004) Protective effects of

fermented red ginseng on a transient focal ischemic rats. Arch Pharm Res 27:1136-1140.

Block ML, and Hong JS (2005) Microglia and inflammation-mediated

neurodegeneration: multiple triggers with a common mechanism. Prog Neurobiol

76:77-98.

Bocchni V, Mazzolla R, Barluzzi R, Blasi E, Sick P, and Kettenmann H (1992) An

immortalized cell line expresses properties of activated microglial cells. J Neurosci Res

6:16-21.

Cuong TT, Yang CS, Yuk JM, Lee HM, Ko SR, Cho BG, and Jo EK (2009)

Glucocorticoid receptor agonist compound K regulates dectin-1-dependent

inflammatory signaling through inhibition of reactive oxygen species. Life Sci 85:625-

633.

Dang PM, Stensballe A, Boussetta T, Raad H, Dewas C, Kroviarski Y, Hayem G, Jensen

ON, Gougerot-Pocidalo MA, and El-Benna J (2006) A specific p47phox-serine

phosphorylated by convergent MAPKs mediates neutrophil NADPH oxidase priming at

inflammatory sites. J Clin Invest 116:2033–2043.

Ginsberg MD (2003) Adventures in the pathophysiology of brain ischemia: penumbra,

gene expression, neuroprotection: the 2002 Thomas Willis Lecture. Stroke 34:214-223.

Ito D, Tanaka K, Suzuki S, Dembo T, and Fukuuchi Y (2001) Enhanced expression of

Iba1, ionized calcium-binding adapter molecule 1, after transient focal cerebral ischemia

in rat brain. Stroke 32:1208-1215.

Jia L, Zhao Y, and Liang XJ (2009) Current evaluation of the millennium

phytomedicine-ginseng (II): collected chemical entities, modern pharmacology, and


at ASPE



ownloaded from


JPET #189035

24

clinical applications emanated from traditional Chinese medicine. Curr Med Chem

22:2924-2942.

Joh EH, Lee IA, Jung IH, and Kim DH (2011) Ginsenoside Rb1 and its metabolite

compound K inhibit IRAK-1 activation-The key step of inflammation. Biochem

Pharmacol 82:278-286

Jung JS, Shin JA, Park EM, Lee JE, Kang YS, Min SW, Kim DH, Hyun JW, Shin CY,

and Kim HS (2010) Anti-inflammatory mechanism of ginsenoside Rh1 in

lipopolysaccharide-stimmulated microglia: critical role of the protein kinase A and

hemeoxygenase-1 expression. J Neurochem 115:1668-1680.

Jung SH, Woo MS, Kim SY, Kim WK, Hyun JW, Kim EJ, Kim DH, and Kim HS

(2006) Ginseng saponin metabolite suppresses phorbol ester-induced matrix

metalloproteinase-9 expression through inhibition of activator protein-1 and mitogen-

activated protein kinase signaling pathways in human astroglioma cells. Int J Cancer

118:490-497.

Kato H, and Kogure K (1999) Biochemical and molecular characteristics of the brain

with developing cerebral infarction. Cell Mol Neurobiol 19:93-108.

Lee B, Cao R, Choi YS, Cho HY, Rhee AD, Hah CK, Hoyt KR, and Obrietan K (2009)

The CREB/CRE transcriptional pathway: protection against oxidative stress-mediated

neuronal cell death. J Neurochem 108:1251-1265.

Lee CH, and Kim SY (2009) NF-κB and therapeutic approach. Biomol Ther 17:219-240.

Lee NJ, Lee JW, Sung JH, Lee YJ, and Kang JK (2011) In vitro antioxidant properties

of a ginseng intestinal metabolite IH-901. Lab Anim Res 27(3):227-234.

Lin TN, He YY, Wu G, Khan M, and Hsu CY (1993) Effect of brain edema on infarct

volume in a focal cerebral ischemia model in rats. Stroke 24:117-121. Liu JW, Tian SJ, de Barry J, and Luu B (2007) Panaxadiol glycosides that induce

neuronal differentiation in neurosphere stem cells. J Nat Prod 70:1329-1334. Min KJ, Yang MS, Kim SU, Jou I, and Joe E (2006) Astrocytes induce hemeoxygenase-


at ASPE



ownloaded from


JPET #189035

25

1 expression in microglia: a feasible mechanism for preventing excessive brain

inflammation. J Neurosci 26:1880-1887.

Naidu S, Vijayan V, Santoso S, Kietzmann T, and Immenschuh S (2009) Inhibition and

genetic deficiency of p38 MAPK up-regulates heme oxygenase-1 gene expression via

Nrf2. J Immunol 11:7048-7057.

Nakahira K, Kim HP, and Geng XH (2006) Carbon monoxide differentially inhibits

TLR signaling pathways by regulating ROS-induced trafficking of TLRs to lipid rafts. J

Exp Med 203:2377-2389.

Park JS, Park EM, Kim DH, Jung K, Jung JS, Lee EJ, Hyun JW, Kang JL, and Kim HS

(2009) Anti-inflammatory mechanism of ginseng saponins in activated microglia. J

Neuroimmunol 209:40-49.

Qin L, Li G, Qian X, Liu Y, Wu X, Liu B, Hong JS, and Block ML (2005) Interactive

role of the toll-like receptor 4 and reactive oxygen species in LPS-induced microglia

activation. Glia 52:78-84.

Radad K, Moldzio R, and Rausch WD (2010) Use Ginsenosides and their CNS targets.

CNS Neurosci Ther 17(6):761-768

Rushworth SA, MacEwan DJ, and O’Connell MA (2008) Lipopolysaccharide-induced

expression of NAD(P)H:quinone oxidoreductase 1 and hemeoxygenase-1 protects

against excessive inflammatory responses in human monocytes. J Immunol 181:6730-

6737.

Sayre LM, Perry G, and Smith MA (2008) Oxidative stress and neurotoxicity. Chem Res

Toxicol 2:172–188.

Shen L, and Zhang J (2007) NMDA receptor and iNOS are involved in the effects of

ginsenoside Rg1 on hippocamcal neurogenesis in ischemic gerbils. Neurol Res 29:270-

273.

Shin JA, Park EM, Choi JS, Seo SM, Kang JL, Lee KE, and Cho S (2009) Ischemic

preconditioning-induced neuroprotection is associated with differential expression of


at ASPE



ownloaded from


JPET #189035

26

IL-1beta and IL-1 receptor antagonist in the ischemic cortex. J Neuroimmunol 217:14-

19.

Shin JA, Lee EJ, Seo SM, Kim HS, Kang JL, and Park EM (2010a) Nanosized titanium

dioxide enhanced inflammatory responses in the septic brain of mouse. Neuroscience

165:445-454.

Shin JA, Lee H, Lim YK, Koh Y, Choi JH, and Park EM (2010b) Therapeutic effects of

resveratrol during acute periods following experimental ischemic stroke. J


Smale ST (2010) Selective transcription in response to an inflammatory stimulus. Cell

140:833-844.

So HS, Kim HJ, and Lee JH (2006) Flunarizine induces Nrf2-mediated transcriptional

activation of heme oxygenase-1 in protection of auditory cells from cisplatin. Cell

Death Differen 13:1763-1775.

Sorce S, and Krause KH (2009) Nox enzymes in the central nervous system: from

signaling to disease. Antioxid Redox Signal 11:2481-2504.

Stolp HB, and Dziegielewska KM (2009) Review: Role of developmental inflammation

and blood-brain barrier dysfunction in neurodevelopmental and neurodegenerative

diseases. Neuropathol. Appl Neurobiol 35:132-146.

Volonté C, Amadio S, Cavaliere F, D'Ambrosi N, Vacca F, and Bernardi G (2003)

Extracellular ATP and neurodegeneration. Curr Drug Targets CNS Neurol Disord 2:403-

412.

Wang Q, Tang XN, and Yenari MA (2007) The inflammatory response in stroke. J


Wang YZ, Chen J, Chu SF, Wang YS, Wang XY, Chen NH, and Zhang JT (2009)

Improvement of memory in mice and increase of hippocampal excitability in rats by

ginsenoside Rg1’s metabolites ginsenoside Rh1 and protopanaxatriol. J Pharmacol Sci

109:504-510.


at ASPE



ownloaded from


JPET #189035

27

Woo MS, Jang PG, Park JS, Kim WK, Joh TH, and Kim HS (2003) Selective

modulation of lipopolysaccharide-stimulated cytokine expression and mitogen-activated

protein kinase pathways by dibutyryl-cAMP in BV2 microglial cells. Brain Res Mol

Brain Res 113:86-96.

Yang CS, Ko SR, Cho BG, Shin DM, Yuk JM, Li S, Kim JM, Evans RM, Jung JS, Song

DK, and Jo EK (2008) The ginsenoside metabolite compound K, a novel agonist of

glucocorticoid receptor, induces tolerance to endotoxin-induced lethal shock. J Cell Mol

Med 12:1739-1753.

Yuan QL, Yang CX, Xu P, Gao XQ, Deng L, Chen P, Sun, ZL, and Chen QY (2007)

Neuroprotective effects of ginsenoside Rb1 in transient cerebral ischemic in rats. Brain

Res 1167:11-12.

Zhang B, Hata R, Zhu P, Sato K, Wen TC, Yang L, Fujita H, Mitsuda N, Tanaka J,

Samukawa K, Maeda N, and Sakanaka M (2006) Prevention of ischemic neuronal death

by intravenous infusion of a ginseng saponin Rb1 that upregualtes Bcl-XL expression. J

Cereb Blood Flow Metab 26:708-721.

Zhao H, Li Q, Pei X, Zhang Z, Yang R, Wang J, and Li Y (2009) Long-term ginsenoside

administration prevents memory impairment in aged C57BL/6J mice by upregulating

the synaptic plasticity-related proteins in hippocampus. Behav Brain Res 201:311-317.


at ASPE



ownloaded from


JPET #189035

28

Footnotes

This work was supported by the National Research Foundation of Korea (NRF) grant

funded by the Korea government [Grant 2010-0029354].

H.S.K. and E.M.P. contributed equally to this work.


at ASPE



ownloaded from


JPET #189035

29

Legends for Figures

Fig. 1. The chemical structure of compound K.

Fig. 2. Compound K inhibits the expressions of proinflammatory molecules in

LPS-stimulated BV2 and primary microglial cells. (A) Cells were pre-treated with

compound K for 1 h, followed by treatment with LPS (0.1 μg/ml) for 24 h. The amounts

of nitrite in the supernatants were measured using Griess reagent, and TNF-α and IL-1β

were measured by ELISA. The data are expressed as the mean ± S.E.M. of four

independent experiments. *P < 0.05, compared to the value in cells treated with LPS

alone. (B) Total RNA was isolated from microglial cells treated with LPS in the absence

or presence of compound K for 6 h, and RT-PCR was performed to determine the

mRNA levels of iNOS, TNF-α, IL-1β, IL-6, MCP-1, MMP-3 and MMP-9. The data are

representative of three independent experiments.

Fig. 3. Compound K inhibits DNA binding activities of NF-κB and AP-1 with

increasing nuclear protein binding to CRE. (A) Electrophoretic mobility shift assay

(EMSA) for NF-κB DNA binding activity. The arrow indicates a DNA-protein complex

of NF-κB. ‘F’ indicates free probe. Antibody supershift assay data is shown in the right

panel. Coincubation with p65 or p50 antibody but not with Sp1 antibody diminished

formation of NF-κB complex and/or generated supershift bands as indicated by arrows.

(B) NF-κB reporter gene assay. BV2 cells were transfected with (κB)3-luc plasmid and

pre-treated with compound K for 1 h before addition of LPS. After 6 h of LPS treatment,

cells were harvested and the luciferase assay was performed. Values correspond to the

mean ± S.E.M. of three independent experiments performed in duplicate. *P < 0.05,


at ASPE



ownloaded from


JPET #189035

30

significantly different from the value in cells treated with LPS alone. (C, D) EMSA for

AP-1 and CRE binding activity. The autoradiograms are representative of three

independent experiments.

Fig. 4. Compound K inhibits LPS-induced ROS production and phosphorylation

of NADPH oxidase p47phox and MAP kinases. (A) BV2 and primary microglial cells

were pre-treated with compound K for 1 h, followed by treatment with LPS (0.1 μg/ml)

for 16 h. Then, the intracellular ROS levels were measured by the DCF-DA method as

described in the Materials and Methods section. The data are expressed as the mean ±

S.E.M. of three independent experiments. *P < 0.05, significantly different from LPS-

treated sample. (B) The representative picture of DCF-derived fluorescence in BV2

cells (n = 3). (C) Western blot analysis for phosphorylation of p47phox in BV2 cells and

densitography. Values correspond to the mean ± S.E.M. of three independent

experiments. *P < 0.05, significantly different from LPS-treated samples. (D) Western

blot detection of MAP kinases phosphorylation in BV2 cells. The blots are

representative of four independent experiments.

Fig. 5. Compound K increased HO-1 expression and ARE-mediated

transcriptional activities in LPS-stimulated microglia. (A) Western blot analysis

shows the effect of compound K on HO-1 protein expression. BV2 cells were treated

with compound K with or without LPS for 24 h and cell lysates were obtained. (B) RT-

PCR was performed to determine the HO-1 mRNA expression. Quantification data are

shown in the graph (n = 3). (C) EMSA for nuclear protein binding to ARE element (n =

3). The arrow indicates a DNA-protein complex of ARE. (D) BV2 cells were


at ASPE



ownloaded from


JPET #189035

31

transfected with ARE-luc plasmid and pre-treated with compound K for 1 h before

addition of LPS. After 6 h of LPS treatment, cells were harvested and the luciferase

assay was performed. Data are the mean ± S.E.M. of three independent experiments. *P

< 0.05, significantly different from the control sample. #P < 0.05, significantly different

from the LPS-treated sample.

Fig. 6. Compound K reduced inflammatory responses in the septic brain of mice.

(A) Immunofluorescence labeling of Iba1 and quantification of the number of activated

Iba1-positive cells in the cortex and striatum 3 h after systemic LPS treatment (5 mg/kg).

Representative images were obtained from one set of experiments and three

experiments were done independently. Veh, vehicle; Comp K, compound K. The data

are the mean ± S.E.M. (B) Western blots for IL-1β, TNF-α, and actin in the cortex 6 h

after LPS treatment, and quantification of IL-1β and TNF-α protein levels with

normalization by actin (n = 3 in each group). Values (mean ± S.E.M.) are the ratio vs.

controls (assigned a nominal value of 1). *P < 0.05, significantly different from the

value in control mice. #P < 0.05, significantly different from the value in vehicle-treated

mice.

Fig. 7. Compound K reduced ischemic brain injury of mice and suppressed

microglial activation in the post-ischemic brain. (A) Representative brain sections of

cresyl violet staining and infarct volumes in total brain, cortex, and striatum from mice

pre-treated with vehicle (n = 7) or compound K (n = 8). Dotted lines in brain sections

indicate infracted areas. *P < 0.05, significantly different from vehicle treated mice. The

data are the mean ± S.E.M. (B) Immunofluorescence labeling and quantification of


at ASPE



ownloaded from


JPET #189035

32

Iba1-positive cells (green) in the cortex and striatum 24 h after MCAO. Representative

images from one of three independent experiments are shown. Comp K, compound K.

The data are the mean ± S.E.M. *P < 0.05, significantly different from the value in

control mice. #P < 0.05, significantly different from the value in vehicle-treated mice.


at ASPE



ownloaded from


Fig. 1

OH

Glc-O

HO


at ASPE



ownloaded from


[BV2 cells] [Primary microglia]

iNOS

TNF-α

IL-1β

(-)

+ LPS

25 50 75 (-)

+ LPS

(μM)25 50 75

MMP-3

IL-6

MCP-1

0 0Comp K

+ LPS + LPS

A [BV2 cells] [Primary microglia] B

Fig. 2

0

500

1000

25 50 75Comp K

TN

F-α

(pg

/ml)

1500

2000

0

500

1000

100

1500

2000

2500

200

300

400

IL-1

β

(pg

/ml)

100

200

300

400

25 50 75

0

20

40

60

80

Nit

rite

( μM

)

0

10

20

30

40

(μM)(-) (-)0 00 0

(μM)

**

*

**

** *

** *

** *

**

*

500500

100 50

2500 3000

GAPDH

MMP-9


at ASPE



ownloaded from


Fig. 3

A

2

4

6

8

Rel

ativ

e lu

cife

rase

act

ivit

y

Reporter plasmid: (κB)3-Luc

25 50Comp K (μM)(-) 0

+ LPS

B

C D

Comp K (μM)

NF-κB

0 25 50

+ LPS

AP-1

◀ F

◀ F

CREB

◀ F

(-)

**

NF-κB

◀ F

supershift

α p50 α p65 α Sp1Ab :

Comp K (μM)0 25 50

+ LPS

(-) Comp K (μM)0 25 50

+ LPS

(-)

(-)


at ASPE



ownloaded from


Fig. 4

(-)

p-p47phox

β-actin

(μM)0 25 50

+ LPS

2

6

8

Fo

ld In

du

ctio

n

4

(p-p

47p

ho

x/ β

-act

in)

Comp K

0

C

(-) (μM)0 25 50

+ LPSD

Comp K

p-ERK

ERK

JNK

p-JNK

p38

p-p38

* *

1

2

3Control LPS

L+CK 25μM L+CK 50μM

25 50 75Comp K 25 50 75 (μM)(-) (-)0 0

[BV2 cells] [Primary microglia] A

+ LPS + LPS

B

* **

* * *

RO

S p

rod

uct

ion

(f

old

ind

uct

ion

)


at ASPE



ownloaded from


Fig. 5

ARE+ protein

complex

Comp K (μM)0 0 25 50

+ LPS

◀ F

C DReporter plasmid: ARE-Luc

Rel

ativ

e lu

cife

rase

act

ivit

y

1

2

3

(μM)25 50Comp K (-) 25 50 0

+ LPS

HO-1

0 25 50Comp K 0 25 50 (μM)

+ LPS

β-actin

A

Fo

ld in

du

ctio

n

2

4

6 # #

(HO

-1/β

-act

in)

**

HO-1

0 25 50Comp K 0 25 50 (μM)

+ LPSB

Fo

ld in

du

ctio

n4

8

12

(HO

-1/G

AP

DH

)

##

* *

**

##

GAPDH


at ASPE



ownloaded from


Fig. 6


at ASPE



ownloaded from


Fig. 7


at ASPE



ownloaded from


title page anti-inflammatory mechanism of compound k in...

Documents