TIP47, a Lipid Cargo Protein Involved in MacrophageTriglyceride Metabolism

Insa Buers, Horst Robenek, Stefan Lorkowski, Yvonne Nitschke, Nicholas J. Severs, Oliver Hofnagel

Objective—Uptake of lipids by macrophages (M�) leads to lipid droplet accumulation and foam cell formation. The PATfamily proteins are implicated in lipid droplet formation, but the precise function of the 47-kDa tail interacting protein(TIP47), a member of this family, is poorly defined. The present study was performed to determine the function of TIP47in M� lipid metabolism.

Methods and Results—Freeze-fracture cytochemistry demonstrates that TIP47 is present in the plasma membrane of M�and is aggregated into clusters when the cells are incubated with oleate. Suppression of adipophilin levels using siRNAknockdown leads to migration of TIP47 from a cytoplasmic pool to the lipid droplet. Further, reduction of TIP47decreases triglyceride levels, whereas raising TIP47 levels by expression of EGFP-TIP47 shows the opposite effect.

Conclusion—Our results show that the TIP47 protein levels directly correlate with triglyceride levels. We propose that TIP47may act as a carrier protein for free fatty acids and in this way participates in conversion of M� into foam cells. (ArteriosclerThromb Vasc Biol. 2009;29:767-773.)

Key Words: TIP47 � triglyceride metabolism � macrophages � PAT proteins � lipid droplets

The uptake of lipids by macrophages (M�) resulting intheir conversion to foam cells is a hallmark of athero-

sclerosis. The accumulation of cholesterol esters in M� canbe induced in vitro by incubation of the cells with modifiedlow density lipoprotein (LDL), eg, acetylated LDL (acLDL),which is taken up by scavenger receptors. The accumulationof triglycerides in M� can be mediated in vitro by incubationwith free fatty acids (eg, oleate) or very low density lipopro-tein (VLDL). The lipid loading of M� with cholesterol estersand triglycerides results in the formation of lipid droplets(LD), a process critical not only to atherosclerosis, but also todiabetes and obesity.1–5 The molecular mechanisms regulat-ing the formation and metabolism of LD are not wellunderstood. Structurally, LD consist of a lipid core sur-rounded by a phospholipid monolayer, which contains vari-ous proteins involved in lipid metabolic processes such aslipolysis or lipogenesis.6–8

The most abundant LD-associated proteins are those of thePAT family (the collective term for perilipin, adipophilin andthe tail interacting protein of 47 kDa, TIP47). Perilipinexpression is limited to adipocytes, steroidogenic cells, andM�9–11; whereas adipophilin and TIP47 are more widelyexpressed.12,13

The most prominent LD-associated protein in M� isadipophilin, found both at the surface of LD and also withinthe core.14,15 Although adipophilin is widely held not to be

present in any other subcellular compartments, our recentstudies using high-resolution freeze-fracture electron micros-copy combined with immunogold labeling demonstrate thatthis protein is also expressed in the plasma membrane andendoplasmic reticulum.16,17 Sequence analysis and functionalstudies reveal that adipophilin is able to bind free fatty acids18

and cholesterol.19

TIP47 was originally described as a cytosolic proteinwhich binds to the cytoplasmic domains of the cation-dependent and cation-independent mannose 6-phosphate re-ceptors.20 Subsequent studies reported TIP47 at the LDsurface of HeLa cells13 and other cell types.14,21,22 Our recentstudies revealed that TIP47 is not restricted to cytosoliccompartments but is also localized in the LD core and in theplasma membrane of THP-1 M� in a similar manner to thatfound with adipophilin.14–16 The highly conserved C-terminalPAT domain of TIP47 and adipophilin suggests that bothproteins share a common lipid binding site.23 This lipidbinding site consists of a 4 helix bundle which forms, togetherwith �/� sheets, a hydrophobic cleft that is suggested to bindfatty acids.

The function of adipophilin and TIP47 in foam cellformation is only poorly understood. Lipid loading of humanmonocytes24 or M�5,25 results in an increased adipophilinexpression. Overexpression of adipophilin increased lipidaccumulation5; conversely, adipophilin knockdown de-

Received July 31, 2008; revision accepted February 18, 2009.From the Leibniz Institute for Arteriosclerosis Research (I.B., H.R., O.H.), Muenster, Germany; the Institute of Nutrition (S.L.), University of Jena,

Germany; the Department of General Pediatrics (Y.N.), University Children’s Hospital, Munster, Germany; and the National Heart and Lung Institute(N.J.S.), Imperial College London, UK.

Correspondence to Insa Buers, Leibniz Institute for Arteriosclerosis Research, Domagkstr. 3, 48149 Muenster, Germany. E-maili_buer01@uni-muenster.de

© 2009 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.108.182675

767

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

creased the lipid content of THP-1 M�.5 Paul et al26 revealedthat M� of ApoE�/�/adipophilin�/� mice exhibit an impairedability to accumulate intracellular LD and that the lack ofadipophilin in these mice protects against atherosclerosis.

In contrast to adipophilin, little is known regarding TIP47in M� lipid metabolism and foam cell formation. The presentstudy therefore set out to investigate the function of TIP47 onTHP-1 M� lipid metabolism.

MethodsCell CultureHuman monocytic THP-1 cells were cultured in RPMI 1640 mediumcontaining the supplements recommended by Schnoor et al.27 THP-1monocytes differentiated to adherent M� by addition of 100 �mol/Lphorbol 12-myristate 13-acetate (Sigma-Aldrich) to the medium for72 hours.

Preparation of LipoproteinsVLDL (d�1.006 g/mL) was isolated from human plasma ofindividual normolipidemic volunteers by sequential ultracentrif-ugation in a Beckmann L7-65 ultracentrifuge using a 70 Ti rotoroperated at 59 000 rpm at 4°C for 24 hours. The top fraction wasdialyzed at 4°C for 72 hours in 0.15 mol/L NaCl containing0.3 mmol/L EDTA (pH 7.4). Oleate and acLDL was prepared asdescribed previously.15

AntibodiesAntibodies were purchased from Progen Biotechnik, abcam,Dianova, and Jackson Immunoresearch. For details, please seethe supplemental materials (available online at http://atvb.ahajournals.org).

ImmunofluorescenceCells were fixed with 4% paraformaldehyde, blocked, permeabil-ized, fluorescently labeled with specific antibodies, and examinedusing a laser-scanning confocal microscope LSM510 (Zeiss). Fordetails please see the supplemental materials.

Freeze-Fracture ReplicationFreeze-fracture replication, nomenclature, and interpretation of freeze-fracture replica immunolabeling data were as described by Robeneket al.14–17 For details please see the supplemental materials.

Plasmid Generation and siRNA ConstructionFull-length TIP47 sequence and 4 truncation mutations werecloned into pEGFP-C1 expression vector (Clontech Laborato-ries). TIP47 specific siRNA and the negative control werepurchased from Qiagen. Adipophilin specific siRNA was ob-tained by Invitrogen. For details please see the supplementalmaterials.

TransfectionTHP-1 M� were transfected using the nucleofection method ofamaxa. For details please see the supplemental materials.

Real-Time RT-PCRIsolation of RNA and synthesis of cDNA were performed asdescribed by Schnoor et al.27 We performed real-time RT-PCR usingthe ABI PRISM 7900HT sequence detection system (AppliedBiosystems) and the QuantiTect SYBR Green PCR kit (Qiagen). Fordetails please see the supplemental materials.

LD IsolationTransfected THP-1 M� were scraped in 40% iodixanol buffer(Progen Biotechnik). Cells were homogenized by sonication andthen transferred to the bottom of a centrifuge tube and overlaid with

30% and 20% iodixanol buffer. LD were isolated by using densitygradient centrifugation. For details please see the supplementalmaterials.

SDS-PAGE and Western Blot AnalysisTransfected THP-1 M� were scraped in HIDE buffer. 10 �g of totalprotein per lane was loaded on 10% SDS-polyacrylamide gels.Proteins were transferred to Immobilon-P polyvinylidene fluoridemembranes (Millipore). Membranes were labeled with specificprimary and secondary antibodies. For details please see the supple-mental materials.

Measurement of Cholesterol andTriglyceride ContentTriglyceride and total cholesterol content were measured using theGPO/PAP and CHOD/PAP method (ProDiagnostica) according tothe manufacturer’s instructions. Protein content of the lysate wasmeasured by using the Bradford protein assay (Bio-Rad). For detailsplease see the supplemental materials.

ResultsTIP47 Clusters in Specific Plasma MembraneDomains After Oleate IncubationFreeze-fracture replica immunogold labeling demonstratedthat TIP47 is present in the plasma membrane of THP-1 M�(Figure 1). The TIP47 label was widely dispersed in theplasma membrane under normal culture conditions (data notshown), but lipid loading with oleate for 24 hours resulted inits clustering in discrete raised plasma membrane domains.Fractures penetrating beneath the plasma membrane demon-strate that LD are closely apposed to the raised TIP47protein-enriched domains (Figure 1).

TIP47 Localizes to LD AfterAdipophilin KnockdownThe close association between the TIP47 plasma membraneclusters and underlying LD suggests a specialized function

Figure 1. Immunolabeled freeze-fracture replica demonstratingendogenous TIP47 in the P-face (PF) of the plasma membrane(PM) of THP-1 M�. TIP47 clusters after oleate incubation onelevated membrane domains. Fractures that penetrate beneaththese domains demonstrate that LD lie immediately below. Bar:0.5 �m.

768 Arterioscler Thromb Vasc Biol May 2009

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

for these membrane domains in M� lipid metabolism. Toexplore this possibility we applied siRNA-induced knock-down of TIP47 and adipophilin. Transient transfection ofTIP47 siRNA resulted in a 60% reduction of TIP47 proteinexpression with no significant alteration in the level ofadipophilin (supplemental Figure IA). The TIP47 mRNAlevel was correspondingly reduced by 80% and the adipophi-lin mRNA level unchanged (supplemental Figure IB). Trans-fection of adipophilin siRNA knocked down adipophilinprotein concentration by 55% and transcript levels by 80%without affecting TIP47 protein or transcript concentrations(supplemental Figure IA and IB).

We then investigated the PAT protein distribution patternof M� after transfection of adipophilin and TIP47 siRNA.Forty-eight hours after transfection with adipophilin siRNA,THP-1 M� were incubated for 24 hours with acLDL oroleate. Immunofluorescence microscopy revealed that perili-pin was undetectable at the LD surface in the knockdowncells. TIP47 labeling in untransfected control cells was

mostly in the cytoplasm and adipophilin exclusively at theLD surface (Figure 2A through 2C). After acLDL incubationof adipophilin suppressed cells, however, a remarkable redis-tribution of TIP47 to the LD was apparent (Figure 2D through2F, arrows).

As with the nontransfected acLDL loaded cells, nontrans-fected cells incubated with oleate showed adipophilin prom-inently at the LD and TIP47 diffusely localized in thecytoplasm with only occasional instances of colocalization ofthe proteins at the LD surface (Figure 2G through 2I, arrows).Oleate incubation of adipophilin suppressed cells led to amarked redistribution of TIP47 to the LD surface (Figure 2Jthrough 2L, arrows) similar to but more pronounced than thatobserved in the corresponding acLDL adipophilin knock-down cells.

To verify these results, we isolated LD from control andsiRNA transfected cells after incubation with acLDL, VLDL,and oleate. In accordance with the immunofluorescencefindings, the TIP47 protein level was slightly increased in

Figure 2. Immunofluorescence localization of TIP47 after adipophilin knockdown and lipid incubation. A through F, Control cells andadipophilin knockdown cells were incubated with acLDL. TIP47 redistributes to LD (arrows) after adipophilin knockdown. G through L,Incubation with oleate after adipophilin knockdown results in a marked TIP47 redistribution to the LD surface. Bars: 6 �m.

Buers et al TIP47 Affects Triglyceride Metabolism 769

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

unloaded and acLDL loaded cells after adipophilin suppres-sion. Incubation with VLDL or oleate resulted in respectivelya 30% or 85% increase in TIP47-protein level at the LD(supplemental Figure IIA and IIB). Knockdown of TIP47 hadno influence on the adipophilin protein concentration at theLD (supplemental Figure IIA and IIC).

TIP47 Knockdown Influences the Triglyceride butNot the Cholesterol ContentThe altered localization of TIP47 observed after adipophilinknockdown or lipid loading raises the possibility that TIP47plays a role in lipid storage in M�. We therefore analyzed thetriglyceride and cholesterol content of unloaded and lipid-loaded control and siRNA transfected cells (Figure 3).Knockdown of adipophilin and TIP47 in unloaded cellssignificantly decreased triglyceride content (Figure 3A). In-cubation with acLDL did not influence the triglyceridecontent of control cells, but suppression of TIP47 or adi-pophilin expression slightly reduced the triglyceride content.Supplementation of acLDL with triacsin C, an inhibitor of theacyl-coenzyme A synthetase which esterifies free fatty acidswith coenzyme A, did not enhance this effect. Both VLDLand oleate incubation resulted in strongly increased triglyc-eride levels compared to unloaded cells. Triglyceride levels inadipophilin-suppressed cells were enhanced after VLDL andoleate incubation. Knockdown of TIP47 resulted in a signif-icantly lower triglyceride content after VLDL or oleateincubation. Incubation with triacsin C abrogated partly theVLDL or oleate-induced triglyceride increase. When triacsinC was added to VLDL or oleate incubated cells, the overalllevels of triglyceride were reduced in controls and TIP47-

suppressed samples, but the magnitude of the reduction afterTIP47 suppression was not altered by triacsin C (Figure 3A).

AcLDL incubation resulted in strongly increased choles-terol levels compared to unloaded cells. The cholesterol levelof adipophilin knockdown cells was significantly decreasedin unloaded and lipid loaded cells, whereas that of TIP47knockdown cells was unaffected in acLDL treated cells(Figure 3B). Incubation with VLDL or oleate had no influ-ence on the cholesterol content compared to control cells.Triacsin C had no effect on the cholesterol level.

Suppression of TIP47 Does Not Influence aP2or mal1The altered triglyceride content after TIP47 or adipophilinsuppression suggests that TIP47 is able to transport fattyacids to LD. To exclude the possibility that the alteredtriglyceride content could be attributable to regulation ofother fatty acid binding proteins (FABP) such as aP2 or mal1,we investigated the protein level of both these proteins aftersuppression of TIP47 or adipophilin. Western blot analysisshowed that alterations in TIP47 or adipophilin protein levelsdo not influence aP2 or mal1 in the presence or absence ofoleate or VLDL (supplemental Figure IV).

Effects of Enhancing TIP47 Levels UsingFull-Length and Truncated EGFP-TIP47 VectorsTo verify further the relationship between TIP47 expressionand triglyceride levels as deduced from the siRNA knock-down, we determined the effects of expression of full-lengthand truncated fragments of TIP47 (Figure 4A) in M�.Western blot analysis (supplemental Figure III) demonstratedexpression of EGFP-TIP47 and the truncated fragments of

α/β α/β4-helixTIP47

full length

aa 1-198

aa 1-248

aa 1-416

aa 198-434

A

B

0

50

100

150

200

250

300

350

unloaded VLDL VLDL + triacsin C oleate oleate + triacsin C

trig

lyce

ride

[% o

f con

trol

]

EGFP EGFP-TIP47 EGFP-TIP47-aa1-198EGFP-TIP47-aa1-248 EGFP-TIP47-aa1-416 EGFP-TIP47-aa198-434

***

**

*

* * *

* **

**

*

Figure 4. Expression of EGFP-TIP47 constructs in THP-1 M�.A, Diagram of the structure of the constructs. B, Triglyceridecontent of cells expressing EGFP-TIP47, EGFP-TIP47-aa1-416,or EGFP-TIP47-aa198-434 is enhanced compared to controlcells. Values for each bar are means�SEM, n�4; *P�0.05 vs con-trol cells.

A

0,00

100,00

200,00

300,00

400,00

500,00

600,00

unloaded acLDL acLDL +triacsin C

VLDL VLDL +triacsin C

oleate oleate +triacsin C

trig

lyce

ride

[% o

f con

trol

]

control siRNA adipophilin siRNA TIP47 siRNA

0,00

50,00

100,00

150,00

200,00

250,00

300,00

unloaded acLDL acLDL +triacsin C

VLDL VLDL +triacsin C

oleate oleate +triacsin C

chol

este

rol [

% o

f con

trol

]

control siRNA adipophilin siRNA TIP47 siRNA

*

*

*

*

*

*

*

*****

** *

* * * *

B

Figure 3. Effect of adipophilin and TIP47 knockdown on (A) tri-glyceride and (B) cholesterol levels. Transfected THP-1 M�were incubated with acLDL, VLDL, and oleate in the presenceor absence of triacsin C. Values for each bar are means�SEM,n�4; *P�0.05 vs control siRNA cells.

770 Arterioscler Thromb Vasc Biol May 2009

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

TIP47. The additional expression of EGFP-TIP47, EGFP-TIP47-aa1-416, or EGFP-TIP47-aa198-434 had the oppositeeffect to that obtained by siRNA knockdown of TIP47, ie,triglyceride levels were elevated rather than depressed. Thiseffect was found in both VLDL and oleate incubated cells(Figure 4B). No effect was found after acLDL incubation(data not shown). Triacsin C supplementation resulted indecreased triglyceride levels of all treatments. EGFP-TIP47,EGFP-TIP47-aa1-416, or EGFP-TIP47-aa198-434 expres-sion led to enhanced triglyceride levels after VLDL andoleate incubation, even in the presence of triacsin C comparedto the control (Figure 4B). In contrast to this, the expressionof EGFP-TIP47-aa1-198 and EGFP-TIP47-aa1-248 had noeffect on the triglyceride level compared to EGFP-controlcells. Similar to the siRNA knockdown experiments, thecholesterol content was not altered when overall levels ofTIP47 were increased by expression of EGFP-TIP47 and thetruncated TIP47 fragments.

TIP47 Colocalizes With DGAT at the LD SurfaceIf TIP47 is able to transport fatty acids to lipid droplets, thenthese fatty acids would be incorporated into triglycerides forstorage. We therefore investigated whether acyl-coenzymeA:diacylglycerol acyl-transferase (DGAT), the enzyme whichcatalyzes the terminal step in triglyceride synthesis, is local-ized at the LD surface. Immunofluorescence microscopy

showed that, after adipophilin suppression, DGAT is indeedlocalized at the LD surface as is TIP47 (Figure 5A through5C). Freeze-fracture replica immunogold labeling confirmedthe colocalization of TIP47 and the DGAT at the LDmonolayer (Figure 5D and 5E).

DiscussionA novel key finding of the present study is that TIP47 isactively redistributed from the cytosolic compartment to theLD to replace adipophilin when the latter is removed bysiRNA knockdown. This is linked to an enhanced cellulartriglyceride level after oleate and VLDL incubation. WhenTIP47 expression is suppressed, triglyceride levels decrease;conversely, when TIP47 levels are increased by expression ofEGFP-TIP47 alongside endogenous TIP47, the triglyceridecontent is increased. These findings shed new light on therelevance of TIP47 in M� lipid accumulation, in particularby pointing to a role for this protein in triglyceridemetabolism.

Decreased expression of one PAT family protein can insome instances lead to increased expression and functionalsubstitution by another, as reported with adipophilin andperilipin.12 It might, therefore, be predicted that TIP47expression would increase in adipophilin knockdown cells.Recent studies have indeed reported increased TIP47 expres-

Figure 5. Distribution of TIP47 and DGAT in THP-1 M�. A through C, TIP47 and DGAT labeling shows distinct rings surrounding theLD after adipophilin suppression. Bars: 4 �m. D and E, Double imunolabeled freeze-fracture replicas show abundant labeling of bothTIP47 and DGAT (encircled) at the LD phospholipid monolayer P-face. Bar: 0.2 �m.

Buers et al TIP47 Affects Triglyceride Metabolism 771

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

sion in fibroblasts of adipophilin knockout mice and thatTIP47 may substitute for adipophilin at the LD surface ofthese cells.28 However, peritoneal M� of these mice show noalteration in TIP47 mRNA and protein expression, raising thepossibility that other LD binding proteins may compensatefor the lack of adipophilin.26

Our findings show that when adipophilin is lacking, despiteno change in TIP47 level, a major redistribution of TIP47occurs to the normal site of adipophilin, the LD surface. Thefact that TIP47 mRNA and protein level did not increase inM� after adipophilin suppression may be explained by theability of TIP47, unlike other PAT family proteins, to exist ina soluble cytosolic form.26,29,30 The ability to bind at the LDsurface arises from the crystalline structure of TIP47 whichreveals 4 amphipathic helices23 that form a hydrophilicbundle similar to that of lipid-free apolipoprotein E. Duringlipid binding, the bundle of lipid-free apolipoprotein E opensto interact with the surface phospholipid monolayer of li-poproteins,31,32 and similar properties may permit TIP47 tobind to the LD monolayer.30 New synthesis of TIP47 inresponse to reduced adipophilin may not be necessary in viewof the substantial cytosolic pool of TIP47 that is availableimmediately for recruitment to the LD. The dramatic nature ofsuch recruitment in response to the reduction of adipophilinexpression is clearly demonstrated by our immunofluorescenceresults and confirmed by Western blot of isolated LD.

From our localization findings, it might be predicted thatTIP47 compensates functionally for adipophilin in M� choles-terol or triglyceride metabolism. To investigate this possibility,we examined total cholesterol and triglyceride contents in cellswith suppressed adipophilin and TIP47 levels. Larigauderie andcoworkers5 have previously shown that overexpression of adi-pophilin in the presence of acLDL leads to a higher cholesterollevel in THP-1 M� and that suppression of adipophilin in thepresence of acLDL conversely decreased the cholesterol content.We analyzed the influence of cholesterol ester-rich acLDL,triglyceride-rich VLDL, and oleate incubation on THP-1 M�with suppressed adipophilin and TIP47 levels. In accord withLarigauderie et al,5 our data show that adipophilin suppressiondecreases the total cholesterol content. Thus, the presence of LDTIP47 fails to prevent the effect arising from lack of adipophilin.Our data show that neither loss nor enhancement of TIP47 altersthe cholesterol content. Thus, TIP47 is unable to compensatefunctionally for adipophilin in THP-1 M�.

Previous studies have reported that oleate incubation increasesTIP47 protein concentration in HeLa cells.13 Others showed thatTIP47 is rapidly recruited from the cytosol to nascent LD whencells are provided with fatty acid,30 again raising the possibilitythat TIP47 might influence the triglyceride metabolism of M�.In contrast to the cholesterol level, our experiments showed thatthe triglyceride level was clearly influenced by TIP47 in THP-1M�. Our findings show that translocation of TIP47 from thecytosol to LD in adipophilin-suppressed cells treated with oleateor VLDL is also associated with markedly enhanced triglyceridelevels. This positive correlation between TIP47 and triglyceridelevels was apparent irrespective of whether TIP47 expressionwas suppressed or enhanced. This finding stands in contrast tothat of Larigauderie et al,25 who reported that adipophilinsuppression results in decreased triglyceride levels after VLDL

incubation. The reasons for this discrepancy are unclear, but onepossibility is that it might be related to the use of differenttransfection methods. Whereas Larigauderie et al used a stan-dard liposome-based transfection method, we applied thenucleofection method with a protocol that gives much highertransfection efficiency and excellent cell survival compared withestablished techniques, which we developed specifically for usewith THP-1 cells.

To exclude that changes in triglyceride content arise from theregulation of other FABPs in adipophilin or TIP47 knockdowncells, we examined aP2 and mal1 content in the THP1 M�.These two proteins are known to be involved in M� foam cellformation and atherogenesis.33 Our findings showed that neitheradipophilin suppression nor suppression of TIP47 influence thelevels of aP2 and mal1. We thus conclude that neither aP2 normal1 are responsible for the observed differences in the triglyc-eride content after TIP47 or adipophilin suppression.

Because previous studies showed that adipophilin is able tobind free fatty acids18 and TIP47 exhibits high sequencehomology to adipophilin, we examined which part of TIP47is able to bind fatty acids. Our results showed that, apart fromfull length TIP47, only the TIP47 fragments containing the 4helix domain were able to enhance the triglyceride content.This is in accordance with analysis of the crystal structure ofTIP47 which showed that the �/�-sheets and the 4 amphi-pathic helices of TIP47 build a hydrophobic cleft which isable to bind monomers. This hydrophobic cleft appears tofacilitate the binding of free fatty acids.

Having shown that the TIP47 redistribution in response toloss of adipophilin is implicated in triglyceride rather thancholesterol metabolism, our next step was to explore thepossible mechanism by applying triacsin C to inhibit acyl-coenzyme A synthetase, a key enzyme of triglyceride synthe-sis. This enzyme esterifies long chain fatty acids withcoenzyme A as they are incorporated into triglycerides. Ourfindings showed that TIP47 suppression results in decreasedtriglyceride levels. The magnitude of this effect was not en-hanced by addition of triacsin C, indicating that TIP47 influ-ences the triglyceride level at the step of acyl-coenzyme Asynthetase-mediated triglyceride synthesis. Expression of fulllength-TIP47 as well as TIP47 fragments containing the 4 helixdomain leads to an enhanced triglyceride level. This increasewas not influenced by triacsin C treatment. Our findings areconsistent with the idea that TIP47 may transport free fatty acidsactivated by acyl-coenzyme A synthetase from the cytosolic siteof the plasma membrane or from the cytoplasm to LD.

If TIP47 is able to transport free fatty acids to LD, the fattyacids would have to be incorporated into triglycerides forlong-term storage. This would imply that the LD monolayercontains enzymes for triglyceride metabolism. Our results re-vealed that the DGAT, which catalyzes the terminal step intriglyceride synthesis, colocalizes with TIP47 in the LD mono-layer. Our data are thus consistent with the notion that TIP47 maytransport free fatty acids to LD, and at the LD surface the activatedfree fatty acids are incorporated into triglycerides by DGAT.

Finally, given our conclusion that TIP47 may substitute forthe lack of adipophilin in triglyceride metabolism, what is thesignificance of the altered distribution of this protein found inthe plasma membrane of M� on oleate incubation? We

772 Arterioscler Thromb Vasc Biol May 2009

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

propose that the clustering of TIP47 in the plasma membranemay enhance the direct transport of activated free fatty acidsfrom the plasma membrane to LD. We speculate that TIP47is able to bind activated free fatty acids at the cytoplasmicmonolayer of the plasma membrane or in the cytoplasm andtransports them to LD. Opening of the 4 helix bundles mayfacilitate TIP47 binding at the LD surface. The integration ofTIP47 in the LD monolayer may promote the transfer of freefatty acids and their incorporation into triglycerides byDGAT. After releasing the lipids, TIP47 may dissociate fromthe LD and become available for new lipid binding. We thusenvisage TIP47 as stabilizing the triglyceride content of M�by acting as a lipid cargo protein. It is in this manner that wesuggest that TIP47 may promote M�-derived foam cellformation and act as a player in the pathogenesis ofatherosclerosis.

AcknowledgmentsWe thank Ingrid Otto-Valk, Karin Schlattmann, and MarianneOpalka for competent technical assistance.

Sources of FundingThis work was supported by the Deutsche Forschungsgemeinschaft,Sonderforschungsbereich 492, and the Karl & Lore Klein Stiftung.

DisclosuresNone.

References1. Murphy DJ. The biogenesis and functions of lipid bodies in animals,

plants and microorganisms. Prog Lipid Res. 2001;40:325–438.2. Umlauf E, Csaszar E, Moertelmaier M, Schuetz G, Parton RG, Prohaska

R. Association of stomatin with lipid bodies. J Biol Chem. 2004;279:23699–23709.

3. Liu P, Ying Y, Zhao Y, Mundy DJ, Zhu M, Anderson RG. Chinesehamster ovary K2 cell lipid droplets appear to be metabolic organellesinvolved in membrane traffic. J Biol Chem. 2003;279:3787–3792.

4. Wang XT, Reape J, Li X, Rayner K, Webb C, Burnand KG, Lysko PG.Induced expression of adipophilin mRNA in human macrophages stim-ulated with oxidized low-density lipoprotein and in atheroscleroticlesions. FEBS Lett. 1999;462:445–450.

5. Larigauderie G, Furman C, Jouye M, Lasselin C, Copin C, Fruchart JC,Castro G, Rouis M. Adipophilin enhances lipid accumulation andprevents lipid efflux from THP-1 macrophages: potential role in athero-genesis. Arterioscler Thromb Vasc Biol. 2004;24:504–510.

6. Brasaemle DL, Dolios G, Shapiro L, Wang R. Proteomic analysis ofproteins associated with lipid droplets of basal and lipolytically stim-ulated 3T3-L1 adipocytes. J Biol Chem. 2004;279:46835– 46842.

7. Fujimoto Y, Itabe H, Sakai J, Makita M, Noda J, Mori M, Higashi Y,Kojima S, Takano T. Identification of major proteins in the lipid droplet-enriched fraction isolated from the human hepatocyte cell line HuH7.Biochim Biophys Acta. 2004;1644:47–59.

8. Wu CC, Howell KE, Neville MC, Yates JR III, McManaman JL. Pro-teomics reveal a link between the endoplasmic reticulum and lipidsecretory mechanisms in mammary epithelial cells. Electrophoresis.2000;21:3470–3482.

9. Servetnick DA, Brasaemle DL, Gruia-Gray J, Kimmel AL, Wolff J,Londos C. Perilipins are associated with cholesteryl ester droplets insteroidogenic adrenal cortical and Leydig cells. J Biol Chem. 1995;270:16970–16973.

10. Blanchette-Mackie EJ, Dwyer NK, Barber T, Coxey RA, Takeda T,Rondinone CM, Theodorakis JL, Greenberg AS, Londos C. Perilipin islocated on the surface layer of intracellular lipid droplets in adipocytes.J Lipid Res. 1995;36:1211–1226.

11. Hofnagel O, Buers I, Schnoor M, Lorkowski S, Robenek H.Expression of perilipin isoforms in cell types involved in athero-genesis. Atherosclerosis. 2007;190:14 –15.

12. Brasaemle DL, Barber T, Wolins NE, Serrero G, Blanchette-Mackie EJ,Londos C. Adipose differentiation-related protein is an ubiquitouslyexpressed lipid storage droplet-associated protein. J Lipid Res. 1997;38:2249–2263.

13. Wolins NE, Rubin B, Brasaemle DL. TIP47 associates with lipid droplets.J Biol Chem. 2001;276:5101–5108.

14. Robenek H, Lorkowski S, Schnoor M, Troyer D. Spatial integration ofTIP47 and adipophilin in macrophage lipid bodies. J Biol Chem. 2005;280:5789–5794.

15. Robenek H, Robenek MJ, Troyer D. PAT family proteins pervade lipiddroplet cores. J Lipid Res. 2005;46:1331–1338.

16. Robenek H, Robenek MJ, Buers I, Lorkowski S, Hofnagel O, Troyer D,Severs NJ. Lipid droplets gain PAT family proteins by interaction withspecialized plasma membrane domains. J Biol Chem. 2005;280:26330–26338.

17. Robenek H, Hofnagel O, Buers I, Robenek MJ, Troyer D, Severs NJ.Adipophilin-enriched domains in the ER membrane are sites of lipiddroplet biogenesis. J Cell Sci. 2006;119:4215–4224.

18. Serrero G, Frolov A, Schroeder F, Tanaka K, Gelhaar L. Adipose differ-entiation related protein: expression, purification of recombinant proteinin Escherichia coli and characterization of its fatty acid binding prop-erties. Biochim Biophys Acta. 2000;1488:245–254.

19. Frolov A, Petrescu A, Atshaves BP, So PT, Gratton E, Serrero G, SchroederF. High density lipoprotein-mediated cholesterol uptake and targeting to lipiddroplets in intact L-cell fibroblasts. A single- and multiphoton fluorescenceapproach. J Biol Chem. 2000;275:12769–12780.

20. Diaz E, Pfeffer SR. TIP47: a cargo selection device for mannose6-phosphate receptor trafficking. Cell. 1998;93:433–443.

21. Than NG, Sumegi B, Bellyei S, Berki T, Szekeres G, Janaky T, Szigeti A,Bohn H, Than GN. Lipid droplet and milk lipid globule membraneassociated placental protein 17b (PP17b) is involved in apoptotic anddifferentiation processes of human epithelial cervical carcinoma cells.Eur J Biochem. 2003;270:1176–1188.

22. Straub BK, Stoeffel P, Heid H, Zimbelmann R, Schirmacher P. Dif-ferential pattern of lipid droplet-associated proteins and de novoperilipin expression in hepatocyte steatogenesis. Hepatology. 2008;47:1936 –1944.

23. Hickenbottom SJ, Kimmel AR, Londos C, Hurley JH. Structure of a lipiddroplet protein; the PAT family member TIP47. Structure. 2004;12:1199–1207.

24. Buechler C, Ritter M, Duong CQ, Orso E, Kapinsky M, Schmitz G.Adipophilin is a sensitive marker for lipid loading in human bloodmonocytes. Biochim Biophys Acta. 2001;1532:97–104.

25. Larigauderie G, Cuaz-Perolin C, Younes AB, Furman C, Lasselin C,Copin C, Jaye M, Fruchart JC, Rouis M. Adipophilin increasestriglyceride storage in human macrophages by stimulation of bio-synthesis and inhibition of beta-oxidation. FEBS J. 2006;273:3498 –3510.

26. Paul A, Chang BH, Li L, Yechoor VK, Chan L. Deficiency of adiposedifferentiation-related protein impairs foam cell formation and protectsagainst atherosclerosis. Circ Res. 2008;102:1492–1501.

27. Schnoor M, Cullen P, Lorkowski J, Stolle K, Robenek H, Troyer D,Rauterberg J, Lorkowski S. Production of type VI collagen by humanmacrophages: a new dimension in macrophage functional heterogeneity.J Immunol. 2008;180:5707–5719.

28. Sztalryd C, Bell M, Lu X, Mertz P, Hickenbottom S, Chang BH, Chan L,Kimmel AR, Londos C. Functional compensation for adiposedifferentiation-related protein (ADFP) by Tip47 in an ADFP nullembryonic cell line. J Biol Chem. 2006;281:34341–34348.

29. Miura SJ, Gan W, Brzostowski J, Parisi MJ, Schultz CJ, Londos C, Oliver B,Kimmel AR. Functional conservation for lipid storage droplet associationamong Perilipin, ADRP, and TIP47 (PAT)-related proteins in mammals,Drosophila, and Dictyostelium. J Biol Chem. 2002;277:32253–32257.

30. Wolins NE, Quaynor BK, Skinner JR, Schoenfish MJ, Tzekov A, BickelPE. S3-12, adipophilin, and TIP47 package lipid in adipocytes. J BiolChem. 2005;280:19146–19155.

31. Hatters DM, Peters-Libeu CA, Weisgraber KH. Apolipoprotein Estructure: insights into function. Trends Biochem Sci. 2006;31:445–454.

32. Saito H, Lund-Katz S, Phillips MC. Contributions of domain structureand lipid interaction to the functionality of exchangeable human apoli-poproteins. Prog Lipid Res. 2005;43:350–380.

33. Makowski L, Hotamisligil GS. The role of fatty acid binding proteins inmetabolic syndrome and atherosclerosis Curr Opin Lipidol. 2005,16:543–548.

Buers et al TIP47 Affects Triglyceride Metabolism 773

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

HofnagelInsa Buers, Horst Robenek, Stefan Lorkowski, Yvonne Nitschke, Nicholas J. Severs and Oliver

TIP47, a Lipid Cargo Protein Involved in Macrophage Triglyceride Metabolism

Print ISSN: 1079-5642. Online ISSN: 1524-4636 Copyright © 2009 American Heart Association, Inc. All rights reserved.

Greenville Avenue, Dallas, TX 75231is published by the American Heart Association, 7272Arteriosclerosis, Thrombosis, and Vascular Biology

doi: 10.1161/ATVBAHA.108.1826752009;29:767-773; originally published online March 12, 2009;Arterioscler Thromb Vasc Biol. 

http://atvb.ahajournals.org/content/29/5/767World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://atvb.ahajournals.org/content/suppl/2009/03/16/ATVBAHA.108.182675.DC1Data Supplement (unedited) at:

  http://atvb.ahajournals.org//subscriptions/

at: is onlineArteriosclerosis, Thrombosis, and Vascular Biology Information about subscribing to Subscriptions:

  http://www.lww.com/reprints

Information about reprints can be found online at: Reprints: 

document. Question and AnswerPermissions and Rightspage under Services. Further information about this process is available in the

which permission is being requested is located, click Request Permissions in the middle column of the WebCopyright Clearance Center, not the Editorial Office. Once the online version of the published article for

can be obtained via RightsLink, a service of theArteriosclerosis, Thrombosis, and Vascular Biologyin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:

by guest on July 7, 2018http://atvb.ahajournals.org/

Dow

nloaded from

1

Supplement material

TIP47, a lipid cargo protein involved in macrophage triglyceride metabolism Insa Buers1, Horst Robenek1, Stefan Lorkowski2, Yvonne Nitschke3, Nicholas J. Severs4

and Oliver Hofnagel1

1. Leibniz Institute for Arteriosclerosis Research, 48149 Muenster, Germany

2. Institute of Nutrition, University of Jena, 07743 Jena, Germany

3. Department of General Pediatrics, University Children’s Hospital, 48149 Münster, Germany

4. National Heart and Lung Institute, Imperial College London, U.K.

Methods

A polyclonal antibody raised in g

Antibodies

uinea pig against a synthetic polypeptide corresponding to

the N-terminus (amino acids 1-16) of human TIP47 (GP30; Progen Biotechnik) was used to

detect TIP47. Adipophilin was detected using a mouse monoclonal antibody against a

synthetic peptide representing the N-terminus (amino acids 5–27) of human adipophilin

(AP125; Progen Biotechnik). A polyclonal antibody raised in guinea pig against a synthetic

peptide corresponding to the N-terminal region of human perilipin, which is shared by all

known perilipin isoforms, was used to detect “pan”-perilipin (GP29, Progen Biotechnik).

Acyl-Coenzyme A:diacylglycerol acyl-transferase (DGAT) was detected using a goat

polyclonal antibody against a synthetic polypeptide corresponding to the internal sequence

(amino acids 305-317) of human DGAT (ab59034; abcam). EGFP was immunolabeled using

a rabbit polyclonal antibody raised against the entire sequence of GFP (ab290, abcam). A

polyclonal antibody raised in rabbit was used to detect full human full length aP2 (ab37267,

abcam). Human mal1 was detected using a mouse monoclonal antibody against the amino

acids 1-133 (ab54617, abcam). For fluorescence microscopy anti-guinea pig, anti-mouse or

2

anti-goat Cy3-conjugated or Cy2-conjugated secondary antibodies were used (Dianova). The

secondary antibodies used for electron microscopy were donkey anti-guinea pig or donkey

anti-goat coupled to 12 nm or 18 nm colloidal gold (Jackson Immunoresearch). For Western

blot analysis peroxidase-conjugated anti-guinea pig, anti-mouse or anti-rabbit antibodies

(Dianova) were used.

Immunofluorescence microscopy

THP-1 MФ transfected with EGFP-TIP47 vector, TIP47 siRNA or adipophilin siRNA and

incubated with 50 µg/ml acLDL or 150 mM oleate/BSA were washed twice with PBS and

fixed with 4% paraformaldehyde. After extensive washing the cells were incubated for 1 h in

PBS containing 1% BSA to block nonspecific binding, and 0.05% Tween 20 for

permeabilization. Cells were labeled using guinea pig anti-TIP47 (Progen Biotechnik), guinea

pig anti-perilipin (Progen Biotechnik) and mouse anti-adipophilin (Progen Biotechnik)

antibodies for 1 h, followed by incubation with anti-guinea pig Cy3-conjugated or anti-mouse

Cy2-conjugated secondary antibodies for 1 h. The preparations were mounted in fluorescence

mounting medium (Dako) and examined in a confocal laser-scanning microscope LSM510

THP-1 MФ incubated with 150 mM oleic acid or transfected with adipophilin siRNA were

scraped from the

(Zeiss).

Freeze-fracture replication

culture vessels, centrifuged to remove excess medium, re-centrifuged briefly

in 30% glycerol for 30 sec, frozen in Freon 22 cooled with liquid nitrogen, and freeze-

fractured in a BA310 freeze-fracture unit (BAL-TEC AG) at -100°C. Replicas of the freshly

fractured cells were immediately made by electron beam evaporation of platinum-carbon and

carbon at angles of 38° and 90° and to thicknesses of 2 and 20 nm, respectively. Replicas were

incubated overnight in 5% SDS to remove cellular material except for those molecules

3

adhering directly to the replicas. Replicas were

When frozen

then washed in distilled water and incubated

briefly in 5% BSA before immunolabeling.

Freeze-fracture nomenclature and interpretation of freeze-fracture replica immunolabeling

data

membranes are fractured, the fracture preferentially splits membranes into their

two constituent half-membrane leaflets along a plane between the hydrophobic tails of the

phospholipids in the bilayer. In the case of the plasma membrane, one leaflet remains attached

to the extracellular space (E-half), whereas the other leaflet remains attached to the cytoplasm

or protoplasm (P-half). The view of the E-half revealed by freeze-fracturing is termed the E-

face, and that of the P-half is termed the P-face. A corresponding nomenclature is applied to

intracellular membranes. The fracture faces of the cytoplasmic leaflets of the ER and nuclear

membranes are designated as P-face views, and those of the endoplasmic leaflets adjacent to

the ER lumen and perinuclear space are the complementary E-face views. In this way, a

consistent terminology describes structurally and functionally equivalent portions of the

different membrane systems of the cell. The envelope surrounding the lipid droplets presents

a special case, because it is not part of a classic bilayer, but a phospholipid monolayer

apposed against the lipids of the core. The fracture plane often exposes the interface between

the hydrophobic aspect of the monolayer and the core. The fracture face of the monolayer

revealed in concavely fractured lipid droplets is considered to be the P-face view, and the

complementary aspect seen in convexly fractured lipid droplets (which actually represents a

view of the outermost layer of the neutral lipid core) is the E-face equivalent. Correct

identification of the fracture faces of membranes relies on multiple cues, such as membrane

curvature, specific structural features of the membrane type or fracture face, the distribution

of metal evaporation, and labeling specificity. Rather than removing all cellular material from

the replicas with strong oxidants (the standard procedure in freeze-fracture replica

4

preparation), replicas for immunolabeling are washed with SDS. This preserves molecules

adhering directly to the replicas, while the remaining cellular material is flushed away.

Integral membrane proteins may than be labeled using immunocytochemical techniques.

Labeling of the SDS-treated freeze-fracture replicas was carried out using the primary

antibodies against TIP47 and DGAT described above followed by matching secondary

antibodies coupled to 12 nm or 18 nm colloidal gold. Viewed in the electron microscope, the

electron-dense gold particles

The sequence-specific

clearly mark the positions of these proteins, superimposed upon

the en face views of the membranes or lipid droplet phospholipid monolayers.

Plasmid generation and siRNA construction

Human TIP47 ORF cDNA was amplified by polymerase chain reaction from THP-1 MФ

using primers corresponding to the 5´ and 3´ends of TIP47 ORF to which XhoI (5´-end) and

BamHI (3´-end) cutting sites were attached. The amplified TIP47 sequence was cloned into

the pEGFP-C1 expression vector (Clontech Laboratories). Four additional truncation

mutations of TIP47 (EGFP-TIP47-aa1-198, EGFP-TIP47-aa1-248, EGFP-TIP47-aa1-416,

EGFP-TIP47-aa198-434) were prepared as well as human full length TIP47. Primer

sequences used for TIP47 cDNA amplification are described in table 1. The sequences of the

inserts were verified using 5'-TGCATTCATTTTATGTTTCAGGTTCA-3` and 5`-

CGATCACATGGTCCTGCTGG-3` sequencing primers and the BD Terminator Cycle

Sequencing kit 3.1 (Applied Biosystems). The sequences were determined with a capillary

electrophoresis sequencer (Applied Biosystems) and then analyzed with SeqMan from the

DNASTAR software package (DNASTAR).

siRNA directed against human TIP47 was designed by Qiagen. Human

adipophilin-specific siRNA was obtained from Invitrogen. Among three siRNAs for target

genes TIP47 or adipophilin, the sequences specific for adipophilin (sense: 5`-

5

CCUACCUGAAGUCUGUGUGUGAGAU-3` and antisense: 5`-

AUCUCACACACAGACUUCAGGUAGG-3`) and TIP47 (sense: 5`-

GUUCUCCCCUGCAGAAUUU-3` and antisense: 5`-AAAUUCUGCAGGGGAGAAC-3`)

were selected based upon their efficiency to specifically inhibit target gene expression. An

unmodified siRNA pre-designed by Qiagen with the following sequence (sense: 5`-

UUCUCCGAACGUGUCACGUdTdT -3` and antisense: 5`-

ACGUGACACGUUCGGAGAAdTdT -3`) was used as a negative control.

Transfection

Two days before transfection, cells were plated in 75 cm2 culture flasks at a density of

1.5×107 cells. Detached THP-1 MФ were transfected using the nucleofection method of

Amaxa. The transfection efficiency using 0.5 µg of vector DNA or 1 µg siRNA was

approximately 50% or 90%, respectively. LD formation in THP-1 MФ was induced by

incubation with 50 µg/ml acLDL, 50 µg/ml VLDL or 150 mM oleate complexed to bovine

serum albumin (BSA) for 24 h.

Isolation of RNA and synthesis of cDNA were performed as described by Schnoor et al..

Real-time RT-PCR

1 We

performed real-time RT-PCR using the ABI PRISM 7900HT sequence detection system

(Applied Biosystems) and the QuantiTect SYBR Green PCR kit (Qiagen). Primers were

obtained from Invitrogen and the primer sequences were as follows: TIP47 forward, 5’-

GGCCCTAAGCCTGATGGAAA-3’; TIP47 reverse, 5’-CTGGCCTTCCACCAGCTTCT-3’;

adipophilin forward, 5’-CTGATGAGTCCCACTGTGCTGA-3’; adipophilin reverse, 5’-

TGTGGCACGTGGTCTGGAG-3’; SRP14 forward, 5’-AGCACTGTGGTGAGCTCCAAG-

3’; SRP14 reverse, 5’-TCAGCCCATCCATGTTAGCTCTA-3’; GAPDH forward, 5’-

6

CAACAGCGACACCCACTCCT-3’; GAPDH reverse, 5’-

CACCCTGTTGCTGTAGCCAAA-3’. Cycling parameters and analyses were performed as

described previously.

THP-1 MФ transfected with TIP47 or adipophilin siRNA or transfected with full length

EGFP-TIP47 or truncated mutations of EGFP-TIP47 were washed twice with PBS and lysed

in HIDE buffer. 10 µg of total protein per lane was loaded on 10% SDS-polyacrylamide gels.

Proteins were transferred to Immobilon-P polyvinylidene fluoride membranes (Millipore).

Membranes were incubated with

1

Lipid droplet isolation

THP-1 MФ transfected with TIP47 siRNA or adipophilin siRNA were washed twice with

PBS and scraped into 40% iodixanol buffer (Progen Biotechnik) containing 30 mM Tricine.

Cells were homogenized by sonication and then transferred to the bottom of a centrifuge tube

and overlaid with 30% and 20% iodixanol buffer. After centrifugation at 10,000 x g for 60

min the LD fraction was transferred to acetone (1:6) for protein precipitation. The precipitate

of the LD was centrifuged for 10 min at 10,000 x g and dissolved in HIDE lysis buffer (0.5%

Nonidet P40, 50 mM Tris-HCl pH 8.0, 250 mM NaCl, 5 mM EDTA, and 50 mM NaF)

containing protease inhibitor cocktail from Boehringer. Lysates were used for Western blot

analysis.

SDS-PAGE and Western blot analysis

guinea pig anti-human TIP47 (Progen Biotechnik) or mouse

anti-human adipophilin (Progen Biotechnik) antibodies followed by incubation with

peroxidase conjugated anti-guinea pig or anti-mouse antibodies (Dianova). Densitometric

analysis was performed to measure the amount of TIP47 and adipophilin protein. The TIP47

and adipophilin protein per lane was normalized to the total protein amount determined by

Ponceau S staining.

7

Measurement of cholesterol and triglyceride content

48 h after transfection 2.5 µM triacsin C (Biomol) was added to the medium 4 h before lipid

loading. MФ transfected with TIP47 and adipophilin siRNA as well as MФ transfected with

EGFP-TIP47 or truncated mutations of EGFP-TIP47 were incubated with 50 µg/ml acLDL,

50 µg/ml VLDL or 150 mM oleate. The cells were washed twice with PBS and scraped in 400

µl 0.9% NaCl. After sonication the protein content of the lysate was measured by using the

Bradford protein assay (Bio-Rad). Triglyceride and total cholesterol content were measured

using the GPO/PAP and CHOD/PAP method (ProDiagnostica) according to the

manufacturer´s instructions.

8

adipophilin

tubulin

TIP47co

ntro

l

TIP4

7 si

RN

A

47 kDa

50 kDa

50 kDaco

ntro

l

adip

ophi

lin s

iRN

A

A

adipophilin

tubulin

TIP47co

ntro

l

TIP4

7 si

RN

A

47 kDa

50 kDa

50 kDaco

ntro

l

adip

ophi

lin s

iRN

A

adipophilin

tubulin

TIP47co

ntro

l

TIP4

7 si

RN

A

47 kDa

50 kDa

50 kDaco

ntro

l

adip

ophi

lin s

iRN

A

A

siRNA TIP47 siRNA ADRP

TIP47 ADRP HKG

**

TIP47 ADRP HKG0,0

0,5

1,0

1,5

2,0

Rela

tive

chan

gein

mRN

A le

vels

**

B

siRNA adipophilin

TIP47 adipophilin GAPDH TIP47 adipophilin GAPDH

siRNA TIP47 siRNA ADRP

TIP47 ADRP HKG

**

TIP47 ADRP HKG0,0

0,5

1,0

1,5

2,0

Rela

tive

chan

gein

mRN

A le

vels

**

B

siRNA adipophilin

TIP47 adipophilin GAPDH TIP47 adipophilin GAPDH

Results Figure I

Figure I. Expression of adipophilin and TIP47 protein and mRNA in siRNA transfected cells.

THP-1 MФ were transfected with adipophilin- or TIP47-specific siRNA. 72h after

transfection, total protein and RNA were isolated. A) Western blot analysis of adipophilin and

TIP47 in THP-1 MФ. Densitometric analysis showed that knockdown of TIP47 or adipophilin

results in 60% decreased TIP47 or 55% decreased adipophilin protein level (n=5, p < 0.01). B)

RNA levels of adipophilin and TIP47 mRNA were quantified using real-time RT-PCR. The

differences between adipophilin or TIP47 knockdown cells and control cells was significant at

p < 0.01, n=6.

9

TIP47adipophilin

47 kDa

50 kDaunloaded acLDL VLDL oleate

cont

rol s

iRN

A

cont

rol s

iRN

A

cont

rol s

iRN

A

cont

rol s

iRN

A

adip

ophi

lin s

iRN

A

adip

ophi

lin s

iRN

A

adip

ophi

lin s

iRN

A

adip

ophi

lin s

iRN

A

TIP

47 s

iRN

A

TIP

47 s

iRN

A

TIP

47 s

iRN

A

TIP

47 s

iRN

A

Figure II

0

50

100

150

200

250

300

unloaded acLDL VLDL oleate

adip

ophi

lin p

rote

in c

onc.

[% o

f con

trol

] control siRNA adipophilin siRNA TIP47 siRNA

* * * *

0

50

100

150

200

250

300

unloaded acLDL VLDL oleate

TIP4

7 pr

otei

n co

nc. [

% o

f con

trol

]

control siRNA adipophilin siRNA TIP47 siRNA

*

*

*

*

*

* *

A

B

C

10

Figure II. TIP47 and adipophilin protein expression in TIP47 or adipophilin suppressed THP-

1 MФ after incubation with acLDL, VLDL, or oleate for 24 hours. Suppression of adipophilin

leads to enhanced TIP47 protein levels after VLDL and oleate incubation (A, B). Unloaded

cells or treatment with acLDL had no effect on TIP47 protein levels after adipophilin knock

down (A, B). Supression of TIP47 did not influence the adipophilin protein expression (A, C).

Suppression of TIP47 in the presence of oleate and VLDL is lower compared to unloaded or

acLDL loaded cells (A). This might be due to a higher affinity of TIP47 to triglyceride rich

lipid droplets and a subsequent reduced turn-over rate of TIP47 protein. Values for each bar

are means_SEM from 3 experiments (*P_0.05 versus control).

Figure III

EGFP

-TIP

47

EGFP

-TIP

47 a

a198

-434

EGFP

-TIP

47 a

a1-2

48

EGFP

-TIP

47 a

a1-1

98

EGFP

-TIP

47 a

a1-4

16

75 kDa

50 kDa

37 kDa

EGFP

-TIP

47

EGFP

-TIP

47 a

a198

-434

EGFP

-TIP

47 a

a1-2

48

EGFP

-TIP

47 a

a1-1

98

EGFP

-TIP

47 a

a1-4

16

75 kDa

50 kDa

37 kDa Figure III. Western blot analysis using a rabbit anti-GFP antibody showed the expression of

full length and truncated EGFP-TIP47 proteins.

11

Figure IV

cont

rol

Adip

ophi

lin s

iRN

A

TIP4

7 si

RN

A

cont

rol

adip

ophi

lin s

iRN

A

TIP4

7 si

RN

A

cont

rol

adip

ophi

lin s

iRN

A

TIP4

7 si

RN

A

TIP47

Adipophilin

mall

aP2tubulin

47 kDa

50 kDa

15 kDa

15 kDa50 kDa

unloaded VLDL oleate

Figure IV. Expression of aP2 and mal1 protein in TIP47 or adipophilin siRNA transfected

THP-1 cells. Suppression of TIP47 or adipophilin has no influence on the protein level of aP2

or mal1 in the presence or absence of oleate or VLDL.

Table 1. Primers used for cloning full length and truncated TIP47. XhoI and BamHI cloning

sites are underlied.

Primer specificity Sequence 5´→ 3´ forward Sequence 5´→ 3´ reverse

TIP47 full length CTGCTCTCGAG CTCTCAACCATGTCTGCCGACGG GGATCCCCATACTTCTTCTCCTCCG

TIP47 aa 1-198 CTGCTCTCGAG GGTTGTAACCATGTCTGCCGACGG GGATCCCTCCTCCGACTTCCC

TIP47 aa 1-248 CTGCTCTCGAG TAGAACCATGTCTGCCGACGG GGATCCCCGCAGCCTCTCCGA

TIP47 aa 1-416 CTGCTCTCGAG TCCCAAACCATGTCTGCCGACGG GGATCCCGTGACAGGTGTGTTCT

TIP47 aa 198-434 AAGTCTCGAG CTCTCAGTGGGCGGACAACCAC

GGATCCCCATACTTCTTCTCCTCCG

12

References:

1. Schnoor M, Cullen P, Lorkowski J, Stolle K, Robenek H, Troyer D, Rauterberg J, Lorkowski

S. Production of type VI collagen by human macrophages: a new dimension in macrophage

functional heterogeneity. J Immunol. 2008;180:5707-5719.