Vol. 64, No. 12

The Upstream Factor-Binding Site Is Not Essential for Activation ofTranscription from the Adenovirus Major Late Promoter

MICHAEL REACH,1 LEE E. BABISS,2 AND C. S. H. YOUNG'*Department of Microbiology, College of Physicians and Surgeons, Columbia University, New York, New York 10032,'

and Department of Molecular Cell Biology, Rockefeller University, New York, New York 100212

Received 17 July 1990/Accepted 12 September 1990

An adenovirus major late promoter (MLP) has been constructed with a 4-bp alteration in the sequence whichbinds the transcription factor known as USF or MLTF. This upstream element has often been considerednecessary and sufficient for maximal transcription of the MLP. A duplex oligonucleotide containing the mutantsequence was not capable of binding specific proteins in a band shift assay, nor was it capable of inhibiting suchbinding by the wild-type sequence. In an in vitro assay, the mutant sequence was incapable of inhibitingtranscription from a duplex sequence containing the MLP, whereas the wild-type sequence could. These twopieces of evidence suggest that the sequence is functionally impaired. Surprisingly, a virus containing themutant MLP had a normal replication phenotype. On more detailed examination however, we show that themutant viral MLP was deficient in transcription at 9 h postinfection but that the rate of transcription was closeto normal by 20 h postinfection. An inverted CAAT box located immediately upstream of the USF-bindingelement was not previously thought to be of importance to the functioning of the MLP. However, a single pointmutation in the CAAT box, placed in the USF mutant background, had a marked effect upon transcriptionfrom the MLP. This result suggests that the MLP may exhibit functional redundancy in which either theUSF-binding site or the CAAT box can serve as an upstream promoter element. Neither of the mutant virusesdisplayed any change in the levels of the divergent IVa2 transcription unit, suggesting that the levels ofdivergent transcription are not determined by competition for limiting transcription factors.

Over the last decade, a general picture of the structure ofmammalian promoters has emerged. cis-Acting DNA se-quence elements have been identified and trans-acting tran-scription factors have been isolated and cloned (for reviews,see references 12, 21, 33, 37, and 39). Emphasis has nowshifted to the mechanisms by which tissue-specific transcrip-tion regulation is achieved (for a review, see reference 45),and a detailed biochemical description of the proteins in-volved in these reactions is under way. Yet, despite theseadvances, the behavior of most mutant mammalian promot-ers in their correct genomic context has not been addressedbecause of the difficulties of replacing the wild-type versionof the promoters with mutant counterparts by homologousrecombination. The transcriptional behavior of promotersmay be affected by their context, and these effects may bemissing in simplified reconstructed systems. The majorexception to the lack of contextual analysis in mammalianpromoters has occurred in viruses, when it is possible toreconstruct the genome in its entirety, and mutated promoterelements can be examined for their detailed transcriptionalphenotypes (as in the herpesvirus thymidine kinase gene [6]and the simian virus 40 early promoter [18]).The major late promoter (MLP) of adenovirus is one of the

viral promoters that have been extensively studied as modelsfor eucaryotic transcription. In the MLP, the requirementsfor specific cis-acting sequences have been examined, usingin vitro transcription and plasmid-borne transfection assays(7, 16, 25, 26, 40, 41, 48, 56), as well as at ectopic sites (30,35) in the viral genome. These studies have defined cellularfactor-binding sites important to promoter function underthe experimental conditions employed. The MLP has beenthought to be an example of a simple promoter in that it

* Corresponding author.

functions with a TATA element located at an appropriatedistance from the start site and an upstream element towhich a trans-acting factor termed USF or MLTF binds (40,46, 48). Data suggest that the TATA box-binding factorTFIID interacts with USF to give maximal expression (48).Although the requirements for maximal activity of the

MLP have been defined previously, these studies did notaddress the more complex regulatory circuits that may beoperating in viral infection. The promoter is subject tocontrol by adenovirus Ela protein (27, 43) by unknownmechanisms (see, for example, references 22 and 29) and isactivated at late times by DNA replication (20, 52). Thelatter effect may be mediated both by cis-acting effects ofDNA replication itself (52) and also by the action of a newlydescribed factor induced at late times (20) which binds tosequences identified as being downstream of the transcrip-tion start site (20, 28). The degree to which these controls aredependent upon the MLP being in its correct position withinthe viral chromosome are not known. Thus we have chosento make mutations in the various promoter elements and tostudy them in the correct position.As part of this survey, we have studied the function of the

upstream promoter elements and have determined the im-pact of the altered sites on the viral life cycle. We demon-strate that the mechanism of promoter expression in thevirus is more complicated than previous studies suggest. Aswith many other promoters, the MLP may exhibit functionalredundancy of upstream elements, and we discuss the im-plications for the mechanism of promoter activity.

MATERIALS AND METHODSOligonucleotide-directed mutagenesis. A 453-bp fragment

extending from a XhoI site at bp 5778 to a Hindlll site at bp6231 was cloned into the same sites in an M13mpl8 vector(55) containing the polylinker from pIC7 (36). Mutagenesis

5851

JOURNAL OF VIROLOGY, Dec. 1990, p. 5851-58600022-538X/90/125851-10$02.00/0Copyright C 1990, American Society for Microbiology

5852 REACH ET AL.

was performed by the techniques of Kunkel (23). Briefly, theMLP-containing M13 was grown in the dut ung mutantEscherichia coli CJ236, causing T's to be replaced by U's.Viral DNA was isolated, and the resulting uracil-containingtemplate was hybridized to an oligonucleotide primer con-taining the desired alteration, which was then extended by amodified form of T7 polymerase (Sequenase [United StatesBiochemical]) to copy the entire M13 genome. The double-stranded DNA was transfected into competent JM109 (55) inwhich replication favors the mutation-containing strand overthe wild-type uracil-containing strand. Six of the resultingplaques were screened for those containing the mutation, bysequencing the viral DNA using the dideoxy method (47).Oligonucleotides were purchased from Genetic Designs(now Genosys), The Woodlands, Tex., or from the oligonu-cleotide-synthesizing facility, Comprehensive Cancer Cen-ter, Columbia University, New York, N.Y. The mutation-containing oligonucleotides (mutated bases underlined) wereas follows:

USFO 5' CCCGG-CAIGTAGCATACACC 3'CAAT 5' CCTATAAACCCATCACCTTCC 3'

Construction of an adenovirus MLP replacement vector.For ease of replacement of the wild type by the mutatedMLP sequences, modifications were made to plasmid pO-26.5 (1). This plasmid contains adenovirus sequences ex-tending from the viral left-hand end at map unit (m.u.) 0 tom.u. 26.5 (bp 9523). The MLP/IVa2 region of study is locatedat around m.u. 16.7 and is flanked by two convenientrestriction sites, a XhoI site at bp 5778 and a HindlIl site atbp 6231. In order to allow the easy replacement of promoterfragments, a HindlIl site at bp 2798 and a XhoI site at bp8244 were removed by amino acid-conserving oligonucle-otide-directed mutagenesis, and a plasmid containing uniqueflanking sites was rebuilt by standard cloning techniques(32). This plasmid, pMR1, was further modified to contain a6-bp insert, creating an EcoRI site at the PvuII site at bp6069. This site (which confers no phenotype) can be used asa screen in the replacement described below. The modifiedplasmid is referred to as pMR2.

Testing of MLP mutations by overlap recombination. Aftermutagenesis, the XhoI-to-HindIII MLP fragment was ex-cised from the M13 vector replicative-form DNA into pMR2(Fig. 1). Individual clones were screened for the loss of theEcoRI site present at bp 6069 in the parental plasmid, and itwas assumed that the derivative lacking the site containedthe mutant MLP in its place. To test the viability of aparticular mutant MLP, small DNA preparations of themutation-containing plasmid were digested with EcoRI. Af-ter inactivation of the restriction enzyme, the unpurified mixwas cotransfected (15, 53) on human A549 cells with a rightterminal adenovirus genomic fragment extending from theXhoI site at 22.9 m.u. from the phenotypically wild-typevirus LLX1 (1). Recombination in the overlapping sequencefrom 22.9 to 26.5 m.u. will yield a full-length genome, and ifthe mutation does not confer a lethal phenotype, will giverise to plaques on the transfection plates. The presence ofthe mutations in the resulting viruses was confirmed bycloning the XhoI-to-HindIII fragment into a pSP64-derivedplasmid, followed by double-stranded sequencing using themethod of Zagursky et al. (57). Mutant viruses were plaquepurified once before further analysis.

Viral replication. Growth curves were performed on hu-man A549 cells, derived from a small cell carcinoma of thelung (14). Cells were grown to confluency in 35-mm-diameterdishes in Dulbecco modified Eagle medium plus 10% sup-

plemental calf serum (Hyclone). Infections were performedby removing the medium and adding 0.2 ml of virus at amultiplicity of infection of 10 PFU per cell and incubating at37°C for 1 h, with periodic shaking. The plates were thenoverlaid with infecting fluid (24). The infected cells wereharvested at intervals by freezing individual dishes, andvirus was liberated by repeated freezing and thawing. Titra-tion was performed on A549 cells by fluorescent focus assay(44).DNA replication. Viral DNA was extracted by a modifica-

tion (53) of the Hirt technique (19), from A549 cells infectedidentically to those used for the growth curves. The DNAwas transferred to a Nytran filter (Schleicher & Schuell),using a slot blot apparatus. The filter was blocked for 2 h ina solution containing 4x Denhardt solution, 0.1% sodiumdodecyl sulfate, and 5x SSC (lx SSC is 0.15 M NaCl plus0.015 M sodium citrate), and then probed with the MLPderivative of the pSP64 plasmid described above, which hadbeen labeled by random priming synthesis (13) using both[ct32P]dGTP and [ct-32P]dCTP (3,000 Ci/mM; New EnglandNuclear Corp.). The filter was washed first with 2x SSC-0.1% sodium dodecyl sulfate for 30 min at 65°C and then in2 x SSC at 65°C for 30 min, air dried, and exposed to KodakXAR-5 film for 1 h.

Mobility shift assays. Single-stranded oligonucleotidescontaining either the wild-type USF-binding site or the4-base alteration contained in USFO were phosphorylated,using 10 U of polynucleotide kinase and 100 ,uCi of[_y-32P]ATP in a 10-,ul reaction. The phosphorylated oligonu-cleotides were purified from the unincorporated [32P]ATP byelution from NAP-5 columns (Pharmacia). The labeled sin-gle-stranded oligonucleotides were then hybridized withtheir unlabeled complementary strand by heating to 65°C in100 mM NaCl-1 mM EDTA and slow cooling to 30°C. Thetechnique for the mobility shift was adapted from that ofShore et al. (50). The labeled duplex oligonucleotides wereadded to 40 RI of 5x FPB (100 mM NaCl, 10 mM Tris [pH7.4], 100 ,ug of bovine serum albumin) plus 160 p.l of H20.The HeLa nuclear extract, prepared by a protocol modifiedfrom Dignam et al. (11), was preincubated for 2 min withcompetitor oligonucleotide when indicated, probe wasadded, and the mix was incubated at room temperature for20 min, and then electrophoresed through a 5% nativepolyacrylamide gel to separate bound from unbound probe.The gel was dried and exposed to Kodak XAR-5 film for 45min.

In vitro transcription assays. The duplex oligonucleotidesused in the mobility shift assays were used as competitorsfor transcription factors in an in vitro transcription assaybased on the use of the G-less cassette (48, 49). Rat liverprotein extract was mixed with a plasmid which containedthe sequence of interest upstream of the G-less cassette andcompetitor oligonucleotide when indicated, and incubatedwith a solution containing [32P]UTP (35 mM), CTP, ATP (0.6mM), and 3' O-methyl-GTP at 30°C for 30 min. The reactionswere phenol extracted, and the nucleic acids were precip-itated by ethanol overnight at -20°C. Pellets were sus-pended in running buffer containing 90% formamide, andsamples were electrophoresed on a 5% denaturing polyacryl-amide gel.RNase protection assays. Riboprobes (38) specific for Elb,

IVa2, and late leader 3 were made by incubating linearizedtemplate DNA with 10 ,ul of a solution containing[ot-32P]UTP, 2 mM GTP, CTP, ATP, and 0.1 mM UTP withSP6 RNA polymerase in a 25-,lA reaction at 40°C for 45 minand then treated with RNase-free DNase (Promega). Follow-

J. VIROL.

IN VIVO TRANSCRIPTION FROM ADENOVIRUS MLP

ing DNase treatment, 15 ,ug of yeast tRNA (BethesdaResearch Laboratories), 200 ,ul of 4 M ammonium acetate,180 ,ul of H20, and 1 ml of ethanol were added. Precipitationof RNA was performed on dry ice for 10 min, the precipitatewas centrifuged for 10 min, and the pellet was washed with70% ethanol and dried. Amounts of RNA corresponding to106 cpm of the riboprobe preparation were used in thesubsequent hybridization reactions. Cytoplasmic RNA was

isolated at indicated times postinfection (p.i.) as follows. Atotal of 50 x 106 infected HeLa cells were pelleted, washedonce with ice-cold phosphate-buffered saline without mag-

nesium, resuspended in 1 ml of phosphate-buffered saline,and transferred to a microcentrifuge tube. The cells were

pelleted for 20 s in a microcentrifuge in the cold room andsuspended in 260,ul of lysis buffer. Five microliters of 5%Nonidet P-40 was added, and the tube was vortexed and thenkept on ice for 5 min. Nuclei were pelleted, and the super-

natant was kept. Two hundred microliters of 2x PK buffer(2x PK buffer is 0.2 M Tris chloride buffer [pH 7.5]-25 mMEDTA-0.3 M NaCl-2% [wt/vol] sodium dodecyl sulfate) wasadded, followed by 10 IlI of a proteinase K solution (10

,ug/,ul; Boehringer Mannheim), and incubated for 30 min at65°C. The solution was extracted twice with phenol and withchloroform-isoamyl alcohol and then precipitated with eth-anol. Fifteen micrograms of total cytoplasmic RNA was

hybridized to riboprobe in 75% formamide for 18 h and thendigested with 50 U of T2 RNase (Bethesda Research Labo-ratories) per ml in 350,ul of T2 buffer for 2 h. The mix was

phenol extracted, and the ethanol precipitate was thenelectrophoresed on a 5% denaturing acrylamide gel.Primer extensions. The technique used was that of Her-

nandez and Keller (17), as modified by Yumi Kasai and JaneFlint (personal communication). Total cytoplasmic mRNAwas isolated by the method described above. mRNA was

hybridized to oligonucleotide primers, kindly provided by Y.Kasai and J. Flint, specific for either MLP or IVa2 tran-scripts. The oligonucleotides were then extended by usingavian myeloblastosis virus reverse transcriptase with[cI-32P]dCTP, dGTP, dATP, and TTP, and the products were

electrophoresed on a 6% denaturing polyacrylamide gel.Nuclear run on transcription assays. A total of 1.5x 108

HeLa cells in spinner culture were infected with the appro-

priate viruses and at the indicated times were centrifuged,washed twice with ice-cold phosphate-buffered saline sus-

pended in 1 volume of RSB (10 mM Tris chloride buffer [pH7.4], 10 mM NaCl, 1.5mM MgCl2, 0.5 mM phenylmethyl-sulfonyl fluoride, 0.5 mM dithiothreitol), and incubated on

ice for 10min. All subsequent manipulations were performedon ice or at4°C. Cells were centrifuged and resuspended in1/4 volume of RSB, Dounce homogenized, and recentri-fuged, and the nuclear pellet was suspended in 1/10 volumeof RSB plus 0.025% Nonidet P-40. They were Douncehomogenized again, and the nuclei were added to the top ofRSB containing 30% sucrose. The tubes were spun at 1,000rpm in an IEC model PR2 centrifuge for 15 min, thesupernatant was removed with a pipette, and the purifiednuclei were suspended in 2x transcription buffer(2X tran-scription buffer is 40 mM Tris chloride buffer [pH 7.9]-200mM KCI-9 mM MgCl2-10 mM dithiothreitol-40% [vol/vol]glycerol) and recentrifuged. The pellet was suspended in an

equal volume of a solution containing 0.8 MM [32p]UTP(3,000 CiImM; New England Nuclear Corp.), 2 mM ATP,CTP, and GTP and incubated for 15min at30°C. Thepreparation was chased with an equal molarity of cold UTPfor 10min. One hundred microliters of RNase-free DNase(Bethesda Research Laboratories) was added and incubated

A

X m H

RF DNA

RI H

pMR226.5 m.u.

0 m.u.

X m H

RMutant 26.5 m.u.pMR2 /

O m.u.

B m 26-5 m.u.

_,

22.9 m.u.

EjI LLX1 DNA100 m.u.

FIG. 1. Strategy for replacement of the wild-type MLP sequence

by mutant sequences. The details of the reconstruction cloning andthe overlap recombination methods are described in Materials andMethods. (A) Replacement of wild-type sequence by mutant se-

quence in plasmid pMR2. The XhoI-to-HindIII fragment is derivedfrom M13 replicative-form (RF) DNA. (B) Cotransfection of theplasmid and the viral DNA fragment. Abbreviations: X, XhoI site atbp 5778; H, HindIll site at bp 6231; R, artificial EcoRI site at bp6069; m, mutated sequence in the MLP region. In plasmid pMR2,the thick line represents adenovirus sequences, and the thin linerepresents pBR322 sequences. The adenovirus sequences at theleft-hand end and at bp 9523 are bounded by the EcoRI and BamHIsites of pBR322, respectively.

for 15 min at room temperature, followed by an equalvolume of 2x PK buffer. Proteinase K was added to a finalconcentration of 200,ug/ml and incubated for 30 min at37°C.Three to four volumes of RNAzol B (Cinna/Biotecx, Friend-swood, Tex.) were added, the mixture was vortexed vigor-ously, and centrifuged at 8,000 rpm in a Sorvall SS34 rotor at

4°C for 10 min. The supernatant was kept, 1/4 volume ofammonium acetate was added, and RNA was precipitatedwith ethanol. The precipitation step was repeated four timesto remove unincorporated label. The final RNA pellet wassuspended in 1 ml of 10 mM Tris EDTA, and a sample was

used to determine the radioactive counts. In the subsequenthybridizations, 107 and 106 CpM were used for early and latetime points, respectively. Nytran filters (Schleicher &Schuell) containing 15,ug of various single-stranded M13clone DNAs were prepared on a slot blot apparatus. TheDNA was cross-linked to the filters with a Stratagene UVcrosslinker and baked for 30min in a vacuum oven. Hybrid-ization in the presence of 50% deionized formamide was

done by standard procedures.

5853

5854 REACH ET AL.

RESULTS

Introduction of a mutated MLP into virus. To examine theeffects of mutations upon the function of the adenovirusMLP in vivo, we have developed a system that allows theeasy placement of an altered MLP in the correct viralgenomic location (Fig. 1). This allows a rapid survey ofmutations in the promoter elements. Although it is knownthat the DNA polymerase encoded on the opposite strand tothe MLP transcription unit can tolerate many amino acidsubstitutions and in-frame insertions (1; also unpublishedresults), the mutations introduced maintained the wild-typesequence of the DNA polymerase so that any phenotypicconsequences could be ascribed unambiguously to the MLP(or IVa2) transcription unit. To test the viability of a partic-ular mutant MLP, mutation-containing plasmids are cotrans-fected on human A549 cells with an adenovirus fragment thatextends from 22.9 to 100 m.u. Recombination in the over-lapping sequence will yield a full-length genome, and if themutation does not confer a lethal phenotype, will give rise toplaques on the transfection plates. The presence of themutations in the resulting viruses can be confirmed bycloning and sequencing of the appropriate region.

Elimination of the USF-binding site. The first element to beexamined in detail was the USF-binding site, which on thebasis of previous work, was suggested to be the onlyupstream element necessary for maximal activity of theMLP (30, 48). The element is a nearly perfect palindrome 5'GGCCACGTGACC 3' extending from -63 to -52 relativeto the MLP start site at + 1.To eliminate binding of USF, a 4-bp alteration in the

binding site was constructed as follows:

-63 -52wild type: GGCCACGTGACCmutant: TGCIACATGGCC

Changes at these sites were demonstrated previously toreduce transcription (25) and the G residue at position -63 isconserved in the mouse metallothionein promoter (2). Plas-mids containing these mutations formed the same numbersof plaques in the overlap reactions as the wild-type plasmid.Virus carrying the mutant USF site formed the same sizeplaques as the wild type, although the individual infectedcells displayed a more birefringent morphology.To investigate the ability of the altered USF site (USFO) to

bind its cognate factor, we performed a mobility shift assaywith HeLa cell nuclear extract. An oligonucleotide contain-ing the normal USF-binding site (wild-type probe) wasincubated with extract and electrophoresed on a nativepolyacrylamide gel (Fig. 2, lanes 1 to 6). As shown in lane 4,the mobility of the probe was reduced, with the appearanceof two slower-migrating bands. Extract incubated with a50-fold molar excess of unlabeled oligonucleotide containingthe wild-type sequence, eliminated the appearance of thebands (lane 3), whereas competition with the mutant se-quence or with an unrelated oligonucleotide, at 100-foldmolar excess, eliminated only the lower band (lanes 5 and 6).From these and other results with oligonucleotides contain-ing mutant USF sites (results not shown), we suggest thatthe upper band is specific for the USF interaction and thatthe lower band is caused by some nonspecific interaction. Asadditional evidence in support of this conclusion, the wild-type oligonucleotide was incubated with yeast whole-cellextract. Yeast extract contains a factor capable of binding tothe USF site (4). As expected, wild-type oligonucleotideincubated with yeast extract showed a slightly greater de-

WT PROBE USFO PROBE

- y -HELA-- -HELA-COMPETITOR COMPETITOR

- - W - U Oc --U W Oc

..........

1 2 3 4 5 6 7 8 9 10 11

FIG. 2. Analysis of the retardation of duplex oligonucleotidescontaining wild-type (WT) or mutant USF-binding sequences byHeLa cell nuclear extracts. The methods for band shifting aredescribed in Materials and Methods. The sequence of the wild-typeoligonucleotide was 5' GGTGTAGGCCACGTGACCGGG 3' and itscomplement (the sequence protected by USF binding is in italics).The mutant sequence was 5' GGTGTATGCTACATGGCCGGG 3'and its complement (the mutated bases are in boldface type). Thecompetitions were performed with wild-type sequence (W), USFOsequence (U), or a sequence capable of binding the transcriptionfactor Octl (Oc). Incubations were performed with HeLa nuclearextract, a yeast whole-cell extract (y), or nothing (-).

crease in mobility of the specific band than that with HeLaextract (lane 2). Further corroborating evidence that theupper band is specific for USF binding came from incubationwith antibodies directed against USF. When extracts werepreincubated with the antibody, the upper band was elimi-nated (data not shown).When the USFO oligonucleotide was used as a probe (Fig.

2, lanes 7 to 11) only the lower nonspecific shifted band wasobserved (lane 8). As expected, the lower band shift wasinhibited by the mutant, wild-type, and unrelated oligonu-cleotides. The mutant oligonucleotide also has been shownto be incapable of binding purified USF (Polly Gregor,personal communication).These results strongly suggest that the mutant USFO

sequence cannot bind USF in this in vitro system. Fromresults to be shown later, we can also infer that the mutantsequence cannot bind USF in the infected cell.The mutated USF-binding sequence does not inhibit in vitro

transcription. Before examining the transcriptional charac-teristics of the virus containing the mutant USF-binding sitein detail, it seemed prudent to determine whether the mutantsite affects in vitro transcription. One method to examinetranscription factors necessary for promoter activity in an invitro transcription assay is to attempt to allow competitionfor these factors with oligonucleotides containing factorbinding sites. If the factors are involved in promoter func-tion, sequestration of the particular factors by the oligonu-cleotides will result in a decrease in promoter activity.We employed an in vitro transcription system derived

from rat liver extracts and a supercoiled plasmid containingthe MLP extending from -88 to +33, fused to a G-lesscassette (49). Transcription reactions containing only threenucleotides, ATP, UTP, and CTP, give rise to transcripts250 nucleotides in length. The ability of the cold oligonucle-otides used in the mobility shift assay to compete and henceto lower transcription was determined. As expected, tran-scription from the MLP-containing template was decreased

J. VIROL.

IN VIVO TRANSCRIPTION FROM ADENOVIRUS MLP

0-0 0 0CD en c)O00CzZZ Z (aoCD (a CECc C V) U)cl n -nm m

(D (. 0

A 6 hrs I2 hrs+Ara 12hrs 24hrs--I

2 3 4 5 6 7 8 9 10 1 12 M1 1_ iO

rn411mu__ 0. 4 90

-~~~~~~~~= =I: -a

FIG. 3. In vitro transcription competition assay. In vitro tran-scription assays were set up as described in Materials and Methods.The extended transcription product is 250 nucleotides in length(arrow) and migrates slightly slower than the 242-bp band of theMspI-digested and end-labeled pBR322 markers (results not shown).Reactions were preincubated with wild-type (WT) or mutant oligo-nucleotide, as indicated, prior to the incorporation reaction.

with wild-type oligonucleotide (Fig. 3, lanes 3 and 4). On theother hand, the mutation-containing oligonucleotide, whichfailed to produce a specific shift, did not decrease expression(lanes 1 and 2).These in vitro transcription results, together with the

findings of the mobility shift assay, suggest that the USFOsequence is unable to bind factor(s) necessary for increasedMLP activity.

Analysis of RNA production in vivo: RNase protectionassays. Despite the inability of the mutant sequence to bindUSF, we were surprised to find that the sequence could beincorporated into viable virus. Thus it was of some impor-tance to determine whether the elimination of USF binding,as suggested by the results above, resulted in a change to thetranscriptional program of the virus.

In order to examine the transcription phenotype of themutant MLP, we measured steady-state accumulation ofcytoplasmic RNA sequences derived from transcriptionfrom the major late, IVa2, Elb, and protein IX promoters byRNase T2 protection assays. Cytoplasmic RNA was isolatedat different times p.i. from HeLa cells infected with thewild-type or mutant viruses, hybridized to each of thespecific riboprobes, digested with RNase T2, and electro-phoresed on a denaturing polyacrylamide gel. One set ofinfected cells from each infection was incubated in thepresence of AraC to inhibit DNA replication. The resultsfrom the MLP are shown in Fig. 4A. As expected, expres-sion was not observed from the MLP of either virus at 6 hp.i. or in the presence of AraC (wild type in lanes 3 and 6 andUSFO in lanes 2 and 5). Specific protected probe bandscorresponding to MLP expression (band corresponding to 89bases in length) are visible at 12 h p.i., but the amount fromUSFO-infected cells (lane 8) was twofold less than that fromthe wild type (lane 9). This result was observed in severalrepeated experiments in which the amount of late transcrip-tion from the mutant promoter was reduced two- to fivefoldcompared with that from the wild type. However, by 24 hp.i. the deficiency in USFO and wild-type mRNA productionwas less (lanes 11 and 12); this has been observed in severalexperiments. The results from the studies of the Elb andprotein IX promoters are shown in Fig. 4B. As expected,

B 6 hrs 12 hrs+Ara 12 hrs 24 hrsM......2.3.. 4 5 6. i .--1 1--. 12M 2 3i 4 5 6.17 8 9 1:10 ST 221

217-

20119C- up

CM

622 _527 4

404-- _

6 hrs 12 hrs+Ara

2 3 .4 5 6

- 205I- 195

12 hrs 24 hrs7-8- r-1 .--

7 8 9 10 11 1 2

-441

FIG. 4. Steady-state viral mRNA levels in wild-type- and mu-tant-infected cells. Cells infected with wild-type, USFO, and USFO/CAAT viruses were harvested at 6, 12, and 24 h p.i. All panels showdata derived from a single experiment and a single autoradiographicexposure. Below each panel is diagrammed the structure of theriboprobe sequences synthesized from the plasmid and the adeno-virus sequences with which they are expected to hybridize (seetext). (A) Sequences protected by the leader 3-specific probe; (B)those sequences protected by a probe specific for protein IX andElb; (C) those sequences corresponding to IVa2. Markers (M) areend-labeled fragments of MspI-digested pBR322. Lanes 1, 4, 7, and10, cells infected with USFO/CAAT; lanes 2, 5, 8, and 11, cellsinfected with USFO; lanes 3, 6, 9, and 12, cells infected with wildtype. Quantitation of the radioactive bands was performed bytwo-dimensional beta-emission spectroscopy of the dried gel, usinga Betagen Betascope 603 blot analyzer.

I

904opm

::; .:. .- iiillimilij-0 ,r- f- :;i.;; m.,m ol

VOL. 64, 1990 5855

5856 REACH ET AL.

sequences corresponding to expression from the Elb pro-moter (the band labeled 195), can be detected at 6 h p.i., at12 h p.i. in the presence of AraC, and at 24 h p.i. (the183-nucleotide protected band was omitted from the autora-diograph [see diagram]). There was no difference betweenthe mutant and wild-type infections (compare lanes 2, 5, and8 with lanes 3, 6, and 9). These results serve as a control,showing that the two infections were established undersimilar conditions. The expression from the protein IXpromoter (band labeled 205) is also indistinguishable be-tween mutant and wild-type infections, and again this sug-gests that the establishment and time course of infection wassimilar in the two sets of cells. In the presence of AraC, nohybridizing material was visible, since this promoter is onlyactive after DNA replication. The apparent loss of RNAhybridizing at 24 h p.i. is explained by the use of 15-fold-lessmaterial, so that the relative differences between mutant andwild type for other species of RNA could be observed.The IVa2 promoter is divergent from the MLP, the start

sites of transcription are separated by 210 nucleotides, and itis expressed only after DNA replication (10). It was thoughtthat they share common promoter elements and that theUSF site was necessary to activate both promoters (42).However, unlike the situation with the MLP, IVa2 RNAexpression in the wild-type and USFO infections was identi-cal at 12 p.i. (Fig. 4C, lanes 8 and 9, band labeled 441). Againas expected, expression could not be detected at 6 h p.i. orin the presence of AraC (lanes 2 and 3, and lanes 5 and 6).The lower amount of IVa2 expression of USFO at 24 h (lane11) was not observed in other experiments and is notobserved in the double mutant infection discussed later.The results of the RNase protection experiments show a

subtle effect upon expression from the MLP. This suggeststhat the mutations present in USFO have affected the struc-ture and function of the MLP and they are consistent withthe idea that USF binding has been altered in vivo as well asin vitro. Although the differences in mRNA accumulationbetween the wild type and the mutant at the two times weresmall, the finding that late mRNA expression was nearlyequivalent at 24 h p.i. suggests that the USFO MLP isimpaired at early times, while later on both promoters arenearly equal in strength.

Viral DNA replication in mutant and wild-type infection.Decreased level of expression from the mutant MLP atintermediate times p.i. might occur if the template has notreplicated to the same extent as in the wild-type infection.DNA replication has been shown to increase MLP expres-sion (20, 52). Protein IX and IVa2 expression is an indirectmeasure of DNA replication, since they too depend uponDNA replication. Expression from these promoters wasequivalent in both USFO- and wild-type-infected cells at 12 hp.i. (Fig. 4B, lanes 8 and 9 and Fig. 4C, lanes 8 and 9),suggesting that a decrease in DNA replication is not respon-sible for the decrease in MLP activity. Direct measurementsof the rate of viral DNA replication in wild-type- andmutant-infected cells showed that they were similar (Fig. 5,rows WT and USFO). Direct measurement of the counts onthe filter at 12 h showed that they were within twofold of oneanother. Moreover, when the extent of hybridization to thefilters at each time point was plotted, the rate of increase wasidentical.Primer extension assays. To examine whether the mutation

in the MLP affects the choice of initiation sites for the majorlate and IVa2 transcripts, primer extensions were performedon cytoplasmic mRNAs obtained from cells infected for 18and 24 h with the mutant and wild-type viruses (Fig. 6). With

hours p.i2 12 15 18

WT

USFO

USFO/CAAT j 9 *

FIG. 5. DNA replication in wild-type (WT) and mutant virusinfection. A549 cells in monolayer culture were infected at 10 PFUper cell and harvested at the times indicated. DNA was extracted bya modification of the Hirt technique and examined by slot blot, usinglabeled adenovirus probe. Quantitation was as described in thelegend to Fig. 4.

the IVa2 primer (right side of Fig. 6), the two pairs ofdoublets were of the expected sizes for extension to the IVa2start sites and the quantities were equivalent in the twoinfections. The lanes corresponding to the MLP-specificprimer also show the expected extension products, althoughthe amounts from the mutant-infected cells were somewhatlower at both time points. Quantitation by densitometry ofthe MLP-specific bands from a lower exposure of the gelshows a less than twofold difference between the mutant andwild-type infections.

MARKER

m;..w."f

.s,

Start-sites -

Free Priners-

Major late Primer18h 24h

Ik

IZa2 PrimerlBh 24hmmI

t-Startsites

M. M.z, im,

,4 .1 T'

;Xz

A.

4..

FIG. 6. Primer extension analysis of cytoplasmic viral RNA.Cytoplasmic RNA isolated from infected cells, was hybridized toprimers specific for the major late and IVa2 transcription units, andthen extended by avian myeloblastosis virus reverse transcriptase.The extended products should be 36 bases long for the major latemRNAs and 55 and 57 for the IVa2 mRNAs. In the panel with majorlate primer, the samples were run in every other lane, while with theIVa2 primer, they were in adjacent lanes. The marker is a dideoxysequencing reaction to show sizes. WT, Wild type.

J. VIROL.

IN VIVO TRANSCRIPTION FROM ADENOVIRUS MLP

2 2 h r p.i.

ML ML

E2b E2b

FIG. 7. Transcription in isolated infected-cell nuclei. SpinnerHeLa cells were infected at a multiplicity of infection of 50 PFU per

cell for the 9-h infection and 20 for the 22-h infection. Nuclei wereisolated and, after incubation with [32P]UTP, RNA was isolated andhybridized to single-stranded DNA-containing filter slots as shownin panels C. Adenovirus sequences between the HindIll sites at bp11555 and bp 13636 were cloned in either orientation in M13mpl8 togive sequences complementary to the major late transcription unit(ML) or the E2b transcription unit. In the 9-h sample, panel Acorresponds to RNA from USFO-infected cells and panel B corre-sponds to wild-type-infected cells. The autoradiographic exposuretimes for the 9-h samples were 2 h for the MLP filter slots and 14 hfor the others. In the 22-h sample, panels A and B correspond towild-type-infected and USFO-infected cells, respectively. The 22-hsample autoradiographic exposure was 14 h.

The fact that both sets of messages start at their respectivenormal sites and are quantitatively similar suggests that themutations present in USFO do not alter the positioning of thepolymerase when initiating transcription in either direction.They also confirm the observations of the RNase experi-ments in showing that the total quantity of RNA made issimilar between the mutant and wild type at late times.Rate of transcription initiation at wild-type and mutant

MLPs. The subtle temporal effects of the mutation in theUSF binding site, observed in vivo, are most probablycaused by an alteration in the rate of transcription initiationat the MLP. Changes in promoter structure are unlikely tohave consequences for RNA processing, transport, or sta-bility. To demonstrate this unequivocally however, it isnecessary to measure transcriptional initiation by using a

nuclear run-on assay. Nuclei were isolated from infectedcells at 9 and 22 h p.i. and incubated with [32P]UTP, to allowpreviously initiated RNA polymerases to elongate. RNAwas isolated and hybridized to single-strand sequences spe-

cific for either the major late transcription unit or thecomplementary E2b transcription unit (Fig. 7). At 9 h p.i.,the ratio of counts hybridizing to the two strands, as mea-sured by two-dimensional beta-emission spectroscopy, isdifferent in the wild-type and mutant infections. In theexperiment shown, the MLP/E2b ratio was approximately16.4 in the wild type but only 5.3 in the mutant. In a secondexperiment, this threefold difference in ratios was againobserved. At late times, the ratio of hybridization is similarin the two infections, with the MLP-specific sequences beingin considerable excess, as expected at this stage of infection.The transcription initiation results thus agree with the

RNase protection assays in showing a temporal deficiency inthe functioning of the MLP at earlier times, which is absentat 22 h p.i.

8-

7 -o--WT

6- -*"-USFO- - - USFO-CCCAT

5 -

2-

0-

0 10 20 30Time (hours)

40 50

FIG. 8. Viral replication cycles. A549 cells in monolayer culturewere infected at a multiplicity of infection of 10 PFU per cell, andsamples were taken at intervals. Virus was titrated by fluorescentfocus assay.

Possible role of other promoter elements. One plausibleinterpretation of the results described above is that it ispossible to eliminate the binding of USF to the upstreampromoter element of the MLP without affecting expressionseverely. It is possible that in the absence of a functionalupstream element, another promoter element may compen-sate. As part of our comprehensive survey of the elementsimportant to MLP expression, we have investigated thepossible role of the upstream inverted CAAT sequence. Thiselement has been shown to bind a heterodimeric transcrip-tion factor, CP1, in vitro (3). Its role in in vitro transcriptionor transient transfection assays of MLP function suggestedthat it played a minor role (31, 40, 41). We chose to make achange in the CCAAT sequence at the central conservednucleotide, which is known to contact CP1 (3). The altera-tion changed the sequence to CCCAT. The mutation doesnot alter the appearance and number of plaques upon over-lap transfection. However, an MLP with both the mutantCCCAT and the USFO sequence produced plaques whichwere much smaller than the wild type and in which theinfected cells were morphologically distinct. The phenotypeof this mutant was examined in viral growth curves, DNAreplication kinetics, and accumulation of cytoplasmic RNA(Fig. 4, 5, and 8). There was a protracted eclipse period forthe double mutant compared with either single mutation orthe wild type, and the burst was lowered by some 10-fold at42 h p.i.The level of expression of the MLP from the double

mutant infection was measured by a T2 RNase protectionassay. These results were obtained in parallel infections tothose described previously in Fig. 4. While expression fromthe E1B, protein IX, and IVa2 promoters was very similar tothat seen with the USFO and mutant infections (Fig. 4B andC), expression from the MLP was severely affected at both12 and 24 h p.i. (Fig. 4A, lanes 7 and 10). DNA replicationwas unaffected in the double mutant (Fig. 5, row USFO/CAAT), although the input level of DNA was considerablyelevated (see the visible hybridizing band at the 2-h timeinterval in the double mutant). This is caused by an inabilityto titrate the virus accurately because of the small plaquesize, which would lead to an underestimate of the trueinfectious titer. Analysis of RNA production by nuclearrun-on assay and of viral protein synthesis show that the

9 hr p.i.A

B

A

_0 __-B

CC

M13 ML ML

Actin E2b E2b..... I,,,

VOL. 64, 1990 5857

5858 REACH ET AL.

double mutant infection is considerably delayed, commen-surate with the delay in the replication cycle (data notshown).Taken together, the results with the double mutant show

that while mutation in either upstream element alone isinsufficient to affect expression from the MLP severely,mutations in both are highly deleterious to promoter func-tion. It is also worth reemphasizing that effects upon MLPfunction do not have any consequences for the divergentIVa2 promoter.

DISCUSSION

Ever since the demonstration that the adenovirus MLPcan be specifically transcribed in crude cellular extracts (34,54), the MLP has remained one of the primary models for theinvestigation of the structure and function of eucaryoticpromoters. Results from both in vitro and in vivo studies hadsuggested that the MLP is a very simple promoter, contain-ing a single upstream binding site which binds a cellulartranscription factor necessary for activation (5, 48). Interac-tion of this factor with the general transcription factor TFIIDat the TATA box is sufficient to give maximal levels oftranscription in vitro (48). As mentioned in the introductionhowever, the regulatory circuits of which the MLP forms apart, are not reproduced in the in vitro systems.An important way to examine the roles of promoter

elements in vivo is to make mutations in them by site-directed mutagenesis and to test the phenotypic conse-quences in the correct genomic context in the intact virus.Although this is a more laborious method than the customarytransient expression assay (40, 41), the results obtained are atrue reflection of the consequences for the viral transcriptioncycle, since both structural and temporal controls on viralgene expression are intact. The replacement system we havedeveloped especially for this mutational survey (Fig. 1),allows specific bases to be mutated and the easy replacementof wild type by mutant MLP regions in the correct genomiclocation within the intact virus. This method allows a morespecific and rapid mutational survey than the bisulfite muta-genesis protocol used previously (1).The results of the replacement of the wild-type USF-

binding site by a 4-base mutation were surprising. As ex-pected, oligonucleotides containing this mutation were un-able to bind USF in a gel mobility shift assay (Fig. 2) and thesequence was unable to compete for transcription factors inin vitro assays (Fig. 3). Furthermore, experiments withtransient expression vectors, in which the chloramphenicolacetyltransferase gene was under the control of the MLP,showed that the USF mutant sequence was 20-fold lessactive than the wild type (data not shown). On the otherhand, despite these hallmarks of transcriptional incompe-tence, virus containing this mutation were easy to obtain anddisplayed a gross replicative phenotype similar to the wildtype (Fig. 8). On more detailed examination, there was asubtle but reproducible difference in activity of the MLP ofUSFO and wild type. USFO mRNA accumulation (Fig. 4)was lowered some two- to threefold from that of the wildtype at 12 h p.i., but at 24 h p.i., this difference wasconsiderably less (varying in different experiments from a1.5-fold decrease to near equivalence). Nuclear run-on ex-periments (Fig. 7) showed that the transcription rate at 22 hp.i. was indistinguishable between the mutant and the wildtype, while at 9 h p.i., expression from the mutant wasreduced some three- to fourfold. Taken together, these datasuggest that USF is involved in activation only during a

portion of the infection, but by 18 h the MLP has becomeindependent of USF. This interpretation differs from one inwhich the mutant MLP is defective throughout the infection.The MLP has been shown to be transactivated early by theimmediate-early gene product Ela (43), possibly through theTATA box (27). If, on the other hand, Ela transactivation ofthe MLP were dependent on USF binding, the early defect inUSFO expression could be explained, implying a novel roleof USF in Ela transactivation.A possible explanation for the decreased level of expres-

sion from the mutant MLP at intermediate times p.i. wouldbe that the template has not replicated to the same extent asin the wild-type infection. To address this possibility, DNAreplication was measured directly. The results indicate thatat 12 h p.i. DNA replication is about twofold lower inUSFO-infected cells compared with wild-type infected cells.However, protein IX and IVa2 expression, which are com-pletely dependent on DNA replication, were equivalent inboth USFO- and wild-type-infected cells at 12 h p.i., asmeasured by nuclear run-on and RNase T2 assays. Thereforeit is likely that the twofold difference observed in DNAreplication is not significant and does not account for re-duced MLP transcription of USFO.

Regardless of the interpretation of the small differences intranscription observed between the mutant and wild type atintermediate times p.i., MLP expression in the virus at latetimes was not dependent on USF binding for activity. Thisapparent incongruity between the in vitro and in vivo resultscould arise from a number of mechanistic possibilities asfollows. (i) Transcription at late times from the viral genomecan occur at high efficiency with only the general transcrip-tional machinery, including factor TFIID binding to theTATA box. (ii) While binding of USF in vitro is notobserved, the binding constant in vivo is still sufficiently highthat adequate binding takes place. (iii) Some other elementcompensates for the lack of the USF-binding site under theculture conditions employed. Candidates for such elementsinclude the upstream CP1-binding site (3) and the bindingsites of the newly described factor DEF (20, 28). As wediscuss below, the third possibility seems the most likely,and specifically we suggest that CP1 may compensate for thelack of USF binding.

It has been shown that the MLP contains an invertedbinding site for the transcription factor CP1 (3). Previous invitro and in vivo studies have suggested that this normallyplays little role in the attainment of maximal levels oftranscription from the MLP. Our results also show that asingle point mutation in the CCAAT sequence can be incor-porated into virus with no observable phenotype (results notshown). But, as we show (Fig. 8), virus containing both theUSFO mutation and CCCAT mutation was severely crippled.Transcription from the MLP containing the double mutationwas decreased about 15-fold at both 12 and 24 h p.i. (Fig.4A). The results suggest that in the absence of USF binding,the CCAAT sequence plays an important role in MLPexpression. Thus the MLP, like many other promoters, maydisplay functional redundancy of upstream promoter ele-ments. A suggestion that this might be the case came fromtransient transfection assays with plasmids with deletions inthe upstream region (40). Deletions encompassing both theUSF- and CP1-binding sites were considerably more defi-cient in expression than those encompassing one or the otherbinding site. The suggested functional redundancy may beaccompanied by mechanistic heterogeneity as well, if CP1and USF exert their transcriptional transactivation effectsvia different mechanisms (for a discussion, see reference 51).

J. VIROL.

IN VIVO TRANSCRIPTION FROM ADENOVIRUS MLP

It remains to be seen whether or not the virus uses the twodifferent mechanisms in different cellular environments. Sofar we have not been able to show cell type specificity forany of the single mutations examined, although the growthdeficiency of the double mutant is much more marked in 293cells derived from human embryonic kidney than in lungcarcinoma A549 cells (data not shown).

Recently it has been shown that the inverted CAAT boxcan act as a terminator for transcription originating upstreamof the MLP (8, 9). One possible interpretation of the pheno-type of the double mutation is that such termination does notoccur in the absence of the binding of both transcriptionfactors, whereas the presence of one or the other is suffi-cient. Unimpeded transcription might inhibit transcriptionfrom the MLP of the double mutant. Further work isnecessary to determine whether transcription upstream ofthe MLP is detectable in the double mutant.

Previous results (42) have suggested that the USF-bindingsite plays a role in the expression of the divergent IVa2transcription unit whose start site is located 210 basesupstream from that of the major late transcription start site.However in our results with both the USFO and doublemutants (Fig. 4), IVa2 expression was not affected, suggest-ing that the virus employs neither binding site for transcrip-tion control of the IVa2 promoter. The results also show(contrary to results obtained in vitro [42]) that simple com-petition for transcription initiation is not sufficient for regu-lating the stoichiometry of the divergent promoters.The rationale for studying mutations in the MLP in the

context of the intact virus and in the correct genomiclocation was that the previous in vivo and in vitro studieshad been unable to reproduce the known temporal control ofthe promoter. Our results have revealed that conclusionsdrawn from in vitro studies are not always reproduced invivo. In addition to the results reported here, mutations inother MLP'elements also yield results that differ from thoseobtained in vitro. For example, single base pair changes atpositions -27 and -30 in the TATA box, known to reducetranscription up to 10-fold (7) and to affect the ratio of MLPand IVa2 expression (42), also function normally in virus anddisplay unaltered mRNA accumulation and transcriptionstart sites (unpublished data). Thus we may conclude thatexamining mutations in the MLP in their natural environ-ment forms an integral part of the structural analysis of thismodel promoter, not only revealing previously unsuspectedfunctional redundancy but also acting as a necessary test ofthe biological validity of conclusions drawn from in vitrostudies.

ACKNOWLEDGMENTS

We thank Scott Zeitlin for unfailing help, good humor, andencouragement, and the virology group at Columbia for constructivecriticism. We also thank the following for materials and advice:Vincent Racaniello, Eric Moss, and Roy Bohenzky for considerablehelp, Yumi Kasai and Jane Flint for the primers used in the primerextension assays, Polly Gregor for antiserum to USF and forshowing that the USFO oligonucleotide did not bind purified USF,and Michelle Sawadogo for advice concerning the structure of theupstream promoter element sequence. David Shore introduced us totechniques of band shifting and provided yeast whole-cell extract.

This work was supported at Columbia University by PublicHealth Service grant GM38125 from the National Institute ofGeneral Medical Sciences awarded to Saul Silverstein and by a grantto the Columbia Comprehensive Cancer Center, CA13696; at Rock-efeller University, it was supported by grant JFRA-235 from theAmerican Cancer Society and by Public Health Service grant

CA48707-10 from the National Institutes of Health awarded toL.E.B.

LITERATURE CITED1. Brunet, L. J., L. E. Babiss, C. S. H. Young, and D. R. Mills.

1987. Mutations in the adenovirus major late promoter: effectsupon viability and transcription during infection. Mol. Cell.Biol. 7:1091-1100.

2. Carthew, R. W., L. A. Chodosh, and P. A. Sharp. 1987. Themajor late transcription factor binds to and activates the mousemetallothionein 1 promoter. Genes Dev. 1:973-980.

3. Chodosh, L. A., A. S. Baldwin, R. W. Carthew, and P. A. Sharp.1988. Human CCAAT-binding proteins have heterologous sub-units. Cell 53:11-24.

4. Chodosh, L. A., S. Buratowski, and P. A. Sharp. 1989. A yeastprotein possesses the DNA binding properties of the adenovirusmajor late transcription factor. Mol. Cell. Biol. 9:820-822.

5. Chodosh, L. A., R. W. Carthew, and P. A. Sharp. 1986. A singlepolypeptide possesses the binding and transcription activities ofthe adenovirus major late transcription factor. Mol. Cell. Biol.6:4723-4733.

6. Coen, D. M., S. P. Weinheimer, and S. L. McKnight. 1986. Agenetic approach to promoter recognition during trans inductionof viral gene expression. Science 234:53-59.

7. Concino, M. F., F. L. Lee, J. P. Merryweather, and R. Wein-mann. 1984. The adenovirus major late promoter TATA box andinitiation site are both necessary for transcription in vitro.Nucleic Acids Res. 12:7423-7433.

8. Connelly, S., and J. L. Manley. 1989. RNA polymerase IItranscription termination is mediated specifically by proteinbinding to a CCAAT box sequence. Mol. Cell. Biol. 9:5254-5259.

9. Connelly, S., and J. L. Manley. 1989. A CCAAT box sequencein the adenovirus major late promoter functions as part of anRNA polymerase II termination signal. Cell 57:561-571.

10. Crossland, L. D., and H. J. Raskas. 1983. Identification ofadenovirus genes that require template replication for expres-sion. J. Virol. 46:737-748.

11. Dignam, J. D., R. M. Lebowitz, and R. G. Roeder. 1983.Accurate transcription initiation by RNA polymerase II in asoluble extract from isolated mammalian nuclei. Nucleic AcidsRes. 11:1475-1489.

12. Dynan, W. S., and R. Tjian. 1985. Control of eukaryoticmessenger RNA synthesis by sequence-specific DNA bindingproteins. Nature (London) 316:774-778.

13. Feinberg, A. P., and B. Vogelstein. 1983. A technique forradiolabelling DNA restriction endonuclease fragments to highspecific activity. Anal. Biochem. 132:6-13.

14. Giard, D. J., S. A. Aaronson, G. J. Todaro, P. Arnstein, J. H.Kersey, H. Dosik, and W. P. Parks. 1973. In vitro cultivation ofhuman tumors: establishment of cell lines derived from a seriesof solid tumors. J. Natl. Cancer Inst. 51:1417-1423.

15. Graham, F. L., and A. J. van der Eb. 1973. A new technique forthe assay of infectivity of human adenovirus type 5 DNA.Virology 52:456-467.

16. Hen, R., P. Sassone-Corsi, J. Corden, M. P. Gaub, and P.Chambon. 1982. Sequences upstream from the TATA box are

required in vivo and in vitro for efficient transcription from theadenovirus serotype 2 major late promoter. Proc. Natl. Acad.Sci. USA 79:7132-7136.

17. Hernandez, N., and W. Keller. 1983. Splicing of in vitro synthe-sized messenger RNA precursors in HeLa cell extracts. Cell35:89-99.

18. Herr, W., and Y. Gluzman. 1985. Duplications of a mutatedsimian virus 40 enhancer restore its activity. Nature (London)313:711-714.

19. Hirt, B. 1967. Selective extraction of polyoma DNA frominfected mouse cell cultures. J. Mol. Biol. 26:365-369.

20. Jansen-Durr, P., G. Mondesert, and C. K6dinger. 1989. Repli-cation-dependent activation of the adenovirus major late pro-moter is mediated by the increased binding of a transcriptionfactor to sequences in the first intron. J. Virol. 63:5124-5132.

21. Jones, J., P. Rigby, and E. Ziff. 1988. Trans-acting protein

VOL. 64, 1990 5859

5860 REACH ET AL.

factors and the regulation of eukaryotic transcription: lessonsfrom studies on DNA tumor viruses. Genes Dev. 2:267-281.

22. Kovesdi, I., R. Reichel, and J. R. Nevins. 1986. Identification ofa cellular transcription factor involved in Ela trans-activation.Cell 45:219-228.

23. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesiswithout phenotypic selection. Proc. Natl. Acad. Sci. USA82:488-492.

24. Lawrence, W. C., and H. S. Ginsberg. 1967. Intracellularuncoating of type 5 adenovirus deoxyribonucleic acid. J. Virol.1:851-867.

25. Lee, R. F., M. F. Concino, and R. Weinmann. 1988. Geneticprofile of the transcriptional signals from the adenovirus majorlate promoter. Virology 165:52-56.

26. Lennard, A. C., and J. M. Egly. 1987. The bidirectional up-stream element of the adenovirus-2 major late promoter binds asingle monomeric molecule of the upstream factor. EMBO J.6:3027-3034.

27. Leong, K., L. Brunet, and A. J. Berk. 1988. Factors responsiblefor the higher transcriptional activity of extracts of adenovirus-infected cells fractionate with the TATA box factor. Mol. Cell.Biol. 8:1765-1774.

28. Leong, K., W. Lee, and A. J. Berk. 1990. High-level transcrip-tion from the adenovirus major late promoter requires down-stream binding sites for late-phase-specific factors. J. Virol.64:51-60.

29. Lillie, J. W., and M. R. Green. 1989. Transcription activation bythe adenovirus Ela protein. Nature (London) 338:39-44.

30. Logan, J., and T. Shenk. 1986. In vivo identification of sequenceelements required for normal function of the adenovirus majorlate transcriptional control region. Nucleic Acids Res. 14:6327-6335.

31. Maity, S. N., P. T. Golumbek, G. Karsenty, and B. de Crom-brugghe. 1988. Selective activation of transcription by a novelCCAAT binding factor. Science 241:582-585.

32. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

33. Maniatis, T., S. Goodbourn, and J. A. Fischer. 1987. Regulationof inducible and tissue-specific gene expression. Science 236:1237-1245.

34. Manley, J. A., A. Fire, A. Cano, P. A. Sharp, and M. L. Gefter.1980. DNA-dependent transcription of adenovirus genes in asoluble whole cell extract. Proc. Natl. Acad. Sci. USA 77:3855-3859.

35. Mansour, J. L., T. Grodzicker, and R. Tjian. 1986. Downstreamsequences affect transcription initiation from the adenovirusmajor late promoter. Mol. Cell. Biol. 6:2684-2694.

36. Marsh, J. L., M. Erfle, and E. J. Wyke. 1984. The pIC plasmidand phage vectors with versatile sites for recombinant selectionby insertional inactivation. Gene 32:481-485.

37. McKnight, S., and R. Tjian. 1986. Transcriptional selectivity ofviral genes in mammalian cells. Cell 46:795-805.

38. Melton, D. A., P. A. Kreig, M. R. Rebagliatti, T. Maniatis, K.Zinn, and M. R. Green. 1984. Efficient in vitro synthesis ofbiologically active RNA and RNA hybridization probes fromplasmids containing a bacteriophage SP6 promoter. NucleicAcids Res. 12:7035-7070.

39. Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation inmammalian cells by sequence-specific DNA binding proteins.Science 245:371-378.

40. Miyamoto, N. G., V. Moncollin, J. M. Egly, and P. Chambon.1985. Specific interaction between a transcription factor and theupstream element of the adenovirus-2 major late promoter.EMBO J. 4:3563-3570.

41. Miyamoto, N. G., V. Moncollin, M. Wintzerith, R. Hen, J. M.Egly, and P. Chambon. 1984. Stimulation of in vitro transcrip-tion by the upstream element of the adenovirus 2 major latepromoter involves a specific factor. Nucleic Acids Res. 12:8779-8799.

42. Natarajan, V., M. J. Madden, and N. P. Salzman. 1985. Positiveand negative control sequences within the distal domain of theadenovirus IVa2 promoter overlap with the major late promoter.J. Virol. 55:10-15.

43. Nevins, J. R. 1981. Mechanism of activation of early viraltranscription by the adenovirus Ela gene product. Cell 26:213-220.

44. Philipson, L. 1961. Adenovirus assay by fluorescent cell-count-ing procedure. Virology 15:263-268.

45. Ptashne, M. 1988. How transcriptional activators work. Nature(London) 335:683-689.

46. Safer, B., R. B. Cohen, S. Garfinkel, and J. A. Thompson. 1988.DNA affinity labeling of adenovirus type 2 upstream promotersequence-binding factors identifies two distinct proteins. Mol.Cell. Biol. 8:105-113.

47. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

48. Sawadogo, M., and R. G. Roeder. 1985. Interaction of a gene-specific transcription factor with the adenovirus major latepromoter upstream of the TATA box. Cell 43:165-175.

49. Sawadogo, M., and R. G. Roeder. 1985. Factors involved inspecific transcription by human RNA polymerase II: analysis bya rapid and quantitative in vitro assay. Proc. Natl. Acad. Sci.USA 82:4394-4398.

50. Shore, D., D. J. Stillman, A. H. Brand, and K. A. Nasmyth.1987. Identification of silencer binding proteins from yeast:possible roles in SIR control and DNA replication. EMBO J.6:461-467.

51. Taylor, I. C. A., and R. E. Kingston. 1990. Factor substitution ina human HSP70 gene promoter: TATA-dependent and TATA-independent interactions. Mol. Cell. Biol. 10:165-175.

52. Thomas, P. G., and M. B. Mathews. 1980. DNA replication andthe early to late transition in adenovirus infection. Cell 22:523-533.

53. Volkert, F. C., and C. S. H. Young. 1983. The genetic analysisof recombination using adenovirus overlapping terminal DNAfragments. Virology 125:175-193.

54. Weil, P. A., D. S. Luse, J. Segall, and R. G. Roeder. 1979.Selective and accurate initiation of transcription at the Ad2major late promoter in a soluble system dependent on purifiedRNA polymerase II and DNA. Cell 18:469-484.

55. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

56. Yu, Y.-T., and J. L. Manley. 1984. Generation and functionalanalysis for base-substitution mutants of the adenovirus 2 majorlate promoter. Nucleic Acids Res. 12:9309-9321.

57. Zagursky, R. J., K. Baumeister, N. Lomax, and M. L. Berman.1985. Rapid and easy sequencing of large linear double-strandedDNA and supercoiled plasmid DNA. Gene Anal. Tech. 2:89-94.

J. VIROL.