The role of sterilization in the cytocompatibility of titania nanotubes

Lingzhou Zhao a,b, Shenglin Mei a, Wei Wang a, Paul K. Chu b,*, Zhifen Wu a,**, Yumei Zhang a,***

a School of Stomatology, The Fourth Military Medical University, 145 West Changle Road, Xi’an 710032, Chinab Department of Physics & Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong, China

a r t i c l e i n f o

Article history:Received 16 November 2009Accepted 26 November 2009Available online 21 December 2009

Keywords:NanotopographySterilizationOsteoblastCytocompatibilityReal-time PCR

a b s t r a c t

Titiania nanotubes have large potential in medical implant applications but their tissue compatibility isstill controversial. Since the sterilization methods may impact the biocompatibility of titania nanotubesand be the source of the controversy, we investigate the influence of three commonly used sterilizationmethods, autoclaving, ultraviolent irradiation and ethanol immersion, on the cytocompatibility of titaniananotubes. Two titania nanostructures, namely nanonets with an average pore diameter of 25 nm andnanotubes with an average diameter of 80 nm, are used in this study. The results show that the steril-ization methods significantly affect the cytocompatibility of these titania surfaces. UV and ethanolsterilization give rise to a higher surface free energy inducing higher initial cell adhesion and prolifer-ation compared to autoclaving, whereas UV irradiation produces the best cell functions includingadhesion, proliferation, as well as differentiation represented by related gene expressions. The cyto-compatibility results obtained from the nanoscale surfaces are compared to those acquired from thepolished surface demonstrating the significant effects. Our results suggest that the sterilization processplays an important role in the observed cytocompatibility of titania nanotubes and may be the reason forthe controversial results so far. UV sterilization is found to be the best method from the viewpoint ofsurface contamination elimination.

� 2009 Elsevier Ltd. All rights reserved.

1. Introduction

It is widely believed that the surface topography of biomedicalimplants plays a critical role in osseointegration and clinicalsuccess. Many studies have been conducted on the influence of thesurface morphology on the osteoblast behavior and subsequentbone formation. Recently, it has been suggested that a surfacenanotopography may facilitate interactions with bone cells in lightof that bone tissues are composed of nanoscale extracellular matrix[1–3]. Among the common surface nanotopographies, the titaniananotubular surface has drawn much attention. The materials canbe fabricated easily by simple and economical anodization and thenanotube dimensions can be precisely controlled [4–6]. It has beenreported that titania nanotubes can modulate the functions ofmany kinds of cells such as osteoblast cells [5,7–10], mesenchymalstem cells [4,11–13] and endothelial cells [13,14]. Furthermore,

these nanotubes can serve as carriers for drugs such as growthfactors [10] and anti-bacterial agents [15].

Unfortunately, the biological performance of titania nanotubeshas been found to vary and is not well understood. It has beenreported that titania nanotubes with different tube sizes of 30–100 nm [5], 50 nm [9], 70 nm [7–10], and 80 nm [8] can enhanceosteoblast cell functions. However, Park et al. have reportedopposite results that only nanotubes with a smaller size of 15 nmstrongly enhance cell activities and cell functions deteriorate withincreasing tube sizes and are even severely impaired on nanotubeswith diameters larger than 50 nm [6]. Conflicting results have alsobeen reported for mesenchymal stem cells [4,11,12,16]. Popat et al.have reported higher adhesion, proliferation, ALP activity, and bonematrix deposition of marrow stromal cells on 80 nm titania nano-tubes compared to flat titanium surfaces [11]. Oh et al. have sug-gested that small (30 nm) nanotubes promote mesenchymal stemcell adhesion without noticeable differentiation, whereas larger(70–100 nm) nanotubes elicit dramatic stem cell elongation whichinduces cytoskeletal stress and selective differentiation into oste-oblast cells [12]. These results appear to contradict those reportedby Park et al. that a smaller tube size (15 nm) enhances cell activ-ities while nanotubes with a larger tube diameter (50–100 nm)impair cell functions and induce a higher rate of cell apoptosis [4].

* Corresponding author. Tel.: þ852 27887724; fax: þ852 27889549.** Corresponding author. Tel.: þ86 29 8477 6093; fax: þ86 29 8477 6096.*** Corresponding author. Tel.: þ86 29 8477 6090; fax: þ86 29 8477 6096.

E-mail addresses: paul.chu@cityu.edu.hk (P.K. Chu), wzfwxy@fmmu.edu.cn (Z.Wu), wqtzym@fmmu.edu.cn (Y. Zhang).

Contents lists available at ScienceDirect

Biomaterials

journal homepage: www.elsevier .com/locate/biomateria ls

0142-9612/$ – see front matter � 2009 Elsevier Ltd. All rights reserved.doi:10.1016/j.biomaterials.2009.11.103

Biomaterials 31 (2010) 2055–2063

Before biomedical implants containing titania nanotubes can beadopted clinically, their cytocompatibility must be better under-stood. One of the possible reasons for the inconsistent results maybe the choice of the sterilization methods when studying thebiocompatibility of titania nanotubes. In most reported studies,autoclaving was used [5–7,9,17,18], but ultraviolent (UV) irradiation[14] and ethanol immersion [4,8,11,14] were adopted as well. Thesterilization methods have been reported to impact the surfaceproperties of biomaterials consequently affecting cell behavior [19–22]. Recently, there have been reports showing that UV irradiationcan dramatically enhance the bioactivity of titanium [23–27]. It isour belief that the sterilization methods may severely influence thebioactivity of titania nanotubes and the different sterilizationmethods used in the various studies may account for the conflictingbiological behavior of titania nanotubes. This study aims at inves-tigating systematically the influence of the sterilization methods onthe cytocompatibility of titania nanotubes as an effort to resolve thecurrent controversy.

2. Materials and methods

2.1. Specimen preparation

Pure titanium (10�10�1 mm3) was used as substrates for anodization. Afterultrasonic cleaning, the substrates were anodized for 30 min in an electrolyte con-taining 0.5 wt% hydrofluoric acid using a DC power supply with a platinum electrodeas the cathode. Two typical kinds of nanosurfaces were obtained by tuning thepotentials in the range of 1–20 V. After anodization, the samples were immediatelyrinsed with deionized water. Three types of titanium surfaces, namely nanonettopography formed at 5 V, nanotubular topography formed at 20 V (Fig. 1) andconventionally polished surface were used to study the influence of sterilization onthe surface characteristics and cell/material interactions. Three sterilizationprocesses used frequently in previous studies, namely autoclaving, ultraviolentirradiation and ethanol immersion, were adopted in this study. The sterilization timewas 30 min.

2.2. Surface characterization

Field emission scanning electron microscopy (FE-SEM, JEOL JSM-6460) wasutilized to observe the surface topography of the prepared specimens. The crystal-linity of the samples was evaluated by X-ray diffraction (XRD) using a SiemensD-500 diffractometer. Contact angle measurements were carried out by the sessile-drop method on a contact angle measuring system (EasyDrop Standard, KRUSS,Germany) at room temperature. Two different liquids, ultra-pure water and diio-domethane, were employed in the contact angle measurements. The contact angle q

was measured by analyzing the drop shape using the DSA1 software (KRUSS). Thecontact angles measured using the two liquids were used to calculate the free energy(SFE) of each surface [28].

2.3. Protein adsorption assay

A 300 ml protein solution droplet (Bovine serum albumin fraction V, 1 mg/ml)was pipetted onto each specimen. After incubation for 1 h at 37 �C, the disks weretransferred to a new 24-well plate (one disk per well) and washed with 1000 ml PBSthree times. 500 ml of 1% sodium dodecyl sulfate (SDS) solution was added to thesewells and shaken for 1 h to detach proteins from the disk surfaces. The proteinconcentration in the collected SDS solutions was determined using a MicroBCAprotein assay kit (Pierce).

2.4. Cell culture

Primary rat calvarial osteoblasts were obtained using a previous reportedprocedure [28] with slight modifications. Succinctly speaking, after removing thefibrous layer mechanically, the parietal and frontal calvarial bone of one day oldSprague–Dawley rats were digested by collagenase (Gibco) for 60 min to extract theosteoblasts. Cells were cultured in Dulbecco’s minimum essential medium (DMEM,Gibco) supplemented with 10% bovine calf serum (BCS, Gibco) and 1% penicillin/streptomycin and incubated in a humidified atmosphere of 5% CO2 at 37 �C. Passages2–5 were used.

2.5. Cell adhesion

Osteoblasts were seeded on the specimens at a density of 17 500 cells/cm2 andallowed to attach for 30, 60 and 120 min. At each prescribed time point, the non-adherent cells were removed by rinsing with a phosphate buffered saline (PBS)

solution. Cells were fixed and stained with 40 ,60-diamidino-2-phenylindole (DAPI).The cell numbers in five random fields were counted under a fluorescencemicroscope.

2.6. Lactate dehydrogenase activity assay

The lactate dehydrogenase (LDH) activity was used as an indexof cytotoxicity in theculture media. After 24 h, the culture media was collected and centrifuged andthe supernatant was used for the LDH activity assay. The LDH activity was determinedspectrophotometrically according to the manufacturer’s instructions.

2.7. Cell proliferation

A 1 ml cell suspension was seeded on each specimen at a density of 2 � 104 cells/ml and then cultured in DMEM with 10% BCS. After 1, 4 and 7 days, cell proliferationwas assessed using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT) assay [28]. In brief, at each prescribed time point, the specimens were gentlyrinsed three times with PBS and transferred to a new 24-well plate. The MTT solutionwas added and the specimens were incubated at 37 �C to form formazen. The for-mazen was then dissolved using dimethyl sulfoxide (DMSO) and the optical density(OD) was measured at 490 nm using a spectrophotometer (Bio-tek).

2.8. Intracellular total protein content and alkaline phosphatase activity

The cells were seeded on the substrates in 24-well plates at a density of2�104 cells/well. After 7 days of culture, the cells were washed three times with PBSand lysed in 0.1% Triton X-100 using four standard freeze-thaw cycles. The alkalinephosphatase (ALP) activities of the samples were determined by a colorimetric assayusing an ALP reagent containing p-nitrophenyl phosphate (p-NPP) as the substrate.The absorbance of p-nitrophenol formed was measured at 405 nm. The intracellular

Fig. 1. Nanonet-like and nanotubular topography formed at 5 V and 20 V.

L. Zhao et al. / Biomaterials 31 (2010) 2055–20632056

total protein content was determined using the MicroBCA protein assay kit and theALP activity was normalized to the total protein content.

2.9. Collagen secretion assay

Collagen secretion on the specimens was quantified using a method describedbefore [29,30] that was modified slightly. Cells with a concentration of 2 � 104/wellwere grown for 7 days and then washed three times in PBS and fixed in 4% para-formaldehyde. Following three washes with PBS, the constructs were stained forcollagen deposition in a 0.1% solution of Sirius Red (Sigma) in saturated picric acid

for 18 h. After washing with 0.1 M acetic acid until no more red color appeared,images were taken. For the quantitative analysis, the stain on the specimens wasmixed with 500 ml of a destain solution (0.2 M NaOH/methanol 1:1) for 15 min. Theoptical density at 540 nm was then measured using a spectrophotometer.

2.10. Mineralization assay

Matrix mineralization by primary osteoblasts was evaluated by Alizarin redstaining as previously described [30]. After incubation for 7 days, the cells werewashed three times with PBS and then fixed with 75% ethanol for 1 h. The cellcultures were stained with 40 mM Alizarin Red in distilled water (pH 4.2) for 10 minat room temperature. Subsequently, the cells were washed five times with distilledwater and images were acquired. For the quantitative analysis, the stain was dis-solved in 10% cetylpyridinum chloride in 10 mM sodium phosphate (pH 7) and theabsorbance values were measured at 620 nm.

2.11. Osteogenesis-related gene expressions

The expressions of osteogenesis-related genes were analyzed using the real-time polymerase chain reaction (Real-time PCR). The cells were seeded witha density of 2 � 104 cells/well and cultured for 3 and 10 days. The total RNA wasisolated using the TRIzol reagent (Gibco). 1 mg RNA from each sample was reversedtranscribed into complementary DNA (cDNA) using the PrimeScript� RT reagent kit(TaKaRa). The forward and reverse primers for the selected genes are listed in Table 1.Expressions of the osteogenesis-related genes including integrin-b1 (ITG), runt-related transcription factor 2 (RUNX2), ALP, bone morphogenetic protein-2 (BMP-2),osteopontin (OPN) and osteocalcin (OCN) were quantified using Real-time PCR (Bio-Rad iQ�5 Multicolor Real-Time PCR Detection System) with SYBR� Premix Ex� TaqII (TaKaRa). Data analysis was carried out using the iQ�5 Optical System SoftwareVersion 2.0 (Bio-Rad). The relative expression levels for each gene of interest werenormalized to that of the housekeeping gene GAPDH.

2.12. Statistical analysis

The data were analyzed using SPSS 14.0 software (SPSS, USA). A one-way ANOVAfollowed by a Student–Newman–Keuls post hoc test was used to determine the levelof significance p< 0.05 was considered to be significant and p< 0.01 was consideredto be highly significant.

3. Results

3.1. Surface characterization

Titanium specimens are occasionally found to discolor afterautoclave sterilization but no discoloration is typically observedafter UV irradiation or ethanol immersion. The measured contactangles and calculated surface free energies are displayed in Fig. 2.Sterilization by UV irradiation or ethanol results in smaller watercontact angles and higher values of total and polar components ofthe surface free energy compared to autoclaving, whereas sterilization

Table 1Primers used for real-time PCR.

Gene Forward primer sequence (50–30) Reverse primer sequence (50–30)

ITG TGCGATAGGTCCAACGGCTTA CATTTGTCGCTACGCATGGAACRUNX2 CCATAACGGTCTTCACAAATCCT TCTGTCTGTGCCTTCTTGGTTCALP AACGTGGCCAAGAACATCATCA TGTCCATCTCCAGCCGTGTCBMP-2 CAACACCGTGCTCAGCTTCC TTCCCACTCATTTCTGAAAGTTCCOPN TCCTGCGGCAAGCATTCTC CTGCCAAACTCAGCCACTTTCAOCN GGTGCAGACCTAGCAGACACCA AGGTAGCGCCGGAGTCTATTCAGAPDH GGCACAGTCAAGGCTGAGAATG ATGGTGGTGAAGACGCCAGTA

Fig. 2. Contact angles (deg.) (A) and values of surface free energy (mJ/m2). (B) ofspecimens after different sterilization methods.

Fig. 3. Amount of adsorbed proteins on titania surfaces after different sterilizationmethods.

L. Zhao et al. / Biomaterials 31 (2010) 2055–2063 2057

by UV irradiation and ethanol leads to similar water contact anglesand surface free energy. After sterilization by UV or ethanol, theanodized surfaces possess much higher surface energy than thepolished one, but this difference is not noticeable after autoclavesterilization.

3.2. Protein adsorption

As shown in Fig. 3, no obvious difference can be observed onprotein adsorption among the various samples after differentsterilization protocols.

3.3. Cell adhesion

Initial cell adhesion assayed by counting cells stained with DAPIis shown in Fig. 4. At each interval adopted in this study, theadherent cell number on the UV or ethanol-sterilized one waslarger than that on the autoclaved one. After 30 and 60 min, there isno obvious difference in the cell adhesion on the UV-sterilized andethanol-sterilized samples. After 120 min of incubation, the cell

number on the ethanol-sterilized surface is slightly larger than thaton the UV-sterilized one. An intriguing phenomenon is that afterautoclave sterilization, cell adhesion is higher on the anodizedsurfaces than that on the polished surface, but such differencecannot be observed after UV irradiation or ethanol immersion.

Fig. 4. Osteoblasts adhesion measured by counting cells stained with DAPI undera fluorescence microscope after incubation of 30, 60 and 120 min *p< 0.05 and**p< 0.01 compared with the autoclave-sterilized of each surface, #p< 0.05 comparedwith the UV-sterilized of each surface.

Fig. 5. LDH activity in the culture media after 24 h incubation of osteoblasts on thespecimens after different sterilization methods.

Fig. 6. Osteoblast proliferation on samples after 1, 4 and 7 days of incubation usingcolorimetric MTT assay. *p< 0.05 and **p< 0.01 compared to the autoclaved of eachsurface, #p< 0.05 and ##p< 0.01 compared to the UV-sterilized of each surface.

Fig. 7. Osteoblast intracellular total protein content (upper panel) and alkaline phos-phatase activity (lower panel) on samples after 7 days of incubation.

L. Zhao et al. / Biomaterials 31 (2010) 2055–20632058

3.4. LDH activity

The LDH activity assay results are depicted in Fig. 5. After 24 hincubation, there is no obvious difference in the LDH activity of theculture media among the different samples.

3.5. Cell proliferation

Cell proliferation measured by the MTT assay is shown in Fig. 6.Based on different sterilization methods, cell proliferation followsthe following trend: UV > ethanol > autoclave. The 20 V anodizedsurface shows higher cell viability than the other two surfaceswhen sterilized by ethanol, but no obvious difference in cellproliferation can be found among the three topographies whensterilized by UV irradiation or autoclaving.

3.6. Intracellular total protein content and alkaline phosphataseactivity

The intracellular total protein content and alkaline phosphataseactivity assayed are depicted in Fig. 7. The total protein contentand alkaline phosphatase activity of osteoblasts on the differenttitania surfaces are not obviously affected by the sterilizationmethods Fig. 7.

3.7. Collagen secretion

Collagen secretion assayed by Sirius Red staining is shown inFig. 8. Sterilization by UV irradiation and ethanol immersioninduces more collagen secretion from the osteoblasts on thetwo anodized titania surfaces than autoclaving. However, onthe polished surface, no obvious difference on the collagen

Fig. 8. Collagen secretion by osteoblasts on samples after 7 days of incubation assayed by Sirius Red staining: optical image (upper panel) and colorimetrically quantitative analysis(lower panel). **p< 0.01 compared to the autoclaved of each surface, #p< 0.05 compared to the UV-sterilized of each surface.

L. Zhao et al. / Biomaterials 31 (2010) 2055–2063 2059

secretion can be observed for the different sterilizationmethods.

3.8. Extracellular matrix mineralization

Extracellular matrix mineralization assayed by Alizarin Redstaining is shown in Fig. 9. Matrix mineralization is dramaticallyaffected by the sterilization methods. On the two anodized titaniasurfaces, UV irradiation leads to the highest mineralization, fol-lowed by ethanol immersion. On the polished surface, UV irradia-tion also induces the best mineralization, while ethanol immersionproduces slightly less mineralization compared to autoclaving. Theanodized surfaces induce higher mineralization than the other twosurfaces when sterilized by UV irradiation or ethanol immersion,but no obvious difference in matrix mineralization can be foundamong the three topographies when sterilized by autoclaving.

3.9. Osteogenesis-related gene expressions

The gene expressions on the three topographies after threedifferent sterilization methods are quantified using Real-time PCRand the results are compared in Fig. 10. In general, the osteoblastscultured on the UV-sterilized samples exhibit higher gene expres-sions than those sterilized by autoclaving or ethanol immersion.There is no obviously difference in the osteoblast gene expressionsamong the samples sterilized by autoclaving and ethanol immer-sion. The OPN expressions on the UV-sterilized samples are notobviously up-regulated or even down-regulated slightly at day 10compared to the ones sterilized by the other two methods.However, the expressions of ITG, RUNX2 and BMP-2 on the UV-sterilized 5 V anodized and polished surfaces are obviously higherthan those on the surfaces sterilized by autoclaving or ethanolimmersion. The expressions of ALP and OCN on all three

Fig. 9. Cell mineralization on samples after 7 days of incubation assayed by Alizarin Red staining: optical images (upper panel) and colorimetrically quantitative analysis (lowerpanel). **p< 0.01 compared to the autoclaved of each surface, ##p< 0.01 compared to the UV-sterilized of each surface.

L. Zhao et al. / Biomaterials 31 (2010) 2055–20632060

topographies after UV sterilization are dramatically higher thanthose after sterilization by autoclaving or ethanol immersion.

4. Discussion

Although titania nanotubes have attracted much attention fortheir large potential in implant applications, their biologicalbehavior is still controversial [4–12,16,17]. In our previous study, wefound that different phenotype of cells used in the experimentsmight constitute to this controversy (Unpublished data). Thiscurrent study reveals that the sterilization methods also affectsignificantly the characteristics and cell behavior of titaniananotubes.

Different sterilization processes can lead to different degrees ofmodification of the biomaterial surfaces consequently influencingcell/biomaterial interactions [19–22]. Actually, strong discoloration

can be occasionally observed after autoclaving but it is seldomfound after UV or ethanol sterilization, suggesting potential issuescaused by different sterilization methods. Discoloration of titaniumafter autoclaving has been reported earlier [31] and is believed toarise from accelerated growth of surface oxide. It is also suspectedthat fluorine contamination may be responsible for the acceleratedoxide growth [31]. As titania nanotubes are fabricated in HF, thehigh fluorine content in the titania nanotubes may cause largersurface alterations during autoclave sterilization.

The main attributes altered by sterilization are surface chemistryand wettability [20,22]. In this study, sterilization by UV irradiationor ethanol immersion results in smaller water contact angles andhigher surface free energy than autoclaving, whereas sterilization byUV irradiation and ethanol immersion produces similar watercontact angles and surface free energies. Our results are consistentwith those previously reported. It has been reported that autoclave

Fig. 10. Gene expressions by primary osteoblasts cultured on titanium surfaces after incubation of 3 and 10 days: (A) Integrin-b1, (B) RUNX2, (C) ALP, (D) BMP-2, (E) osteopontin and(F) osteocalcin. The data are generated by Real-time RT-PCR and were shown as mean expression relative to GAPDH� SD. *p< 0.05 and **p< 0.01 compared with respectiveethanol-sterilized surface, #p< 0.05 and ##p< 0.01 compared with respective autoclaving sterilized surface.

L. Zhao et al. / Biomaterials 31 (2010) 2055–2063 2061

sterilization decreases the hydrophilicity of biomedical implants bydepositing hydrophobic contaminants over the implant surfaces[19–22]. In contrary, UV treatment of titanium dramaticallyenhances the surface free energy of titanium. It is associated with themolecular structure alteration of surface titania with the formationof abundant Ti–OH functional groups [32,33], and removal of surfacehydrophobic contaminants especially hydrocarbon [23–25]. Hith-erto, the influence of ethanol sterilization on the titanium surfacecharacteristics and biocompatibility has not been reported. Aftersterilization by UV or ethanol, the anodized surfaces possess obvi-ously higher surface energies than the polished one, whereas there isnearly no difference in the surface energy among them after auto-clave sterilization. The higher surface energies of the anodizedsurfaces relative to the control surface after sterilization by UVirradiation or ethanol immersion are mainly due to the nanoporoustopography and less surface contamination. In comparison, afterautoclave sterilization, large amounts of hydrophobic contaminantscover the surface and mask the difference in the surface energy thatwould have resulted from the different surface textures, leading tosimilar surface energies.

Though the cytotoxicity of titanium specimens indicated by theLDH activity in the culture medium is not obviously influenced by thesterilization process, the cytocompatibility is related to the sterili-zation methods. Initial cell adhesion is believed to be very importantfor the ensuing cell functions and eventual tissue integration [34].Furthermore, faster initial cell adhesion is supposed to win the ‘‘racefor the surface’’ against bacteria and is thus important to theprevention of implant-associated infection [35]. Higher cell prolif-eration is also meaningful in tissue integration as high cell prolifer-ation results in more cell colonization on the implant surface,probably leading to a larger mass of bone tissues around the implantthus securing a more robust bone-implant bonding. In this study,initial cell adhesion is dramatically higher on the UV or ethanol-sterilized surfaces compared to the autoclave-sterilized ones. There isno obvious difference on the UV and ethanol-sterilized ones exceptthat slightly higher cell adhesion is found on the ethanol-sterilizedone at 120 min. After one week of cell culturing, UV irradiationinduced the best cell proliferation, followed by the ethanol immer-sion, and autoclaving fares the worst. The degrading effects ofautoclaving on biomaterial surfaces have been long recognized [19]and UV irradiation inducing higher cell adhesion and proliferationhave been widely reported recently on many kinds of biomaterialsurfaces such as titanium [23,25,27] and zirconium [36]. However theeffects of ethanol sterilization on the cytocompatibility of biomate-rials have not been reported before. Our study may be the first onethat systemically compares the impact of these three commonly usedsterilization methods on titania nanotopographies.

The difference in cell adhesion and proliferation on the titaniasurfaces after different sterilization methods can be explained bythe altered surface characteristics. UV irradiation leads to hydro-carbon removal and hydrophilicity thereby rendering the titaniasurface more bioactive. Han has suggested that the enhancedbioactivity and cell response on UV-irradiated coatings result fromthe Ti–OH groups formed [25]. Att et al. believe that UV induceshigher cell adhesion and proliferation is more closely linked tohydrocarbon removal than the induced hydrophilicity [23,27].Although ethanol immersion also leads to similar hydrophilicitylike UV irradiation, it has the drawback of introducing potentialcontamination from the ethanol and may account for lowerproliferation relative to that on the UV-sterilized surface. Auto-claving severely degrades the bioactivity of titania by depositinga large amount of hydrocarbon contaminants consequentlyinducing the lowest cell adhesion and proliferation. Proteinadsorption on the biomaterial surface is generally considered to bean important process for optimal cell functions. However, we are

not able to find obvious differences in the protein adsorptionamong the different sterilized samples. It is suggested that somespecific proteins such as fibronectin and laminin may play a morevital role in cell/biomaterial interactions and that the conformationof the adsorbed protein is also important. Further studies areneeded to give a better explanation.

The influence of the sterilization process on the implant is nota transient phenomenon just influencing the initial events of cell/biomaterial interactions, but rather a long lasting effect involvingthe late stage of cell functions such as cell differentiation repre-sented by extracellular matrix deposition, mineralization, andrelated gene expressions. Extracellular matrix deposition aroundthe implant and mineralization determine the quantity and qualityof bones formed around the implant surface. We have observedthat collagen secretion by osteoblasts and extracellular matrixmineralization on titania surfaces are significantly influenced bythe sterilization methods. According to the amount of collagensecretion and mineralization induced, the sterilization methodsfollows the following trend (from high to low): UV-irradiation > ethanol immersion > autoclaving. After 7 days ofincubation, the intracellular total protein content and ALP activityshow no obvious difference among the different sterilized groups. Alonger incubation time may be needed to observe whether theywill be affected at a later time as we have already observedenhanced expressions of gene ALP on the UV-sterilized surfaces.The real-time PCR results show that expressions of nearly all thegenes concerned, namely ITG, RUNX2, ALP, BMP-2 and OCN, are up-regulated after UV sterilization, but the ethanol-sterilized surfacesshow nearly the same level as the autoclaved ones.

UV induces better osteoblast differentiation and it is probablyrelated to the better cell/implant surface interactions due tohydrocarbon removal and contact-induced differentiation for highcell proliferation. Ethanol sterilization does not show the ability toinduce cell differentiation like UV sterilization. It can be explainedby the lack of contaminant removal ability as well as potentialcontamination from the ethanol medium. Our results appear tosupport Att et al.’s suggestion that hydrocarbon removal accountsfor that UV induces better cell function on titania rather thanhydrophilicity [23,27]. The expressions of ITG, RUNX2 and BMP-2are enhanced after UV sterilization only on the 5 V anodized andpolished samples. The reason for the lower expressions of ITG,RUNX2 and BMP-2 on the 20 V anodized surface may be ascribed tocompromised focal contact formation on the 20 V anodized surface,which leads to a shortage of signals from the extracellular matrixthus resulting in hampered cell differentiation and associated geneexpression. It is surprising that the expressions of ALP and OCN aredramatically enhanced after UV sterilization regardless of thesurface topography even as early as after 3 days of culture. Thisissue cannot be explained adequately at this moment and needs tobe studied in more details.

We have found that different sterilization methods influence thecytocompatibility of the nanotopography relative to the controlsurface. Higher initial cell adhesion is observed on the anodizedsurfaces after sterilization by autoclaving. However, this differencedisappears after sterilization by UV irradiation or ethanol immer-sion. The 20 V anodized surface shows higher cell proliferation thanthe other two surfaces after sterilized by ethanol, but no obvious cellproliferation difference can be found among the three topographiesafter sterilization by UV irradiation or autoclaving. The sterilizationmethods used also alter the relative comparison of cell differenti-ation on the surface nanotopographies with the control surface. Forexample, there is no difference in matrix mineralization on thethree surfaces after sterilization by autoclaving, whereas matrixmineralization is significantly higher on the anodized surfaces thanthe polished one after sterilization by UV irradiation or ethanol

L. Zhao et al. / Biomaterials 31 (2010) 2055–20632062

immersion. Although understanding the detailed mechanismneeds further study, the present results strongly suggest that thesterilization process affects the bioactivity evaluation of titaniananotubes relative to the control surface and it perhaps plays animportant role in the inconsistent results in the literature so far.

5. Conclusion

This study shows that the three sterilization methodscommonly used when studying the biocompatibility of titaniananotubes, namely autoclaving, ultraviolent irradiation and ethanolimmersion, significantly influence the surface characteristics of thenanostructures and subsequent osteoblast behavior. UV andethanol sterilization results in higher surface free energy andinduces higher initial cell adhesion and proliferation than auto-claving, whereas UV irradiation leads to the best cell functionsincluding adhesion, proliferation, as well as differentiation repre-sented by extracellular deposition and mineralization and bone-related gene expressions. We have observed that the differentsterilization methods influence the cytocompatibility evaluation ofthe surface nanotopographies relative to the control surface, con-firming our conjecture that different sterilization methods partlyaccount for the conflicting biological behavior reported on titaniananotube by different groups. From the viewpoint of surfacecontamination, UV sterilization may be the optimal sterilizationmethod. Experimental protocols including the wavelength of theUV light, irradiation intensity, irradiation time, etc. need to bestandardized in order to compare results and for optimization.

Acknowledgements

This work was supported by the National Natural ScienceFoundation of China No. 30672347 and Hong Kong Research GrantsCouncil (RGC) General Research Fund (GRF) No. CityU 112307.

Appendix

Figures with essential color discrimination. Fig. 8, in this articleis difficult to interpret in black and white. The full color images canbe found in the online version, at doi:10.1016/j.biomaterials.2009.11.103.

References

[1] Webster TJ, Ejiofor JU. Increased osteoblast adhesion on nanophase metals: Ti,Ti6Al4V, and CoCrMo. Biomaterials 2004;25:4731–9.

[2] Hajicharalambous CS, Lichter J, Hix WT, Swierczewska M, Rubner MF,Rajagopalan P. Nano- and sub-micron porous polyelectrolyte multilayerassemblies: biomimetic surfaces for human corneal epithelial cells. Biomate-rials 2009;30:4029–36.

[3] Mendonca G, Mendonca DB, Aragao FJ, Cooper LF. Advancing dental implantsurface technology – from micron- to nanotopography. Biomaterials2008;29:3822–35.

[4] Park J, Bauer S, von der Mark K, Schmuki P. Nanosize and vitality: TiO2nanotube diameter directs cell fate. Nano Lett 2007;7:1686–91.

[5] Brammer KS, Oh S, Cobb CJ, Bjursten LM, Heyde HV, Jin S. Improved bone-forming functionality on diameter-controlled TiO2 nanotube surface. ActaBiomater 2009;5:3215–23.

[6] Park J, Bauer S, Schlegel KA, Neukam FW, von der Mark K, Schmuki P. TiO2nanotube surfaces: 15 nm – an optimal length scale of surface topography forcell adhesion and differentiation. Small 2009;5:666–71.

[7] Oh S, Daraio C, Chen LH, Pisanic TR, Finones RR, Jin S. Significantly acceleratedosteoblast cell growth on aligned TiO2 nanotubes. J Biomed Mater Res A2006;78A:97–103.

[8] Popat KC, Eltgroth M, Latempa TJ, Grimes CA, Desai TA. Decreased Staphylo-coccus epidermis adhesion and increased osteoblast functionality on antibi-otic-loaded titania nanotubes. Biomaterials 2007;28:4880–8.

[9] Das K, Bose S, Bandyopadhyay A. TiO2 nanotubes on Ti: influence of nanoscalemorphology on bone cell–materials interaction. J Biomed Mater Res A2009;90:225–37.

[10] Balasundaram G, Yao C, Webster TJ. TiO2 nanotubes functionalized withregions of bone morphogenetic protein-2 increases osteoblast adhesion.J Biomed Mater Res A 2008;84A:447–53.

[11] Popat KC, Leoni L, Grimes CA, Desai TA. Influence of engineered titaniananotubular surfaces on bone cells. Biomaterials 2007;28:3188–97.

[12] Oh S, Brammer KS, Li YSJ, Teng D, Engler AJ, Chien S, et al. Stem cell fatedictated solely by altered nanotube dimension. Proc Natl Acad Sci U S A2009;106:2130–5.

[13] Park J, Bauer S, Schmuki P, von der Mark K. Narrow window in nanoscaledependent activation of endothelial cell growth and differentiation on TiO2nanotube surfaces. Nano Lett 2009;9. p. 3157–64.

[14] Peng L, Eltgroth ML, LaTempa TJ, Grimes CA, Desai TA. The effect of TiO2nanotubes on endothelial function and smooth muscle proliferation. Bioma-terials 2009;30:1268–72.

[15] Eaninwene 2nd G, Yao C, Webster TJ. Enhanced osteoblast adhesion to drug-coated anodized nanotubular titanium surfaces. Int J Nanomedicine2008;3:257–64.

[16] von der Mark K, Bauer S, Park J, Schmuki P. Another look at ‘‘Stem cell fatedictated solely by altered nanotube dimension’’. Proc Natl Acad Sci USA2009;106. E60-author reply E61.

[17] Bjursten LM, Rasmusson L, Oh S, Smith GC, Brammer KS, Jin S. Titaniumdioxide nanotubes enhance bone bonding in vivo. J Biomed Mater Res A, inpress, doi:10.1002/jbm.a.32463.

[18] Yao C, Slamovich EB, Webster TJ. Enhanced osteoblast functions on anodizedtitanium with nanotube-like structures. J Biomed Mater Res A 2008;85:157–66.

[19] Baier RE, Meyer AE, Akers CK, Natiella JR, Meenaghan M, Carter JM. Degra-dative effects of conventional steam sterilization on biomaterial surfaces.Biomaterials 1982;3:241–5.

[20] Serro AP, Saramago B. Influence of sterilization on the mineralization of tita-nium implants induced by incubation in various biological model fluids.Biomaterials 2003;26:4749–60.

[21] Vezeau PJ, Koorbusch GF, Draughn RA, Keller JC. Effects of multiple steriliza-tion on surface characteristics and in vitro biologic responses to titanium.J Oral Maxillofac Surg 1996;54:738–46.

[22] Doundoulakis JH. Surface analysis of titanium after sterilization: role inimplant-tissue interface and bioadhesion. J Prosthet Dent 1987;58:471–8.

[23] Att W, Hori N, Iwasa F, Yamada M, Ueno T, Ogawa T. The effect of UV-photo-functionalization on the time-related bioactivity of titanium and chromium-cobalt alloys. Biomaterials 2009;30:4268–76.

[24] Gallardo-Moreno AM, Pacha-Olivenza MA, Saldana L, Perez-Giraldo C,Bruque JM, Vilaboa N, et al. In vitro biocompatibility and bacterial adhesion ofphysico-chemically modified Ti6Al4V surface by means of UV irradiation. ActaBiomater 2009;5:181–92.

[25] Han Y, Chen D, Sun J, Zhang Y, Xu K. UV-enhanced bioactivity and cellresponse of micro-arc oxidized titania coatings. Acta Biomater 2008;4:1518–29.

[26] Liu X, Zhao X, Li B, Cao C, Dong Y, Ding C, et al. UV-irradiation-inducedbioactivity on TiO2 coatings with nanostructural surface. Acta Biomater2008;4:544–52.

[27] Aita H, Att W, Ueno T, Yamada M, Hori N, Iwasa F, et al. Ultraviolet light-mediated photofunctionalization of titanium to promote human mesen-chymal stem cell migration, attachment, proliferation and differentiation. ActaBiomater 2009;5:3247–57.

[28] Zhao L, Wei Y, Li J, Han Y, Ye R, Zhang Y. Initial osteoblast functions on Ti–5Zr–3Sn–5Mo–15Nb titanium alloy surfaces modified by microarc oxidation.J Biomed Mater Res A, in press, doi:10.1002/jbm.a.32348.

[29] Blackwood KA, McKean R, Canton I, Freeman CO, Franklin KL, Cole D, et al.Development of biodegradable electrospun scaffolds for dermal replacement.Biomaterials 2008;29:3091–104.

[30] Lozano D, Manzano D, Doadrio JC, Salinas AJ, Vallet-Regi M, Gomez-Barrena E,et al. Osteostatin-loaded bioceramics stimulate osteoblastic growth anddifferentiation. Acta Biomater, in press, doi:10.1016/j.actbio.2009.08.033.

[31] Lausmaa J, Kasemo B, Hansson S. Accelerated oxide growth on titaniumimplants during autoclaving caused by fluorine contamination. Biomaterials1985;6:23–7.

[32] Wang R, Hashimoto K, Fujishima A, Chikuni M, Kojima E, Kitamura A, et al.Light-induced amphiphilic surfaces. Nature 1997;388:431–2.

[33] Wang R, Hashimoto K, Fujishima A, Chikuni M, Kojima E, Kitamura A, et al.Photogeneration of highly amphiphilic TiO2 surfaces. Adv Mater 1998;10:135–8.

[34] Anselme K. Osteoblast adhesion on biomaterials. Biomaterials 2000;21:667–81.

[35] Subbiahdoss G, Kuijer R, Grijpma DW, van der Mei HC, Busscher HJ. Microbialbiofilm growth vs. tissue integration: ‘‘the race for the surface’’ experimentallystudied. Acta Biomater 2009;5:1399–404.

[36] Att W, Takeuchi M, Suzuki T, Kubo K, Anpo M, Ogawa T. Enhanced osteo-blast function on ultraviolet light-treated zirconia. Biomaterials 2009;30:1273–80.

L. Zhao et al. / Biomaterials 31 (2010) 2055–2063 2063