thesis complete final edit gm dt480.4 p

Pharmaceutical Relevant Proteins; Studies of

RBP4 and Kvβ2.

Gavin Mooney

School of Food Science and Environmental Health

2011

Thesis Submitted in Partial Fulfilment of Examination Requirements Leading to the

Award

B.Sc. Pharmaceutical Technology

Dublin Institute of Technology

Supervisor: Dr. Barry Ryan Asst. Supervisor: Ms. Alka Singh, M.Sc.

ii

Declaration I Certify that this thesis which I now submit for examination for the award B.Sc.

Pharmaceutical Technology is entirely my own work and has not been taken from

the work of others, save and to the extent that such work has been cited and

acknowledged within the text of my work.

This thesis was prepared according to the regulations provided by the School of

Food Science and Environmental Health, Dublin Institute of Technology and has

not been submitted in whole or in part for another award in any Institute or

University.

The Institute has permission to keep, lend or copy this thesis in whole or in part,

on condition that any such use of material of this thesis is duly acknowledged.

Signed: __________________________

Gavin Mooney

Date: __________________________

iii

Acknowledgements

iv

Abstract

v

Abbreviations Used

µg = Microgram

µg = Micrograms

µl = Micro litre

µM = Micro molar

1o = Primary

2o = Secondary

3’ = Three Prime end of single strand of DNA

4-N-B-alc = 4-nitrobenzylalcohol

4-N-B-ald = 4-nitrobenzaldehyde

5’ = Five Prime end of single strand of DNA

ACN = Acetonitrile

AKR1D1 = Aldo-keto reductase 5β-reductase

Approx. = Approximate

BLAST = Basic Local Alignment Tool

BMI = Body Mass Index

Bp = Base Pair

BSA = Bovine Serum Albumen

C3G = Cyanidin 3-glucosides

C.A.S. = Chemical Abstracts Service

cDNA = Copy Deoxyribonucleic Acid

Conc. = Concentrated

CNS = Central Nervous System

CVD = Cardiovascular Disease

d.H2O = Deionised water

DM2 = Diabetes Mellitus Type 2

DMSO = Dimethyl Sulfoxide

DNA = Deoxyribonucleic Acid

dNTP = Deoxyribonucleic Triphosphate

EDTA = Ethylenediaminetetraacetic Acid

eGFR = Estimated Glomerular Function

EtBr = Ethidium Bromide

vi

g = Gram

GLUT-4 = Glucose Transporter 4

HCl = Hydrochloric Acid

HPLC = High Performance Liquid Chromatography

hRBP4 = Human Retinol Binding Protein-4

hrs = Hours

IGT = Impaired Glucose Tolerance

IPTG = Isopropyl β-D-thiogalactoside

IR = Insulin Resistance

kPa = Kilo Pascal

LBA = Luria Bertani Agar

LBB = Luria Bertani Broth

M = Molar

MCS = Multiple Cloning Site

mg = Milligram

min = Minutes

ml = Millilitre

mm = Millimetres

mM = Millimolar

NaCl = Sodium Chloride

NADPH = Nictinamide adenine dinucleotide phosphate (Reduced form)

NADP = Nictinamide adenine dinucleotide phosphate

NCBI = National Centre for Biotechnology Information

nm = Nanometers oC = Degrees Celsius

PCR = Polymerase Chain Reaction

PPAR-γ = Peroxisome Proliferator-Activated Receptor-gama

psi = Pounds per square inch

QA = Quality Assurance

(h)RBP4 = (human) Retinol Binding Protein-4

rpm = Revolutions per minute

SC = Subcutaneuos

SDR = Short-chain Dehydrogenase Reductases

SDW = Sterile Deionised Water

vii

TAE = Tris-Acetate-EDTA

TM = Melting Temperature

TZD = Thiazolidinedione

ToC = Temperature in Degrees Celsius

UN = United Nations

UV = Ultra Violet

UVB = Ultraviolet-B

V = Volts

v/v = Volume per volume

w/v = Weight per volume

viii

Table of Contents

Declaration...............................................................................................................ii

Acknowledgements................................................................................................ iii

Abstract ...................................................................................................................iv

Abbreviations Used..................................................................................................v

Table of Contents................................................................................................. viii

List of Figures: .........................................................................................................x

List of Tables: ........................................................................................................xii

1.0 Introduction........................................................................................................2

1.1 Retinol Binding Protein 4 ..................................................................................2

1.2 Kvβ2: The Subunit of Kv1 Potassium Channels ...............................................6

1.3 The Phenols: Rutin, Resveratrol and Quercitin .................................................9

1.3.1 Quercitin and Rutin...................................................................................9

1.3.2 Resveratrol..............................................................................................10

1.4 Aldo-Keto Reductases .....................................................................................11

2.0 Materials and Methods.....................................................................................15

2.1 Materials ....................................................................................................15

2.1.1 Instruments..............................................................................................16

2.1.2 E.coli strain.............................................................................................17

2.1.3 Plasmids..................................................................................................17

2.2 Cloning Primer Design ....................................................................................18

2.3 Agar and Broth Preparation .............................................................................20

2.4 Sterilization......................................................................................................20

2.5 Isolation of Plasmid Vector from E.Coli .........................................................20

2.6 DNA and Primer Preparation...........................................................................21

2.7 Agarose Gel Preparation ..................................................................................21

2.8 Polymerase Chain Reaction (PCR)..................................................................22

2.8.1-1 PCR Reaction Mixture 1......................................................................23

2.8.1-2 PCR Condition Set 1............................................................................24





ix




2.8.5-2 PCR Condition Set 5.1.........................................................................28

2.8.5-2 PCR Condition Set 5.2.........................................................................28

2.9 Preparation of TAE Buffer...............................................................................29

2.10 Purification and Expression of Kvβ2.............................................................29

2.11 Dialysis of Kvβ2 ............................................................................................30

2.11.1 Preparation of Dialysis Tubing............................................................30

2.11.2 Dialysis of Kvβ2...................................................................................30

2.12 HPLC assay to measure the inhibition of Kvβ2 mediated reduction of 4-

nitrobenzaldehyde ..................................................................................................30

2.12.1 Method for Gradient HPLC Assay (Rutin & Resveratrol) .........................31

2.13 Bradford Method for Protein Concentration Determination..........................32

2.14 Flouresence Measurement of inhibitor - Kvβ2 binding..................................32

3.0 Results..............................................................................................................34

3.1 PCR Results .....................................................................................................34

3.2 Expression and Purification of Kvβ2...............................................................37

3.3 HPLC Chromtatograms for the Inhibition of Kvβ2 Mediated Reduction of 4-

nitrobenzaldehyde ..................................................................................................38

3.3.1 Chromatogram Results for Rutin Experiment.........................................38

3.3.2 Chromatogram Results for Quercitin Experiment..................................40

3.3.3 Chromatogram Results for Resveratrol Experiment...............................42

3.4 Percentage Inhibition Results for Rutin, Quercitin and Resveratrol................44

3.5 Flouresence Spectra .........................................................................................45

3.5 Bradford Method Standard Curve....................................................................47

x

List of Figures:

Fig.1.1 3-D Protein representation of the RBP4 structure.

Fig.1.2 Schematic of aldehyde-dismutation in Kvβ2

Fig.1.3 Structural features of Kvβ

Fig.1.4 Chemical structure of Rutin

Fig.1.5 Chemical structure of Resveratrol

Fig.1.6 Chemical structure of Quercitin

Fig.2.1 Gradient elution method employed for the HPLC Analysis of

Resveratrol and Rutin

Fig.3.1 PCR UV Photograph of PCR #1





Fig.3.6 Elution profile of purified Kvβ2

Fig.3.7 Chromatogram showing a control reaction for Rutin experiment

Fig.3.8 Chromatogram showing a control reaction for Rutin experiment

Fig.3.9 Concentration dependant inhibition of Kvβ2 by Rutin

Fig.3.10 Chromatogram showing a control reaction for Quercitin experiment

Fig.3.11 Chromatogram showing a control reaction for Quercitin experiment

Fig.3.12 Concentration dependant inhibition of Kvβ2 by Quercitin

Fig.3.13 Chromatogram showing a control reaction for Resveratrol experiment

Fig.3.14 Chromatogram showing a control reaction for Resveratrol experiment

Fig.3.15 Concentration dependant inhibition of Kvβ2 by Resveratrol

Fig.3.16 Concentration dependant percentage inhibition of Kvβ2 by Rutin

xi

Fig.3.17 Concentration dependant percentage inhibition of Kvβ2 by Quercitin

Fig.3.18 Concentration dependant percentage inhibition of Kvβ2 by Resveratrol

Fig.3.19 Flourometric data showing the binding of Rutin to Kvβ2

Fig.3.20 Flourometric data showing the binding of Quercitin to Kvβ2

Fig.3.21 Flourometric data showing the binding of Resveratrol to Kvβ2

Fig.3.22 BSA standard curve

xii

List of Tables:

Table 1. Description of Plasmids

Table 2. Details of Primers Used

Table 3. Comparison of Agarose Volumes Used

Table 4. Details of Primer concentration and cDNA volumes used in PCR 1

Table 5. Temperature gradient and tube layout for PCR 2.

Table 6. Temperature gradient and tube layout for PCR 5.1. (Machine 1)

Table 7. Temperature gradient and tube layout for PCR 5.2. (Machine 2)

Table 8. Outline of reaction mixtures for Bradford Method

1

Chapter 1:

Introduction

2

1.0 Introduction The aim of this project is to study the hRBP4 protein through cloning,

expressing and purifying of the protein in order to perform a selection of tests on

the protein for stability and characteristics. As will be seen throughout this report,

the optimisation process for the PCR of hRBP4 was recurrently unsuccessful and

as a result, it was decided to focus on the standardization of an experiment being

carried out by a PhD student on a new protein, Kvβ2. This protein, a subunit of the

Kv1 protein, is involved in the regulation of the Shaker potassium channels of the

body. In this study, three compounds; Rutin, Quercitin and Resveratrol have been

identified as inhibitors of the kinetic mechanism for aldehyde dismutation that has

been proposed for Kvβ2. For this study, the Kvβ2 was expressed and purified for

HPLC analysis of the inhibitory studies.

1.1 Retinol Binding Protein 4

It has been reported that protein human Retinol Binding Protein-4 (hRBP4) is

linked with insulin resistance when serums levels are elevated (Graham, Yang,

Blüher, et al., 2006). As such, this protein has a casual function in Diabetes

Mellitus Type 2 (DM2). The RBP4 protein is secreted from hepatocytes and

adipocytes. Studies have been conducted on RBP4 regarding its role in the

reduced expression of the glucose transporter-4; GLUT4, an adipocyte which is

responsible for the post-digestive function of glucose uptake through the insulin-

mediated conscription of the GLUT4 transporter to the cell (Graham, et al., 2006).

RBP4, in serum, is now recognised as an adipokine linked with diminishing

hepatic and peripheral insulin sensitivity and therefore increased hepatic

gluconeogenesis (Craig, Chu and Elbein, 2006). It has been identified that the

RBP4 gene is located close to a region linked with type 2 diabetes (DM2) and as

such may be the reason for increased susceptibility to DM2 and the reduction in

insulin sensitivity (Craig, et al., 2006). An in vivo study by Craig, et al. (2006)

aimed at knocking out the adipose-specific GLUT4 in which mice acquired

muscle and hepatic insulin resistance and as such also showed an elevated serum

concentration of RBP4. Elevated RBP4 levels were noted in a population study of

subjects with impaired glucose tolerance and these serum levels dropped in

individuals with exercise-mediated improved insulin sensitivity, as well as the

3

serum levels showing an inverse relationship to insulin sensitivity in individuals

with a family history of DM2 (Graham, et al. 2006). The elevated serum

concentration of RBP4 was also reported by Craig et al. (2006) in individuals with

diabetes relative to euglycemic therapy. While insulin resistance is a vital

accomplice to DM, it can also provide a risk of cardiovascular disease (CVD) and

artherosclerosis indirectly via a pathophysiologic link and thus elevated serum

RBP4 is associated with CVD risk factors and metabolic syndrome; giving the

potential for RBP4 to be used as a predictor to DM2 (Suh, Kim, Cho, Choi, Han

and Geun, 2009). Reports have shown that RBP4 serum concentrations correlated

with diastolic blood pressure, fasting glucose levels and age; all factors associated

with DM (Suh, et al. 2009). Suh, et al. also reported the implications this may

have for lipid metabolism and insulin action. In this same study, it was reported

that serum RBP4 levels may correlate to age-induced insulin resistance (IR) as

well as independently being associated with fasting glucose levels. Women over

50 years of age consistently possessed higher serum RBP4 levels in the study by

Suh, et al; attributed to the reduced levels of Oestrogen during menopause which

leads to changes in the fat amounts in the body and visceral fat increases, thus

causing lipid metabolism changes and increasing RBP4 serum concentrations. The

link between RBP4 levels and fasting glucose concentrations can possibly be

explained through the mechanism which causes the induced expression of the

gluconeogenic enzyme

phosphoenolpyruvate carboxykinase by RBP4 via the liver which leads to RBP4-

induced IR in the liver (Suh, et al. 2009).

Fig.1.1: 3D representation of Retinol Binding Protein-4.

4

Serum RBP4 is reported as being preferentially being expressed in visceral fat

as opposed to expression in subcutaneous fat (Klöting, Graham, Berndt, et al.

2007). RBP4’s correlation with Transthyretin, which stabilizes circulating RBP4

and prevents it from being removed from plasma by glomerular filtration, was

used as an indicator to show the increase in visceral RBP4 in obese subjects, with

DM2 and impaired glucose tolerance (IGT), and was reported to be 35% over the

normal serum concentrations and therefore linking visceral adiposity and visceral

fat to RBP4 concentrations in the serum (Klöting, et al. 2007). Studies have

shown that RBP4 can be a clinical biomarker of IR in patients who present with a

range of clinical presentations, however it has also been reported that no evidence

has been found to back up this correlation and as such Chen, Wu, Chang and Tsai,

et al reported in 2009 the correlation between renal function rather than DM2.

Their study concluded that there was an expected inverse correlation between

RBP4 and uric acid, excreted by the kidneys due to the proven link between RBP4

levels and estimated glomerular function (eGFR), hence the relationship between

RBP4 and renal function in patients with DM2 (Chen, et al 2009). This may be an

indirect biomarker of IR and DM2 for RBP4 levels.

However, using a large study cohort, Lewis, Shand, Elder and Scott reported

in 2008 that RBP4 in the plasma may not be a functional biomarker of IR. In their

study of 285 fasting patients, some of whom had diabetes and some with no

diabetes but with varying levels of IR, the data observed did not provide any

relationship between RBP4 levels and IR and even body mass index (BMI),

percentage body fat and waist circumference as RBP4 levels were not

significantly higher in individuals with DM compared to those without. Thus also

putting into question; the correlation between lipid metabolism and plasma RBP4

levels. As already stated glomerular dysfunction can increase the levels of

circulating RBP4 and it has been noted that RBP4 levels in DM2 patients have

been affected by early nephropathy (Lewis, et al. 2008). RBP4 in this instance

may still be used as a biochemical marker of IR and there is still no evidence on

the contrary that GLUT4 levels reduce with a positive inverse in RBP4 expression

and secretion into serum. As such this is an analytical approach that may be used

to identify IR through RBP4 plasma concentration.

5

The standard treatment, according to the British National Formulary 2010, in

DM2 to reduce peripheral IR is the administration of Pioglitazone or

Rosiglitazone; both of which are Thiazolidinedione (TZD)-classed medications.

These drugs are typically prescribed in combination with Metformin or a

Sulphonylurea in order to reduce IR, as stated, by targeting the regulation of

adipocyte function from which RBP4 levels can be managed. TZD act on the

adipocyte function through adipocyte differentiation and adipocyte gene activation

as they are a synthetic peroxisome proliferator-activated receptor-gama (PPAR-γ)

ligands (Sasaki, Nishimura and Hoshino, et al 2007). TZDs are broadly used to

reduce hyperglycaemia and have been reported to increase serum adiponectin

significantly better than Sulphonylureas (Lin, et al. 2008). Due to the minimal

selectivity of the PPAR-γ modulator, these TZD drugs can provide a undesired

side effects such as gastrointestinal disruption, obesity and oedema and there for

more attention has been focused on food based compounds such as Anthocyanins

like Cyanidin 3-glucosides (C3G) for a more effective management of DM2 and

metabolic syndrome through their efficacy in the modulation of the GLUT4 –

RBP4 system as well as inflammatory adipocytokines which result in the

improvement of hyperglycaemia and insulin sensitivity of patients with DM2

(Sasaki, et al 2007). Anthocyanins are water-soluble, plant based chemicals as due

to their abundance in the plant kingdom it is suggested that high amounts of

Anthocyanins are ingested through plant-based diets, hence the ingestion of

C3G’s which Sasaki et al has reported to be a suppressor of RBP4 expression in

white adipose tissue with a reported 47% reduction in serum RBP4 of the study’s

group compared to the control group of diabetic mice. The treatment of these

diabetic mice with C3G also showed an increase in the expression of GLUT4

transporters, likely to be due to the reduced expression of RBP4, leading to better

insulin sensitivity. Dietary C3G treatment also proved to increase insulin

sensitivity but with no significant affect on the expression of adiponectin and its

receptors; leading to observations that polyphenols may inhibit α-glucosidase

activity although the amelioration of IR by C3G is not due to inhibition of α-

glucosidase activity (Sasaki et al 2007). This suggests a new class of drug and

dietary treatment for DM2 and metabolic syndrome in respect of the management

of IR.

6

1.2 Kvβ2: The Subunit of Kv1 Potassium Channels

Kvβ2 is a cytosolic protein; a subunit of Kv1 potassium (K+) channels which

are belong to the voltage-dependant ‘Shaker family’ of potassium channels.

Potassium channels are known to be widely dispersed ion channels within the

body, particularly in the Central Nervous System (CNS) and these are present in a

large number of living species (Kelly, 2010). The high abundance of Kvβ in the

nervous system may attribute to channel regulation in the myocardial cell and

impact on the action potential of same. The channels also provide a vital function

of establishing resting membrane potential and regulation of frequency during

action potential (Hille, et al. 1991). Such electrical activity is vital for the

functioning of process in excitable cells such as neurons and muscle (Long, et al.

2005). The Kvα subunit, Kvβ associates with the cytoplasmic aspect of the Kvα

protein and these do not contribute to ion conductivity however they do regulate

channel activity; the Kv channels have been shown to be responsible for the

regulation of K+ flow through cell membranes upon changes in the potential of the

membrane (Weng, et al 2006). These channels form transmembrane pores which

can be found in a variety of cell types in which they regulate the electrical

function and signalling processes among other physiological processes (Di

Costanzo, et al. 2009).

Fig.1.2: A mechanism for aldehyde dismutation in Kvβ2 as proposed by Alka, et al. 2010. RCHO is an aldehyde, RCH(OH)2 is its corresponding hydrate, RCOOH and RCH2OH are the corresponding alcohol and carboxylic acid respectively. The dismutation of aldehyde substrate consists of two

coupled half reactions. In the first half (the upper pathway), hydrated aldehyde is oxidised irreversibly to the corresponding carboxylic acid forming ENADPH. In the second half reaction (lower pathway), another molecule free aldehyde binds to the ENADPH complex and is reduced reversibly to corresponding alcohol. Hence, aldehyde is dismutated into equimolar concentration of corresponding alcohol and carboxylic acid in a redox silent reaction with no observable change in A340. Ψ denotes the cofactor exchange step. The steps denoted by Ψ are insignificant during dismutation as cofactor remains enzyme bound throughout alternate oxidation and reduction (Alka, et al. 2010).

7

The Shaker family of Kv potassium channels has an modifications that have

not been reported to exist in Kv channels of prokaryotes and these adaptations

allow the Kv channel to perform functions that are unique to eukaryotic cells

(Long, et al. 2005). Long, et al. (2005) also reported that the β subunit had large

portals on the side of the structure, between the pore and cytoplasm, with

electrophysical properties which have a consistent result in similar studies on

electrophysiological inactivation gating and research postulates the potential of K+

channel regulation by the β subunit (Long, et al. 2005). Upon structural study of

the Kvβ2, it was reported that the subunit contains a similar sequence homology to

that of an aldo-keto reductase (AKR). This AKR fold allows the β subunit to

catalyse a redox reduction. The structural analysis also found that Kvβ2 has a

tightly bound nicotinamide cofactor; NAPDH. This bond is non covalent and the

region also contains an aldehyde binding site (Alka, K. et al. 2010; Weng, et al.

2006).

Crystal structure analysis of the ternary complex Kvβ2-NADPH-cortisone also

identified a binding site for cortisone on the proteins surface; supplementing the

binding site at the enzyme active site (Di Costanzo, et al. 2009). The AKR fold

previously mentioned, catalyses a redox reduction in this instance by reducing an

aldehyde to an alcohol via oxidation of the NADPH cofactor (Weng et al 2006).

Fig 1.2 shows the reaction as proposed by Alka, K., et al in 2010. A similar

scheme proposed by Weng, et al. (2006) also shows an AKR and enzyme binding

in sequence to an NADPH to form an Enzyme-NADPH-aldehyde complex. The

enzyme in this complex transfers a hydride from the NADPH cofactor to the

aldehyde thus producing an alcohol product which is followed suit by NADP+.

This is facilitated by AKRs having a higher affinity for NADPH over NADH

(Weng et al. 2006). The process in Fig.1.2 is reversible which allows the alcohol

to be oxidised to form an aldehyde and NADP+ to be converted to NADPH as

reported by Weng, et al in 2006. The rate of cofactor exchange in the above

process is however, slow thus indicating Kvβ is a slow enzyme. Weng, et al. also

shows in the 2006 publication that even though NADPH was oxidised over a two-

week period, there was still a presence of NADP+ in Kvβ; showing a tight

association which is to an extent due to a flexible loop which stretches over

NADPH and it’s binding site. It is this loop that possibly decelerates the

dissociation of the cofactor to a more prolonged period as reported. The reduction

8

of substrates such as 4-nitrobenzaldehyde (4-N-B-ald) is known to be catalysed by

Kvβ2 and the slow aldehyde-substrate dismutation has been shown through a

HPLC assay (Alka,, et al. 2010).

A potassium channel modulation function was reported as the bound cofactor,

NADPH, is oxidised. The regulation of channel activity, however questionable as

the adequate production of relative aldehydes may not be sufficient enough for the

channel regulation due to both enzymatic and non-enzymatic processes leading to

oxidative stress (Alka, et al. 2010). However, as noted above, this can be a slow

process but it is suspected that this redox reaction of the cofactor may be faster in

the presence of more specific physiological substrate which is yet to be elucidated

(Alka, et al. 2010). The rate of aldehyde reduction is linearly dependant on the

concentration of Kvβ2 and can be observed as a decrease in the peak area at the

450nm fluorescence peak (Alka, et al. 2010). Reports have shown that cortisone

promotes dissociation of the Kvβ2 from the K+ channel as it binds in two sites; at

the bound cofactor and the boundary of the Kvβ subunits and is known to not be a

substrate of the Kvβ2 protein, thus presenting the possibility of it being an

Fig.1.3: Structural features of Kvβ: A, structure of Kv1.2 (blue) in complex with Kvβ2 (red) in ribbon representation (Protein Data Bank code 2A79 (3)). The cell membrane is indicated by the straight lines.B, ribbon representation of Kvβ2 showing its structural fold (Protein Data Bank code 1QRQ (10)). The bound cofactor (cyan) and the conserved active site residues, Asp85, Tyr90, Lys118, and Asn158, are shown in stick representation. Residues Asp85 and Lys118 are labelled. A flexible loop that straddles the cofactor binding site is shown in yellow (Gulbis et al., 1999).

9

inhibitor (Alka, et al. 2010). This study looks at the inhibitory effect three pre-

identified potential inhibitors; Rutin, Quercitin and Resveratrol have on the

dismutation of aldehyde to form an alcohol product; 4-nitrobenzylalcohol (4-N-B-

alc). Cortisone is a steroid hormone and the three compounds mentioned

previously have been shown to have anti-inflammatory effects similar to those of

cortisone.

1.3 The Phenols: Rutin, Resveratrol and Quercitin

Rutin, Resveratrol and Quercitin are the three potential inhibitory compounds

of interest in this study. Fig.1.4 – 1.6 shows the phenolic structures of each

compound.

1.3.1 Quercitin and Rutin

Rutin is a primary flavanoid which can be found in a number of plants such as

Buckwheat. It is for this reason that there is high dietary consumption of Rutin as

buckwheat is used in the manufacture of noodles and rice (Koda, et al. 2008).

Rutin is a glycoside form of Quercitin of whose glycosides have free radical

scavenging activities (Andlauer, et al. 2001). As can be seen in Fig.1.4 and

Fig.1.6, Quercitin and Rutin are very similar in structure, therefore they have

similar mechanisms of action and biological affects. Rutin is a larger molecule

and has been shown to be less potent than Quercitin. This is possibly due to the

glycosylation adding a sterically-hindering group for inhibitory binding which

may impact, in the context of this study, at the interface binding site of the β

subunit in the Kvβ2-NADPH complex. Rutin is known to have an antioxidant

effect among various other biological effects which have a positive impact on

human health such as anti-inflammatory and a gastro protective effect due to its

augmentation of the antioxidant activity on the activity of glutathione peroxidase;

a selenoprotein that is recently being studied to link changes or abnormalities in

the protein with the etiology of some cancers, CVD, autoimmune disease and

diabetes (Lei, et al. 2007). The 2008 study by Koda, et al. investigated the

therapeutic effect of Rutin in reducing brain damage if administered per-orally in

rats. Koda, et al. showed that dietary supplementation of Rutin over a prolonged

period reversed the induced spatial memory impairment by trimethyltin. Other

health benefits such as chemopreventive activity was proposed by Andlauer, et al.

10

with a requirement that intestinal absorptive-uptake must be carried out for this

link to be true contravening studies suggesting that Quercitin glycosides were

excreted rather than absorbed in human intestinal (Caco-2) cells (Andlauer, et al.

2001).

1.3.2 Resveratrol

Resveratrol is a phytoalexin that can be derived from the skin of fruits and I in

particular, red grapes among 70 other plant species. This attributes to high

concentrations of Resveratrol in red wine; approximately 50-100µg per gram of

grape skin (Athar, et al 2007). Like Rutin, Resveratrol is reported to have

antioxidant effects, potent anti-inflammatory and inhibition of the growth of

various cancer cells. Resveratrol is a compound that has helped spark an interest

in naturally occurring compounds being used as chemopreventives in human

cancers as it has been shown to have an effect on the tumour initiation, promotion

and progression stages of carcinogenisis (Athar, et al. 2007). Athar has also

reported that it is thought that Resveratrol can induce apoptosis of cells and

modulate cell growth pathways through its antioxidant activity.

Resveratrol, like other polyphenols can undergo glycosylation which has a

protective effect on Resveratrol by preventing it being degraded by oxidation thus

making it more stable and soluble and more soluble which is advantageous in the

gastrointestinal tract. It is this attribute that makes Resveratrol absorb more

efficiently than other polyphenols like Quercitin (Athar, et al. 2007). A review by

Athar, et al. in 2007 has shown that various administration routes have shown

positive outcomes when Resveratrol has been used in vivo against various

inhibited cancers in mice. Topical Resveratrol was tested in vivo for anti-

carcinogenisis activity on subcutaneous (SC) in the respect of non-melanoma skin

cancer and was proved to significantly reduced the prevalence of ultraviolet-B

(UVB)-mediated photo-toxicity at a topical dosage of 25µmol in SKH-1 hairless

mice and Soleas et al. identified in a 2002 a 60% reduction in papillomas when

Resveratrol was applied topically (Athar, et al. 2007). Modulation by the proteins

that regulate cell cycle have been associated to the anti-proliferative affects of

Resveratrol in such instances (Regan –Shaw, et al. 2004).

A comparison of red wine-consumers against other beverages showed that

there was a lower incidence of lung cancer among the subjects who consumed red

11

wine; associated with the high concentration of Resveratrol in red wine. Berge et

al. (2004) reported that Resveratrol inhibits the production of diol-epoxides;

compounds that have the potential to form covalent adducts with DNA and cause

structural alterations with mutations (Berge, et al. 2004). Studies on a number of

cancer types have shown Resveratrol to induce apoptosis in the carcinogenic cells,

also inhibit cell growth and significantly reduce the incidence of tumours while

also delaying the onset of tumourigenisis, in multiple targets and in a non-toxic

dose (Athar, et al. 2007). However, the dose which Resveratrol presents itself in

with red wine suggests that for health benefit to be observed by its administration

it may require synergistic combinations with compounds such as Quercitin and

ellagic acid; synergistic combinations which have been shown to induce apoptosis

in vitro and in vivo (Athar, et al. 2007). Resveratrol has been reported to have a

number of positive cardiogenic effects such as the reduction in incidences of

CVD. Its cardiogenic effects have been shown in the lowering of hyper / hypo-

tension clinical issues. This is thought to be due to Resveratrol inducing the

expression of endothelial nitric oxide synthase which is the enzyme responsible

for producing the vaso-dilating nitric oxides and decreasing the expression of the

endothelin-1; a vasoconstrictor (Das, et al. 2010). The endothelial cell is also

responsible for regulating the balance of endothelin-1 and nitric oxide which are

both important vasoconstrictors and vasodilators respectively; a function that

provides thromboresistance is shown to preclude atherogenesis (Das, et al. 2010).

Pharmacological intervention in cardiovascular medicine may be entering a new

age due to the range of health affects potentiated by Resveratrol such as cardiac

regeneration and the generation of autophagy (Das, et al. 2010).

1.4 Aldo-Keto Reductases

Aldo-keto reductases (AKR) form a large part of the cytosolic monomeric

NADPH-dependant carbonyl oxidoreductases along side another type of

oxidoreductase; short-chain dehydrogenase reductases (SDR) (Di Costanzo, et al.

2009). The AKR6A subfamily is associated with the Kvβ1-3 proteins which form

an (α/β)8-Barrell fold which links it structurally with AKRs, albeit with having a

low amino acid sequence similarity with other affiliates of the AKR group (Di

Costanzo, et al. 2009). The AKR family are known to reduce aldehydes and

ketones to their corresponding 1o and 2o alcohols and can be found in both

12

eukaryotes and prokaryotes (Penning and Drury, 2007). AKRs have also been

shown by Penning and Drury (2007) to reduce liophilic substrates such as

ketosteroids and retinals, thus regulating ligand access to nuclear receptors.

Substrate specificity of the AKR1 enzyme has been shown by Tipparaju et al.

(2008) to favour aromatic aldehydes, which contain electron withdrawing groups

in the para position of the aromatic ring or compounds that contain carbonyl

groups that are polarised by α,β- un-saturation, over cortisone which has shown

no activity. AKR also functions as an aldehyde reductase may have activity in

glucose metabolism and electron transport (Hyndman, et al. 2003). As mentioned

previously, cortisone binding sites were identified on the surface of the Kvβ-

NADPH-cortisone ternary complex, at which the cortisone binds backwards

compared to its binding profile within the active site of AKR1D1; a 5β-reductase,

which gives productive binding of progesterone as well as cortisone (Di Costanzo,

et al. 2009). Similar assessment of this structure has uncovered the link between

the binding of cortisone, in this fashion, to the surface of the protein and the

dissociation of β subunits from the Shaker potassium channel (Pan, et al. 2008).

AKRs are known to catalyse a number of reductions. In the bisequential

mechanism, in which reduction occurs in a central complex, binding of the

cofactor, NAPDH, supersedes the binding of a carbonyl substrate and is followed

by a release of the alcohol product and NADP+ in this respective order (Penning

and Drury, 2007). Penning and Drury (2007) also note that the AKRs rate

determining step can vary due to enzyme variation, i.e. most AKR reaction will

depend on the enzyme and rate of cofactor release. This is poignant in the regard

of Kvβ2 which has previously been noted by the author as being a slow reactive

protein thus having a slow rate of cofactor hydride transfer.

A link has been publicized about the implication of AKR in human diseases

such as diabetes. Catalysis of glucose conversion into sorbitol has been reported

as a role of aldose redcuatse; a prototypic member of the AKR family. This

conversion is the first step in the polyol pathway; a pathway which can occur in

the presence of chronic hyperglycaemia thus leading to diabetic complications

such as cataracts, retinopathy and nephropathy (Chang, et al. 2007).

13

Fig.1.4: Structure of Rutin (2-(3,4-dihydroxyphenyl)-4,5-dihydroxy-3[3,4,5-trihydoxy-6-[(3,4,5-trihydroxy-6methyl-oxan-2-yl)oxymethyl]oxan-2-yl]oxy-chromen-7-one)

Fig.1.5: Structure of Resveratrol (trans-3,4’,5-trihydroxystilbene

Fig.1.6: Chemical Structure of Quercitin

14

Chapter 2:

Materials & Methods

15

2.0 Materials and Methods

2.1 Materials

Materials are listed per company used for their respective acquisition.

Promega Corporation Damastown, Mulhuddart, Dublin 15, Ireland

100bp DNA Ladder Marker

6X Blue / Orange Loading Dye Cat # G190A

Agarose, LE Analytical Grade C.A.S. #9012-36-6

dNTP Mix Cat # U1511

100bp Ladder Cat # G2101

Ethidium Bromide Cat # H5041

GoTAQ® DNA Polymerase Cat # M3171

GoTAQ® Green Master Mix Cat # M7122

PureYieldTM Plasmid-

Miniprep System A1221

Sigma – Aldrich, Airton Road, Tallaght, Dublin 24, Ireland

4-Nitrobenzaldehyde 98% C.A.S. # 555-16-8

4-Nitrobenzylalcohol 99% C.A.S. # 619-73-8

Bradford Reagent

Dialysis Tubing, High Retention Seamless Cellulose Tubing (23mm x 15mm)

Hydrochoric Acid 37% C.A.S. # 7647-01-0

Imidazole

Isopropyl β-D-thiogalactoside (IPTG)

Primers (detailed further on in Table.2)

Quercitin (Anhydrous) C.A.S. # 117-39-5

Rutin Hydrate (min 95%) C.A.S. # 207671-50-9

Sulphuric Acid (Conc.) C.A.S. # 7664-93-9

Triflouroacetic Acid 99%

(Spectrophotometric Grade) C.A.S. # 76-05-1

β-Nictinamide adenine-

dinucleotide phosphate-

reduced tetrasodium salt C.A.S. # 2646-71-1

Luria Bertani (LB) Broth # L3022-250G

16

Luria Bertani (LB) Agar # L2897-1KG

Lab Scan Analytical Sciences Stillorgan Industrial Park, Stillorgan, Dublin,

Ireland

Acetonitrile (HPLC Grade) C.A.S. # 75-05-8

VWR Northwest Business Park, Ballycoolin, Dublin 15, Ireland

HiPerSolv Chromaorm

for HPLC grade Methanol UN1230

Fisher Chemical / Fisher Scientific Ireland Blanchardstown Corporate Park 2,

Ballycoolin, Dublin 15, Ireland

Di-potassium hydrogen-

orthophosphate (Anhydrous) C.A.S. # 7758-11-4

Methanol (HPLC Grade) C.A.S. # 67-56-1

Potassium dihygrogen-

orthodphosphate C.A.S. # 7778-77-0

Sodium Chloride C.A.S. # 7647-14-5

Tris Base C.A.S. # 77-86-1

cDNA

From U937 Human Leukemic Monocyte Lymphoma Cell line. Donated by Dr.

Sinead Loughran, Dublin City University.

Qiagen Fleming Way, Crawley , West Sussex , RH10 9NQ

pQE-60

2.1.1 Instruments

AGB 1000 Hot Plate & Stirrer

Alpha Imager Mini Software

Alpha Innotech UV Camera

Branson 5510 Sonicator

Consort E865 Electrophoresis power supply

Empower HPLC Computer Software

Gilson Diamond pipette tips (for P2µl to P1000µl pipettes)

Gilson Pipetteman P2µl to P1000µl pipettes

Grant GD100 & W14 Water Baths

G-Storm PCR Machine

Metter Toledo AG285 Weighing Scales

17

Millipore Simplicity 185 Water Filter

Milton Roy Spectonic 1201 spectrophotometer

Perkin Elmer Fluorescence Spectrometer LS50B

Prism Data Processing Software

Revco Elite Plus Freezer

Sartoius BP310S Weighing Scales

Sigma 2K15 Centrifuge

Sonics Vibracell Amplifier and Sonicator

Startedt Sterilins

Stuart Orbital Incubator S1500

Thermo Scientific Heraeus Incubator

Thermo Scientific Orion Star 2 pH meter

Thermo Scientific Pico-21 Centrifuge

Tomy SX-5003 High Pressure Steam Steriliser

Unicam UV2 UV/Vis Spectrophotometer

Waters 2998 Photodiode Array Detector

Waters e2695 HPLC with Empower Operation software

Zanussi Fridge and Freezer Unit

2.1.2 E.coli strain

BL21 F- dcm ompT hsdS(rB- mB-) gal [malB+]K-12(λS) sourced from

Novagen was used in this study.

2.1.3 Plasmids

Plasmid Information Source

pET-15b Carries an N-Terminus His-tag and

contains a T7 promoter. Also

contains a thrombin site and three

cloning sites.

Novagen

pQE-60 3.4kb. High copy number

expression vector. Ampicillin

resistant. T5 promotor/lac operon.

6xHis sequence at 3’ end of MCS

Qiagen

Table 1: Description of Plasmids used.

18

2.2 Cloning Primer Design

All primers acquired from Sigma-Aldrich. Both primers 1 and 2, as listed in

Table 2, were used directly from Thomas, et al. (1993) as published in Gene and

are denoted with ‘G’ in front of their respective prime number. Primers designed

by the author are numbered 3 and 4. Primers 5 and 6 are the forward and reverse

primers for the Alu gene respectively.

No. Name 5’ - 3’ QA

Details

1 hRBP4

G-5’

TTTGAATTCATATGGAGCGCGACTGCCGAGTG

AG

TM =

81.5oC

GC% = 50

2 hRBP4

G-3’

TTTGGATCCCTACAAAAGGTTTCTTTC TM =

67.4oC

GC% = 37

3 hRBP4

5’

CGGGATCCATGAAGTGGGTGTGGGCGCTCTT TM =

84.6oC

GC%=

61.2

4 hRBP4

3’

CAGATCAGAAAGAAACCTTTTGAGATCTTC TM =

67.6oC

GC% =

36.6

5 Alu 5’ GTAAGAGTTCCGTAACAGGACAGCT TM =

65°C

GC% = 48

6 Alu 3’ CCCCACCCTAGGAGAACTTCTCTTT TM =

68°C

GC% = 52

Table 2: Details of Primers used in this study.

Primers were designed using the step-by-step methodology outlined below. This

method was used for hRBP4 5’ and hRBP4 3’ as listed in Table 2.

19

Step 1.

The gene sequence being sought was acquired by performing a BLAST search

using the NCBI website, http://blast.ncbi.nlm.nih.gov. RBP4 Sequence plasma

(RBP4), mRNA included below is 606bp long.

atgaagtggg tgtgggcgct cttgctgttg gcggcgctgg gcagcggccg

cgcggagcgc gactgccgag tgagcagctt ccgagtcaag gagaacttcg

acaaggctcg cttctctggg acctggtacg ccatggccaa gaaggacccc

gagggcctct ttctgcagga caacatcgtc gcggagttct ccgtggacga

gaccggccag atgagcgcca cagccaaggg ccgagtccgt cttttgaata

actgggacgt gtgcgcagac atggtgggca ccttcacaga caccgaggac

cctgccaagt tcaagatgaa gtactggggc gtagcctcct ttctccagaa

aggaaatgat gaccactgga tcgtcgacac agactacgac acgtatgccg

tgcagtactc ctgccgcctc ctgaacctcg atggcacctg tgctgacagc

tactccttcg tgttttcccg ggaccccaac ggcctgcccc cagaagcgca

gaagattgta aggcagcggc aggaggagct gtgcctggcc aggcagtaca

ggctgatcgt ccacaacggt tactgcgatg gcagatcaga aagaaacctt

ttgtag

Step 2.

Using the online software, Webcutter 2.0, the gene sequence was entered to

analyze which restriction endonucleases do not cut the RBP4 gene. The list of

endonucleases produced (which do not cut the gene) was scanned for the

endonucleases which may be used at the multiple cloning site (MCS) of the pQE-

60 vector. BamHI and BglII were identified as the optimum restriction

endonucleases to be used as the endonucleases NcoI cuts at c/catgg and therefore

couldn’t be used.

Step 3.

The forward primer, hRBP4 5’, was designed by taking the first 23bp of the

RBP4 gene and adding the restriction site for BamHI. The reverse primer, hRBP4

3’, was designed by taking the last 22bp of the sequence and rearranging it to its

reverse complement and adding of the restriction site for BglII. The addition of

these restriction sites is shown in the primer sequences outlined in Table 2 and are

20

highlighted in red. The base pair sequence was chosen by also factoring in an

optimum GC content of ~60%. The 23bp sequence selected for the forward primer

already contained the start codon ATG (highlighted blue in Table 2) and therefore

did not require the addition of a start codon. The sequence selected for the reverse

primer did not contain a stop codon, however the restriction site for BglII

contained the stop codon GAT (the reverse compliment of TAG) and therefore did

not require a stop codon addition.

The restriction sites for each of the endonucleases were obtained from the New

England Biloabs Inc. website (www.neb.com).

Step 4.

In order to achieve high efficacy in binding for the primers a restriction

enzyme base pair clamp was added to the primer. The addition of these clamps is

shown in the primer sequences outlined in Table 2 and are highlighted in green.

2.3 Agar and Broth Preparation

LB Agar (LBA) was made to 1 litre stock using 35g of LBA powder and

then sterilized. LB Broth (LBB) was made to 1 litre stock using 20g of LBB

powder and then sterilized. Both LBA and LBB were then supplemented with

100µg/ml of Ampicllin once cooled down to room temperature.

2.4 Sterilization

All sterilization was carried out using the Tomy SX-5003 High Pressure

Steam Steriliser with the parameters set at 121oC for 15mins at 103kPa (15psi).

2.5 Isolation of Plasmid Vector from E.Coli

LBA was inoculated with E.coli containing pQE-60 and placed on static

incubation for 24hrs at 37oC in the Thermo Scientific Heraeus Incubator. LBB

was aliquoted into three test tubes and 1 for a positive-growth control, one as a

negative-growth control and one for the working sample. One colony from the

LBA plates was inoculated into the working sample and positive-control test tubes

for 24hrs incubation at 37oC and 220rpm in the Stuart Orbital Incubator S1500.

21

Protocol, as outlined below were carried out according to the PureYieldTM

Plasmid Miniprep System using the provided isolation kit.

100µl of Cell Lysis buffer was added to 1.5ml of the LBB culture in a

microcentrifuge tube and mixed by inversion of the tube. 350µl of Neutralization

buffer (at 4oC) was added to the mix and thoroughly mixed by inverting the tube.

The mixture was then centrifuged at 14,000g in the Thermo Scientific Pico-21

Centrifuge. The supernatant was transferred to a minicolumn using a pipette in

order to not disturb the cell debris pellet. The minicolumn was centrifuged at

14,000g for 15 seconds. All follow-through from the minicolumn was discarded

and the minicolumn was placed into a collection tube and washed by adding 200µl

of Endotoxin Removal Wash to the minicolumn. The contents were centrifuged

for 15 seconds at 14,000g before adding 400µl of Column Wash Solution and

centrifuging again at 14,000g for 30 seconds. 30µl of Elution Buffer was finally

added and let stand at RT for 1 minute. The minicolumn was then centrifuged at

14,000g for 15 seconds to elute the plasmid DNA. Following final centrifugation

the eluted plasmid was transferred to a sterile ependorf and stored at -20oC.

2.6 DNA and Primer Preparation

cDNA was prepared for use from a stock of cDNA from U937 Human

Leukemic Monocyte Lymphoma Cell line donated by Dr. Sinead Loughran,

Dublin City University, by diluting to 1:50 by adding 1µl of cDNA stock in 50µl

of sterile de-ionized water (SDW). This was also further-diluted to 1:500 in order

to allow for a higher concentration of primers than template cDNA in the PCR

mix during the optimization process. Each primer was reconstituted as per the

manufacturer’s instructions on the Quality Assurance document.

hRBP4 G-5’ was diluted to a final 100µM working concentration using

389µl of SDW. hRBP4 G-3’ was diluted to a final 100µM working concentration

using 389µl of SDW. Both primers where then diluted to several concentrations

(102 to 10-5µM).

2.7 Agarose Gel Preparation

Varying concentrations of Agarose gel were used throughout this research.

The method for a 1% Agarose gel is described below. To make a different

22

percentage concentration the amount of Agarose stock power was changed

accordingly as per Table 3 below.

% Required g/100ml g/200ml

0.7% 0.7g 1.4g

0.8% 0.8g 1.6g

1% 1g 2g

Table 3: Comparison of Agarose volume used in this study.

1g Agarose was added to 200ml TAE buffer and boiled for 2.5 minutes

using a household microwave to ensure the Agarose had fully dissolved. When the

solution had cooled down to approximately 60oC, 8µl (4µl/100ml) of Ethidium

Bromide (EtBr) was added and manually stirred with a glass rod for 1 minute to

ensure complete dissolution of the EtBr. 100ml of Agarose gel was poured into

the gel plate for each PCR experiment.

All wells in the gel were formed in the gel using a 12-well comb placed into

the grooves of the gel plate. In order to prevent spillage of the molten gel,

autoclave tape was firmly placed at either end of the gel plate. The wells were

loaded with 6µl of PCR product and 100bp base pair markers when running the

gel. The PCR product was prepared in a 5:1 (product : 6X loading dye) mix as

this would give a 1X loading dye concentration. GoTAQ® Master Mix already

contained loading dye and was at a final concentration of 1X when in the PCR

reaction mix thus only the 100bp required the addition of 6X loading dye in the

fashion mentioned above.

2.8 Polymerase Chain Reaction (PCR)

A total of 6 PCR conditions were performed using a G-Storm PCR Machine

for each. Pre-prescribed settings, as listed in the GoTAQ® product sheet, were

used for the first run and then adjusting either the annealing or elongation times as

new reactions were carried out. The results are outlined further on in chapter 3.

All PCR cycle settings in this study were carried out with a Heated Lid of 110oC.

All Annealing temperatures were calculated using the calculation

TAnneal = TM – 5oC

23

This was facilitated by calculating the TM using the calculation below. This

calculation is based on the content of A, T, G and C bases in each primer.

TM = [2(A+T) + 4(G+C)] oC

2.8.1-1 PCR Reaction Mixture 1

A total of 4 reaction tubes were prepared using primer concentrations of

10µM and 20µM and varied cDNA volumes. Tube contents are detailed in Table

4. Each reaction tube contained the mix as outlined below. The PCR product was

ran on a 0.7% Agarose gel using a Consort E865 Electrophoresis power supply set

at 100V for 1.5 hours and shown in Fig.3.1. The annealing temperature used was

guided on the approximation of annealing at one minute for each kilo basepair in

the gene, thus the annealing temperature was estimated at 45 seconds as the the

number of basepairs in the gene is 606bp.

Reaction Mix 1

GoTAQ® Master Mix 5µl

hRBP4 G-5’ 1µl

hRBP4 G-3’ 1µl

cDNA (1:50) as per Table 4.

SDW to 25µl

Tube No. Primer Concentration cDNA Volume

1 10ìM 6ìl

2 20ìM 6ìl

3 10ìM 3ìl

4 20ìM 3ìl

Table 4: Details of Primer concentration and cDNA volumes used in PCR 1.

24

2.8.1-2 PCR Condition Set 1

Step Temperature Time

Initial Denaturation 94oC 4min

PCR Cycle at 35 Cycles

Denaturation 94 oC 1min

Annealing 58 oC 45secs

Elongation 72 oC 45secs

Finish Cycle

Final Elongation 72 oC 10min


A total of 6 reaction tubes numbered 2 to 7 were prepared using primer

concentrations of 1µM to 10-4µM in each tube respectively using a cDNA volume

of 6µl. Each reaction tube contained the mix as outlined below. A gradient

annealing temperature method was employed for this PCR cycle. The temperature

gradient was based on the average TM of primers 1 and 2 using the following

calculation:

TM (Av) = (TM1 – TM2) = (81.5 + 67.4)/2 = 74.45 oC

TAnneal(Average) = TM (Av) – 5oC = 74.45 oC – 5oC = 69.45oC

The temperature range based on TAnneal(Average) ±3-5oC (appox) and layout of PCR

product tubes in the G-Storm PCR Instrument is outlined in Table 5. The PCR

product was ran on a 0.7% Agarose gel using a Consort E865 Electrophoresis

power supply set at 100V for 1 hour and shown in Fig.3.2

Reaction Mix 2

GoTAQ® Master Mix 5µl

hRBP4 G-5’ 1µl

hRBP4 G-3’ 1µl

cDNA (1:50) 6µl

SDW to 25µl

25

Lane 1 2 3 4 5 6 7 8 9 10 11 12

ToC 60.1 60.4 61.1 62.2 63.6 65.1 66.7 68.3 70.1 71.2 71.8 72.2

Tube - 2 - 3 - 4 - 5 - 6 - 7

Table 5: ToC gradient and tube layout for PCR 2.








Finish Cycle




concentrations of 10-5µM, 10-3µM and 10-1µM in each tube respectively using a

cDNA (1:500) volume of 4µl. Each reaction tube contained the mix as outlined

below. The PCR product was ran on a 1% Agarose gel using a Consort E865

Electrophoresis power supply set at 100V for 1.5 hours and shown in Fig.3.3.

Reaction Mix 3

GoTAQ® Master Mix 12.5µl

hRBP4 G-5’ 1µl

hRBP4 G-3’ 1µl

cDNA (1:500) 4µl

SDW to 25µl

26








Finish Cycle




concentrations of 10-5µM, and 10µM in each tube respectively using a cDNA

(1:500) volume of 3µl. Alu gene at a 10-5µM concentration was used as a positive

control for the reaction set used. Each reaction tube contained the mix as outlined

below. The PCR product was ran on a 1% Agarose gel using a Consort E865

Electrophoresis power supply set at 120V for 1hr-10mins and shown in Fig.3.4.

Reaction Mix 4

GoTAQ® Master Mix 12.5µl

hRBP4 G-5’ / Alu 5’ 1µl

hRBP4 G-3’ / Alu 5’ 1µl

cDNA (1:500) 3µl

SDW to 25µl

27







Elongation 72 oC 1min

Finish Cycle



A total of 8 reaction tubes numbered 2 to 5 and 7 to 10 were prepared using

primer concentrations of 10-5µM, 10µM and 1µM in each tube respectively using

a cDNA (1:500) volume of 3µl. Alu gene at a 10-5µM concentration was used as a

positive control for the reaction sets used. Each reaction tube contained the mix as

outlined below. The PCR product was ran on a 1% Agarose gel using a Consort

E865 Electrophoresis power supply set at 110V for 1hr-15mins and shown in

Fig.3.5. Two reactions were run simultaneously for this experiment using two

PCR machines which allowed for faster analysis on the new primers using two

different PCR condition sets. This was carried out in Machine 1 and Machine 2

which were in labs M4.06 and M4.02 respectively. Reaction mix 5.1 and 5.2 were

placed in Machine 1 and Machine 2 respectively. The PCR Condition sets below

are numbered also in this fashion. A gradient annealing temperature method was

employed for this PCR cycle. The temperature range of TAnneal(Average) ±3-5oC

(appox) and layout of PCR product tubes is outlined in Table 6 and Table 7.

Reaction Mix 5.1 Reaction Mix 5.2

GoTAQ® Master Mix 12.5µl GoTAQ® Master Mix 12.5µl

hRBP4 -5’ / Alu 5’ 1µl hRBP4 -5’ / Alu 5’ 1µl

hRBP4 -3’ / Alu 5’ 1µl hRBP4 -3’ / Alu 5’ 1µl

cDNA (1:500) 3µl cDNA (1:500) 3µl

SDW to 25µl SDW to 25µl

28

2.8.5-2 PCR Condition Set 5.1





Annealing 57 - 62 oC 55secs


Finish Cycle


2.8.5-2 PCR Condition Set 5.2





Annealing 63 - 67 oC 55secs


Finish Cycle


Lane

No.

1 2 3 4 5 6 7 8 9 10 11 12

ToC 57 57.2 57.5 57.9 58.3 59.1 59.8 60.5 61.2 61.7 61.9 62

Tube 2 5 - - 3 - - - 4 - - -

Table 6: ToC gradient and tube layout for PCR 5.1. (Machine 1)

29

Lane

No.

1 2 3 4 5 6 7 8 9 10 11 12

ToC 60.1 60.4 61.1 61.2 63.6 65.1 66.7 68.3 70.1 71.2 71.8 72.2

Tube

Table 7: ToC gradient and tube layout for PCR 5.2. (Machine 2)

2.9 Preparation of TAE Buffer

A 50X stock solution of TAE buffer at pH ~8.5 was prepared by

measuring out the following components in separate beakers and finally mixing in

a Duran Bottle. 242g of Tris base, 57.1ml of glacial acetic acid, 37.2g

Ethylenediaminetetraacetic Acid, Disodium Salt, Dihydrate (Na2EDTA.2H2O)

and then dH2O was added to a final volume of 1litre. A 1X TAE buffer was

prepared by measuring 20ml of 50X TAE and adding d.H2O to 1litre.

2.10 Purification and Expression of Kvβ2

Kvβ2 gene obtained from rat brain was cloned with an N-terminus His-tag.

The E. coli BL21 (DE3, plysS) stock was transformed with pET15b-Kvβ2 vector-

construct by culturing at 37°C in LB medium containing 50µg/ml ampicillin.

Absorbance was measured at 600nm (A600 nm), thus when the A600 nm of the culture

reached ~ 0.8, the expression of Kvβ2 protein was induced for 14hr by the

addition of IPTG to a final concentration of 1mM, by incubating at 25°C and

280rpm. Cells were resuspended in lysis buffer (20mM Tris-HCl, pH 7.9, 5mM

imidazole, 200mM NaCl) and lysed by sonication for 130 seconds while being on

ice, as protein is extremely sensitive to fluctuation in temperature. Cell debris was

collected by centrifugation at 39000g and the supernatant was run through the

nickel-charged iminodiacetic acid column pre-equilibrated with lysis

buffer/binding buffer. The Ni+ column was washed with 2.5 litres of the binding

buffer/lysis buffer to remove the unbound proteins. Elution was carried out with

20mM Tris-HCl, pH 7.9, 200mM NaCl, and 300mM imidazole. Fifteen fractions

of the post elution Kvβ2 were taken and absorbance (A280nm) of each tube was

30

measured and plotted as described in Fig.3.6 to obtain the elution profile of the

protein.

2.11 Dialysis of Kvβ2

2.11.1 Preparation of Dialysis Tubing

The dialysis tube was boiled in water containing 1mM EDTA for 30 minutes

as this will initiate the removal of glycerol, prepare the pores of the tubing and

chelate any ions present. Removal of sulphur compounds was carried out by

treating the tubing with a 0.3% (w/v) solution of sodium sulphide at 80oC for 1

minute followed by washing with hot water at 60oC for 2 minutes, followed by

acidification with a 0.2% (v/v) solution of sulphuric acid, then rinsed with hot

water to remove the acid.

2.11.2 Dialysis of Kvβ2

The dialysis of Kvβ2 was then carried out in 6 litres of pre-chilled 0.15M

potassium phosphate buffer, pH 7.5 for 36 hours with one change

2.12 HPLC assay to measure the inhibition of Kvβ2 mediated reduction of 4-

nitrobenzaldehyde

All inhibition studies were carried out in duplicate in 0.2M potassium

phosphate buffer, pH 7.5 containing 0.2mM NADPH at 22°C in the presence of

~0.5mg of Kvβ2 appropriate concentration of inhibitor and 500µM of 4-

nitrobenzaldehyde as substrate (final volume of 0.5ml).The inhibitor was

incubated with the protein for 15 minutes before the addition of substrate, which

was added last, and the reaction was further incubated for 40 minutes at 37°C. The

reaction was quenched by adding an equal volume of the HPLC mobile phase

(methanol/trifluroacetic acid/water, 60: 0.1: 39.9). Aliquots, (10µl), of the

resultant mixture were analysed on a Nucleosil C18 (3.9 x 150 mm) HPLC

column with monitoring by a Millipore Waters (Mississauga, Canada) liquid

chromatography UV detector at 274 nm. Controls with no enzyme were

incorporated in every reaction to monitor any background reaction of the inhibitor

with the substrate 4-nitrobenzaldehyde. This method was carried out for all three

inhibitory compounds Mobile phases; Solvents A, B and C, were prepared and

31

0

20

40

60

80

100

120

0 4 8 12 16 20 24 28 32

Run Time, minutes

So

lven

t, %

Solvent A

Solvent B

used for both the isocratic and gradient methods. The contents of Solvent A, B and

C are outlined in the Appendices. An isocratic method was used for Quercitin.

The isocratic method used 100% Solvent B.

2.12.1 Method for Gradient HPLC Assay (Rutin & Resveratrol)

All samples were prepared using the same protocol as outlined above for the

Isocratic HPLC Assay. A gradient assay was set up using Empower software. A

linear gradient setting of Solvent A and B was set up with a runtime of 20mins at

a flow rate of 0.9ml/min. The gradient breaks down as follows: 80% to 20%

Solvent A and 20% to 80% Solvent B over 15mins, 100% Solvent B, 0% Solvent

A for 5mins then back to original conditions of 80% Solvent A, 20% Solvent B.

Fig.2.1 below illustrates this gradient.

Fig.2.1. Diagram representing the Gradient elution method employed for the HPLC Analysis of Resveratrol and Rutin

Return to Normal Conditions

Gradient Profile Isocratic Profile

32

2.13 Bradford Method for Protein Concentration Determination

The protein concentration of Kvβ2 enzyme was determined using Bradford

reagent and by employing the Bradford method. Analysis was carried on out on

three preparations as outlined in Table 8. A Bovine Serum Albumen (BSA)

calibration standard curve was plotted by diluting 1mg/ml stock to yield the

concentrations 0-100 µg/ml of protein. This is seen in Fig.3.22. Bradford reagent

was added to each tube as described below and incubated for 5 minutes. The

absorbance (A595nm) reading was measured using Milton Roy Spectonic 1201

spectrophotometer.

Tube No. Protein d.H2O Bradford

Reagent

1 10ìl 70ìl 0.9ml

2 20ìl 80ìl 0.9ml

3 30ìl 70ìl 0.9ml

Table 8: Outline of reaction mixtures for Bradford Method

2.14 Flouresence Measurement of inhibitor - Kvβ2 binding

Flourometirc analysis of the bound NADPH cofactor to Kvβ2 was taking

using Perkin Elmer fluorescence spectrometer LS50B at 22°C. A 2.0µM sample

of Kvβ2 bound NADPH was carried out in 0.2M potassium phosphate buffer at a

pH 7.5 and all inhibitor solutions were made in DMSO prior to dilution in 0.2M

potassium phosphate buffer while maintaining a DMSO concentration ≤ 1% v/v.

An excitation wavelength of 360nm and a slit size of 15nm were used an emission

spectra were analyzed from 300nm to 600nm. Spectra were recorded as noted in

Chapter 3. 10µl of inhibitor was then added to the Kvβ2 solution and inverted

several times to mix. Using the same conditions, a spectrum was recorded at zero

minutes (T0min) and at set intervals thereafter; T5min, T10min and T15min.

33

Chapter 3:

Results

34

3.0 Results

3.1 PCR Results

Primer concentrations are listed below each PCR image as the concentration of

sample used. Fig.3.1 to Fig.3.5 below outlines the amplification results from PCR

experiments one to five.

Fig.3.1: PCR UV Photograph of PCR #1 on a 0.7% Agarose Gel taken at 302nm. Lane 1: 10µM:

Lane 2: 20µM Sample. Lane 3: 10µM sample. Lane 4: 20µM Sample. Lane 5: 100bp Marker.

1 2 3 4 5

35

Fig 3.2: PCR UV Photograph of PCR #2 on a 0.7% Agarose Gel taken at 302nm. Lane 1: 100bp

Marker (sample leaked out of the well when loading, this there is streaks of DNA). Lane 2: 1µM

Sample. Lane 3: 10-1µM sample. Lane 4: 10-2µM Sample. Lane 5: 10-3µM Sample. Lane 6&7: 10-

4µM Sample. Lane 8: No sample. Lane 9: 100bp Marker.

1 2 3 4 5 6 7 8 9

1500bp

500bp

100bp

36

Fig.3.3: PCR UV Photograph of PCR #3 on a 1% Agarose Gel taken at 302nm. Lane 1: 100bp

marker. Lane 2: 10-5µM Sample. Lane 3: 10-3µM Sample. Lane 4: 10-1µM Sample. Lanes 5-11: No

Sample. Lane 12: 100bp marker.


marker. Lane 2: 10-5µM Alu Gene (Positive control). Lane 3: 10µM Sample. Lane 4: 10-5µM

Sample. Lanes 5: 100bp marker

1 2 3 4 5 6 7 8 9 10 11 12

1 2 3 4 5

1500bp

500bp

100bp

1500bp

500bp

100bp

37


marker. Lane 2: 10µM Sample. Lane 3: 1µM Sample. Lane 4: 10-5µM Sample. Lanes 5: 10-5µM

Alu Gene (Positive control). Lane 6: 100bp Marker. Lane 7: 10-5µM Alu Gene (Positive control).

Lane 8: 10µM Sample. Lane 9: 1µM Sample. Lane 10: 10-5µM Sample. Lane 11: No Sample.

Lane 12: 100bp marker

3.2 Expression and Purification of Kvβ2

Fig. 3.6: Elution profile of purified Kvβ2 after being placed in a Ni+ column. The Phosphate buffer

used during elution was measured as a blank and the protein was eluted as a single peak.

-0.1

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

0 2 4 6 8 10 12 14 16

Protein Volume (ml)

Ab

sorb

an

ce (

28

0n

m)

1 2 4 5 7 9 11 12 3 6 8 10

1500bp

500bp

100bp

38

1.70

4

9.02

3

12.0

33

AU

0.00

0.50

1.00

1.50

2.00

Minutes0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00

1.70

2

7.58

8

9.03

6

AU

0.00

0.02

0.04

0.06

0.08

0.10

Minutes0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00

3.3 HPLC Chromtatograms for the Inhibition of Kvβ2 Mediated Reduction

of 4-nitrobenzaldehyde

3.3.1 Chromatogram Results for Rutin Experiment

Fig.3.7: Chromatogram showing a control reaction for Rutin experiment containing 0.5mM 4-

nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly shows

the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product of the

Kvβ2 mediated reduction of 4-nitrobenzaldehyde)

Fig.3.8: Chromatogram showing a control reaction for Rutin experiment containing 0.5mM 4-

nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The

comparatively small peak intensity of the NADPH is due to the lack of the NADPH bound

cofactor present with the inclusion of Kvβ2.

NADPH 4-N-B-alc

4-N-B-alc

4-N-B-ald

NADPH 4-N-B-ald

39

AU

0.000

0.002

0.004

0.006

0.008

0.010

0.012

0.014

0.016

0.018

0.020

0.022

0.024

0.026

0.028

0.030

Minutes7.12 7.14 7.16 7.18 7.20 7.22 7.24 7.26 7.28 7.30 7.32 7.34 7.36 7.38 7.40 7.42 7.44 7.46 7.48 7.50 7.52 7.54 7.56 7.58 7.60

Fig.3.9: Concentration dependant inhibition of Kvβ2 by Rutin. The chromatogram shows the

decrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasing

concentration of Rutin (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10 µΜ

Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM NADPH

and various concentrations of Rutin, after the addition of Rutin to Κvβ2 containing NADPH.

No Rutin

100µM

300µM

500µM

700µM

40

1.91

4

3.05

63.

387

AU

0.00

0.05

0.10

0.15

0.20

Minutes0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00

1.90

8

3.40

3

4.80

2AU

0.00

0.05

0.10

0.15

0.20

Minutes0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00

3.3.2 Chromatogram Results for Quercitin Experiment

Fig.3.10: Chromatogram showing a control reaction for Quercitin experiment containing 0.5mM

4-nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly

shows the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product

of the Kvβ2 mediated reduction of 4-nitrobenzaldehyde)

Fig. 3.11: Chromatogram showing a control reaction for Quercitin experiment containing 0.5mM

4-nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The

comparatively small peak intensity of the NADPH is due to the lack of the NADPH bound

cofactor present with the inclusion of Kvβ2.

4-N-B-alc

NADPH 4-N-B-ald

4-N-B-alc

NADPH

4-N-B-ald

41

Fig.3.12: Concentration dependant inhibition of Kvβ2 by Quercitin . The chromatogram shows the

decrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasing

concentration of Quercitin (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10 µΜ

Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM NADPH

and various concentrations of Quercitin, after the addition of Quercitin to Κvβ2 containing

NADPH.

AU

0.000

0.005

0.010

0.015

0.020

0.025

0.030

0.035

0.040

0.045

0.050

Minutes2.96 2.98 3.00 3.02 3.04 3.06 3.08 3.10 3.12 3.14 3.16 3.18 3.20

No Quercetin

50µM

100µM

300µM

500µM

42

1.69

9

7.43

3

8.88

1

AU

0.00

0.02

0.04

0.06

0.08

Minutes0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00

1.70

0

8.80

9

11.7

20

AU

0.00

0.10

0.20

0.30

0.40

Minutes0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00 16.00 17.00 18.00 19.00 20.00

3.3.3 Chromatogram Results for Resveratrol Experiment

Fig.3.13: Chromatogram showing a control reaction for Resveratrol experiment containing 0.5mM

4-nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly

shows the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product

of the Kvβ2 mediated reduction of 4-nitrobenzaldehyde)

Fig.3.14: Chromatogram showing a control reaction for Resveratrol experiment containing 0.5mM 4-

nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The comparatively

small peak intensity of the NADPH is due to the lack of the NADPH bound cofactor present with the

inclusion of Kvβ2.

4-N-B-alc

NADPH

4-N-B-ald

4-N-B-alc

NADPH 4-N-B-ald

43

Fig.3.15. Concentration dependant inhibition of Kvβ2 by Resveratrol. The chromatogram shows

the decrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasing

concentration of Resveratrol (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10

µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM

NADPH and various concentrations of Resveratrol, after the addition of Resveratrol to Κvβ2

containing NADPH.

AU

0.000

0.002

0.004

0.006

0.008

0.010

0.012

0.014

0.016

0.018

Minutes7.30 7.35 7.40 7.45 7.50 7.55 7.60 7.65 7.70 7.75 7.80 7.85 7.90 7.95 8.00

100µM

300µM

500µM

No Resveratrol

44

3.4 Percentage Inhibition Results for Rutin, Quercitin and Resveratrol

Fig.3.16: Concentration dependant inhibition of Kvβ2 by Rutin. The graph shows the percentage-

inhibition of the Kvβ2 activity as a result of increasing concentrations of Rutin (0-2000µM) in a

mixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde

(substrate), 200µM NADPH and various concentrations of Rutin, after the addition of Rutin to

Κvβ2 containing NADPH and 4-nitrobenzaldehyde.

Fig.3.17: Concentration dependant inhibition of Kvβ2 by Quercitin. The graph shows the

percentage-inhibition of the Kvβ2 activity as a result of increasing concentrations of Quercitin (0-

2000µM) in a mixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-

nitrobenzaldehyde (substrate), 200µM NADPH and various concentrations of Quercitin, after the

addition of Rutin to Κvβ2 containing NADPH and 4-nitrobenzaldehyde.

45

Fig.3.18: Concentration dependant inhibition of Kvβ2 by Resveratrol. The graph shows the

percentage-inhibition of the Kvβ2 activity as a result of increasing concentrations of Resveratrol

(0-2000µM) in a mixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-

nitrobenzaldehyde (substrate), 200µM NADPH and various concentrations of Resveratrol, after the

addition of Rutin to Κvβ2 containing NADPH and 4-nitrobenzaldehyde.

3.5 Flouresence Spectra

Fig,3.19: Flourometric data showing the binding of Rutin to Kvβ2 in a 2µM Kvβ2 + 50µM

phosphate buffer mixture which is leading to a 64% reduction in Flouresence emission of the peak

at 460nm representing the bound cofactor.

46

Fig.3.20: Flourometric data showing the binding of Quercitin to Kvβ2 in a 2µM Kvβ2 + 50µM



Fig.3.21: Flourometric data showing the binding of Resveratrol to Kvβ2 in a 2µM Kvβ2 + 50µM



47

0

0.1

0.2

0.3

0.4

0.5

0 10 20 30 40 50 60 70 80 90 100

[BSA] (µg/ml)

Ab

sorb

ance

at 5

95 n

m

3.5 Bradford Method Standard Curve

Fig.3.22: Data shown represents BSA standard curve for the estimation of protein concentration

using the Bradford Method.

48

Chapter 4:

Discussion

thesis complete final edit gm dt480.4 p

Documents

human retinol binding

institute oruniversity

award b

fromthe work

deoxyribonucleic aciddntp

copy deoxyribonucleic

luria bertani brothm

luria bertani agarlbb