the plant journal (2002) 29 redistribution of membrane ...fb/saint-jore.pdf664 claude m. saint-jore...

Redistribution of membrane proteins between the Golgiapparatus and endoplasmic reticulum in plants is reversibleand not dependent on cytoskeletal networks

Claude M. Saint-Jore1, Janet Evins1, Henri Batoko2, Federica Brandizzi1, Ian Moore2 and Chris Hawes1,*1School of Biological and Molecular Sciences, Oxford Brookes University, Headington, Oxford OX3 0BP, UK2Department Plant Sciences, Oxford University, South Parks Road, Oxford OX1 3RB, UK.

Received 21 August 2001; revised 5 November 2001; accepted 6 December 2001.*For correspondence (e-mail [email protected]).

Summary

We have fused the signal anchor sequences of a rat sialyl transferase and a human galactosyl transferase

along with the Arabidopsis homologue of the yeast HDEL receptor (AtERD2) to the jelly®sh green

¯uorescent protein (GFP) and transiently expressed the chimeric genes in tobacco leaves. All constructs

targeted the Golgi apparatus and co-expression with DsRed fusions along with immunolabelling of

stably transformed BY2 cells indicated that the fusion proteins located all Golgi stacks. Exposure of

tissue to brefeldin A (BFA) resulted in the reversible redistribution of ST-GFP into the endoplasmic

reticulum. This effect occurred in the presence of a protein synthesis inhibitor and also in the absence of

microtubules or actin ®laments. Likewise, reformation of Golgi stacks on removal of BFA was not

dependent on either protein synthesis or the cytoskeleton. These data suggest that ER to Golgi

transport in the cell types observed does not require cytoskeletal-based mechanochemical motor

systems. However, expression of an inhibitory mutant of Arabidopsis Rab 1b (AtRab1b(N121I)

signi®cantly slowed down the recovery of Golgi ¯uorescence in BFA treated cells indicating a role for

Rab1 in regulating ER to Golgi anterograde transport.

Keywords: Golgi apparatus, endoplasmic reticulum, green ¯uorescent protein, cytoskeleton, brefeldin A.

Introduction

In higher plants, it is generally accepted that, with a few

exceptions (Hara-Nishimura et al., 1998), transport of

material from the endoplasmic reticulum (ER) along the

secretory pathway, to either the cell surface or the vacuolar

system, is via the Golgi apparatus (Hawes et al., 1999a).

Likewise, it has been suggested that the vectorial transport

of material out of the ER is mediated by membrane-

bounded vesicles (Movafeghi et al., 1999; Pimpl et al.,

2000) as is the case in yeast and mammalian cells

(Klumperman 2000 and references therein). However,

both in vivo and in vitro evidence for the existence of

such vesicles in plants is scant. With the exception of

various unicellular algae, electron microscopy has failed to

produce convincing evidence of either exit sites from the

ER, i.e. areas from which vesicle bud or for transition

vesicles themselves (Hawes et al., 1996). In contrast, there

have been various reports of direct tubular connections

between the ER and Golgi in cells producing storage

protein such as those found in the developing cotyledons

of legume seeds (Harris and Oparka, 1983; Hawes et al.,

1996).

The spatial relationship between the organelles of the

secretory pathway is maintained by the cytoskeleton. In

mammalian cells, both the organisation of, and commu-

nication between the endoplasmic reticulum and the Golgi

apparatus, are dependent on the microtubule cytoskeleton

and its associated proteins such as dynein and kinesin

(Allan and Schroer 1999; Harada et al., 1998; Roghi and

Allan, 1999). However, Golgi membranes also appear to

contain myosins, which may indicate the ability to under-

take actin based motility under certain conditions (Allan

and Schroer, 1999; Buss et al., 1998). In plants it appears

that the actin network is the major cytoskeletal component

maintaining the spatial organisation of the Golgi appar-

atus (Boevink et al., 1998; NebenfuÈ hr et al., 1999; Satiat-

Jeunemaitre et al., 1996), and regulating the organisation

The Plant Journal (2002) 29(5), 661±678

ã 2002 Blackwell Science Ltd 661

662 Claude M. Saint-Jore et al.

ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 661±678

and movement of the ER network (Boevink et al., 1998;

Liebe and Quader, 1994; Quader, 1990).

Application of ¯uorescent protein technology has

started to revolutionise plant cell biology and the study

of the secretory pathway is no exception. It is now possible

to observe in vivo the dynamic events of secretion and

endomembrane organisation (Boevink et al., 1996, 1998,

1999; NebenfuÈ hr et al., 1999). Delivering GFP to the Golgi

apparatus by the addition of targeting regions of Golgi

transferases (Boevink et al., 1998; Essl et al., 1999) or

complete enzymes (NebenfuÈ hr et al., 1999) has demon-

strated that in suspension culture cells, leaf epidermal

cells, hypocotyls, and roots (Saint-Jore, Moore and Hawes

unpublished) individual Golgi stacks to be highly dynamic,

moving not only in the general cytoplasmic stream but in

more de®ned patterns at the cortex of cells. With a

construct comprising the Arabidopsis HDEL receptor

homologue (Bar-Peled et al., 1995) and GFP (AtERD2GFP)

we have also demonstrated that both the ER and Golgi can

be targeted in leaf epidermal cells of Nicotiana clevelandii

(Boevink et al., 1998). The surprising result was that Golgi

bodies were apparently closely associated with, and

tracked over the surface of the polygonal network of

cortical ER tubules. This ER network overlaid the cortical

actin cytoskeleton, which when disrupted resulted in

cessation of Golgi movement without disrupting the ER

geometry. Use of the fungal macrocyclic lactone brefeldin

A (BFA) induced retrograde transport of these constructs

into the ER of tobacco leaf cells, a phenomenon which was

reversible on removal of the drug (Boevink et al., 1998).

Although it appears that Golgi movement in plants is

mediated by the actin cytoskeleton, the role of the

cytoskeleton in the vectorial transport of material between

putative exit sites on the ER and the cis-Golgi is unknown,

as is the mode of retrograde retrieval of Golgi proteins to

the ER. By utilising the BFA effect combined with transient

expression (Batoko et al., 2000) of Golgi targeted GFP

constructs or stably transformed BY-2 cells, cytoskeletal

inhibitors and immunocytochemistry, we show here that

BFA mediated retrograde transport to the ER and ante-

rograde recovery of Golgi membrane from the ER is

insensitive to the action of cytoskeletal inhibitors.

However, expression of a dominant-inhibitory mutant of

the Arabidopsis Rab GTPase AtRab1b (Batoko et al., 2000)

had no effect on BFA induced retrograde transport of Golgi

targeted GFP but inhibited recovery of Golgi on BFA

release. These observations pose important questions on

the nature of the physical relationship between the two

organelles.

Results

GFP constructs target the Golgi apparatus in tobacco

leaves and BY-2 cells

In tobacco leaves, GFP when fused to the signal anchor

sequences of a rat sialyl transferase (ST-GFP) and

transiently expressed using Agrobacterium in®ltration

targeted a system of highly motile ¯uorescent structures

(Figure 1a). A human galactosyl transferase signal anchor

sequence construct (GT-GFP, Zaal et al., 1999) and the

Arabidopsis ERD2-GFP also targeted motile ¯uorescent

structures (Figure 1b,c), but also often showed ¯uores-

cence of the ER. It was assumed that the ¯uorescent

bodies were individual Golgi stacks as described previ-

ously by Boevink et al. (1998). In transformed BY2 cells ST-

GFP again labelled Golgi-like structures (Figure 1d,e). One

of the properties of GFP is that the ¯uorophore retains its

capability to ¯uoresce after chemical ®xation. This enabled

the staining ST-GFP cells with JIM84, a Golgi marker

antibody, revealing that JIM84 epitopes co-localised with

the GFP tagged structures (Figure 1f,g,h). To con®rm that

our constructs labelled the same population of Golgi we

co-expressed, in tobacco leaves, AtERD2-GFP and the red

¯uorescent protein, DsRed, fused to the sialyl transferase

signal anchor sequence. Figure 1(i,j,k) shows that in cells

expressing low levels of the DsRed construct, the two

¯uorescent proteins co-localise, indicating that it is likely

that each construct targets every Golgi body in the cell.

Figure 1. Expression of Golgi targetted constructs in tobacco leaves and BY2 cells.(a) ST-GFP locates to Golgi bodies in the cortical cytoplasm of a leaf epidermal cell. Note lack of expression in guard cells (arrows) which are rarelyinfected by the agrobacteria. Bar = 25 mm.(b) GT-GFP locates to Golgi bodies and also faintly highlights the ER network. Bar = 25 mm.(c) AtERD2-GFP locates to the Golgi and to the ER network. Visualisation of the ER depends on expression levels and often necessitates saturation of theGolgi signal (see also Boevink et al., 1998). Bar = 15 mm.(d,e) Stable expression of ST-GFP in BY2 cells showing distribution of Golgi bodies in the cortical cytoplasm (d) and in the same cell at a different focalplane surrounding the nucleus and in transvacuolar strands (e). Bar = 10 mm (d) and 25 mm (e).(f±h) Colocalisation of ST-GFP with the Golgi marker antibody JIM84 in transformed BY2 cells. ST-GFP distribution in a ®xed cell (f) colocalises (h) with theJIM84 antigen detected with a Texas red conjugated second antibody (g). Bar = 25 mm.(i±k) Co-localisation of AtERD2-GFP (i) with ST-DsRed (j) represented in blue (k) with the Zeiss LSM410 co-localisation software. Bar = 10 mm.(l) Actin labelling with rhodamine phalloidin in BY2 cells expressing ST-GFP. Actin and Golgi are closely associated and Golgi bodies align on actin cables(insert). Bar = 10 mm.(m) Immunolocation of cortical microtubules (red) in BY2 cells expressing ST-GFP. Note, in many cells Golgi ¯uorescence was often located in a differentfocal plane to the microtubules (data not shown). Bar = 10 mm.

Redistribution of membrane proteins 663


Staining of the actin cytoskeleton in BY2 cells with

rhodamine labelled phalloidin revealed a close association

between Golgi bodies and actin (Figure 1l), with Golgi

bodies aligned along actin cables (Figure 1l insert) as

previously reported for tobacco leaves (Boevink et al.,

1998). However, there generally appeared to be less co-

alignment between the cortical microtubules and Golgi

bodies (Figure 1m) with the cortical Golgi bodies most

often being located in a different confocal (focal) plane to

the cortical microtubules (data not shown).

BFA induces redistribution of Golgi proteins into the ER

Treatment of tobacco leaves expressing ST-GFP with

180 mM BFA for 30±60 min, results in cessation of Golgi

movement over the ER followed by some clumping of the

Golgi and ®nally the disappearance of ¯uorescent Golgi

stacks and redistribution of ¯uorescence in the polygonal

ER network (Figure 2a). Likewise, a similar treatment of

AtERD2-GFP expressing leaves resulted in an increase in

ER ¯uorescence and disappearance of Golgi (Figure 2b).

This agrees with the data of Boevink et al. (1998) who used

a viral expression system to target GFP to the Golgi.

BFA is known to inhibit export of some newly synthe-

sised proteins from the ER (Batoko et al., 2000; Boevink

et al., 1999). To rule out the possibility that the BFA-

induced accumulation of ST-GFP and ERD2-GFP in the ER

resulted from the synthesis of new ST-GFP in the ER and

loss from the Golgi by secretory activity, we conducted the

experiments above in the presence of cycloheximide. To

verify that cycloheximide can inhibit the accumulation of

new GFP in this system, we investigated the effect of

cycloheximide on the accumulation of a secreted GFP,

secGFP (Batoko et al., 2000). Leaf cells expressing a

secretory form of GFP at levels suf®cient to cause visible

accumulation of ¯uorescence in the apoplast (Figure 2d,

see also Batoko et al., 2000) were treated with BFA for up to

4 h to block secretion and trap GFP in the ER (Figure 2e).

Treatment with 100 mM cycloheximide along with the BFA

prevented any signi®cant accumulation of GFP ¯uores-

cence in the ER indicating successful inhibition of GFP

synthesis (Figure 2f). Also, leaves in®ltrated with higher

titres of Agrobacterium expressing secGFP showed low

level of ER ¯uorescence indicating build up of GFP in the

ER lumen prior to secretion. Treatment of these leaves

with cycloheximide resulted in gradual loss of ¯uores-

cence in the ER over 4 h consistent with inhibition of new

Figure 2. Effect of BFA on Golgi targetted constructs.(a) Treatment of ST-GFP expressing tobacco leaf epidermal cells with 180 mM BFA for 4 h results in complete loss of Golgi ¯uorescence accompanied adramatic increase in ER ¯uorescence. Note lamellate areas of ER in the cortical network, a common feature of BFA treatment. Bar = 25 mm.(b) BFA at 180 mM for 2.5 h causes the redistribution of Golgi ¯uorescence into the ER in AtERD2-GFP expressing tobacco leaf cells. Bar = 25 mm.(c) Redistribution of ST-GFP into the ER of transformed BY2 cells after treatment at 180 mM for 2.5 h. Bar = 25 mm.(d) Secreted GFP locates to the apoplast in transiently expressing tobacco leaf epidermal cells. Bar = 50 mm.(e) BFA treatment at 360 mM for 3 h results in blockage of secretion and retention of GFP in the ER. Bar = 10 mm.(f) Leaf tissue treated as in e but also in the presence of 100 mm cycloheximide for 3 h. Note there is no new synthesis of GFP in the ER. Bar = 50 mm.(g±l) Time course of BFA (360 mM) treatment on BY2 cells. Initially Golgi show some clumping before ER and nuclear envelope ¯uorescence can beobserved. Note that not all Golgi are reabsorbed into the ER. Bar = 50 mm.(m) The cortical network of ER in a ST-GFP transformed BY2 cells after 180 mM BFA for 6 h. Note that the polygonal network of ER tubules areinterdispersed with small patches of ER lamellae. Bar = 25 mm.(n) Location of Golgi in ®xed wild type BY2 cells with the monoclonal antibody JIM84. Bar = 25 mm.(o) Immuno-location of the JIM 84 epitope in BY2 cells after 180 mM BFA for 2 h showing labelling of the ER and Golgi clumps. Note that in suchpreparations the morphology of the ER network is affected by the ®xation protocol. Bar = 10 mm.

Figure 3. Modi®cation of glycans on an ER-resident protein after BFAtreatment.Leaf samples expressing a myc-tagged N-GFP-HDEL were incubated inwater or water plus 180 mM BFA for 3 h. Protein extracts were subjectedto endo-H digestion prior to SDSA-PAGE. N-GFP-HDEL was detected witha cMyc antibody. BFA treatment confers endoglycosidase H resistance onthe glycosylated construct indicating a retrograde transfer of medial totrans-Golgi glycosyl transferases to the ER in response to the drug (a).In contrast, expression of the mutant (N121I) form of At Rab1b did notconfer resistance to endoglycosidase H (b).



GFP synthesis and secretion of the residual ER located

secGFP (data not shown).

A similar redistribution of ¯uorescence was obtained on

treating ST-GFP BY2 cells with BFA (Figure 2c) where a

time series of micrographs revealed an initial clumping of

Golgi, followed by redistribution into the ER over 25 min

(Figure 2g-l). A full movie sequence of this event can be

viewed at http://www.brookes.ac.uk/schools/bms/research/

molcell/hawes/gfpmoviepage.html. Such redistribution

into the ER revealed the classical cortical network arrange-

Figure 4. BFA treatment reveals ER in the mitotic apparatus.(a) Metaphase showing aggregations of ER expressing ST-GFP around the spindle. Bar = 25 mm.(b) Late telophase showing ER accumulating at the phragmoplast and extending between the phragmoplast and the daughter nuclei. Bar = 25 mm.(c) Late telophase as in (b) but after depolymerisation of the actin cytoskeleton with latrunculin B prior to BFA treatment. Bar = 25 mm.(d±f) Location of Golgi (d) and microtubules (e) in a telophase cell showing almost complete exclusion of Golgi from the phragmoplast area (f).Bar = 10 mm.(g±i) Location of ST-GFP (g) and microtubules (h) in a BFA treated cell showing ER interdispersed with the phragmoplast microtubules array (i).Bar = 10 mm.



ment of ER tubules (Figure 2m). BFA treatment also

resulted in distinct morphological changes to the cortical

ER network in that with increasing time in the drug the

network formed small lamellae at the vertices of the

network tubules (Figure 2m) and in many cells the network

converted into large fenestrated sheets of ER membrane

(Figure 5c) as has been previously reported for a soluble

ER targeted GFP (Boevink et al., 1999).

Figure 5. BFA induces retrograde transport of Golgi targetted ST-GFP in the presence of cycloheximide and cytoskeletal inhibitors.(a±d) BY2 cells expressing ST-GFP showing BFA induced redistribution of ¯uorescence into the ER in the presence of 100 mM cycloheximide for 2 h(a) 28.9 mM oryzalin for 1.5 h (b), 39.4 mM cytochalasin D for 1.5 h (c) and 265 mM latrunculin B for 1 h (d). Note the almost complete conversion of thepolygonal cortical ER network to a large fenestrated sheet in one cells (c). Bars = 25 mm.(e±f) BFA induced retrograde transport of ST-GFP in tobacco leaf epidermal cells in the presence of 39.4 mM cytochalasin D for 2 h (e) and 28.9 mM oryzalinfor 1.5 h (f). Bars = 25 mm.



Immuno¯uorescence of BFA treated cells also revealed a

redistribution of the JIM84 epitope into the ER of wild type

BY2 cells, although some clumps of Golgi material also

remained in the cytoplasm (Figure 2n,o). As this antibody

recognises a glycan antigen resident on many Golgi

proteins (Fitchette et al., 1999; Horsley et al., 1993) the

effect of BFA is not restricted to the redistribution of our

chimeric GFP constructs.

To con®rm the above data indicating that the BFA effect

was a true retrograde redistribution of Golgi membrane

proteins into the ER we biochemically tested the endo-

glycosidase H (endo H) sensitivity of a glycosylated ER

targeted GFP construct (N-GFP-HDEL) after BFA treatment.

Treatment of protein extracts from tobacco leaves transi-

ently expressing N-GFP-HDEL revealed that the construct in

the ER was glycosylated and sensitive to the enzyme.

However, after treatment with 180 mM BFA for 3 h all the

GFP had acquired endo H resistance indicating the BFA

induced presence of mid to late Golgi glycosyl transferases

in the ER (Figure 3a). We carried out a similar experiment

on leaves transiently expressing N-GFP-HDEL along with a

mutant form of the Arabidopsis small GTPase Rab1b

(AtRab1b(N121I; Batoko et al., 2000) which has been

shown to inhibit ER to Golgi transport and to cause

increased accumulation of ST-GFP in the ER. As can be

seen in Figure 3b N-GFP-HDEL in leaves expressing

AtRab1b(N121I) remained Endo H sensitive indicating that

inhibition of forward membrane traf®c by At-Rab1b(N121I)

was not suf®cient to cause accumulation of detectable

Golgi transferase activity in the ER. These biochemical data

are consistent with the complete loss of morphologically

distinct Golgi structures in BFA-treated cells in contrast to

the persistence of GFP-labelled Golgi stacks in the presence

of At-Rab1b(N121I) (Batoko et al., 2000).

One unexpected feature of BFA treatment on BY2 cells

expressing ST-GFP cells was the highlighting of mitotic

pro®les by a characteristic distribution of ER around the

spindle apparatus and phragmoplast. Thus, highly char-

acteristic patterns of ER surrounding and running through

metaphase spindles were revealed (Figure 4a) and in

telophase, the new nuclear envelopes, ER compacted

around the phragmoplast and membrane spanning the

nuclear envelopes and phragmoplast were revealed

(Figure 4b). These pro®les were also observed after BFA

treatment following actin depolymerisation in the pres-

ence of latrunculin B (Figure 4c). Immunostaining of

telophase cells with anti-tubulin revealed a classic phrag-

moplast array of microtubules, which appeared to exclude

the majority of Golgi bodies (Figure 4d,e,f). However, BFA

treatment appeared not to interfere with the cytoskeleton

but revealed ER tubules interdispersed with the phragmo-

plast microtubules (Figure 4g,h,i).

Brefeldin A induces redistribution of Golgi proteins in the

presence of cytoskeletal inhibitors

In plant cells the movement, and to a certain extent the

distribution, of ER and Golgi appears to be dependent on

the actin cytoskeleton (Boevink et al., 1998; Quader, 1990).

To test whether cytoskeletal elements are necessary for the

redistribution of Golgi membrane proteins into the ER we

carried out a series of experiments in the presence of

various inhibitors.

In BY2 cells the redistribution of ST-GFP with BFA was

not affected by pre-treatment with the protein synthesis

inhibitor cycloheximide (Figure 5a), by the microtubule

inhibitor oryzalin (Figure 5b) or by the actin inhibitors

cytochalasin D and latrunculin B (Figure 5c,d). Similar

results were obtained for tobacco leaf cells expressing ST-

GFP (Figure 5e,f).

The effects of the cytoskeletal inhibitors were also

assessed by the use of af®nity probes and immuno¯uor-

escence. In BY2 cells expressing ST-GFP the cortical actin

cytoskeleton was unaffected by BFA treatment whilst the

ER appeared in the form of cortical sheets and tubules

(compare Figure 6a with Figure 6b). Treatment with cyto-

chalasin D resulted in the disappearance of major actin

cables leaving short stubby actin ®laments in the cyto-

plasm (Figure 6c) whereas latrunculin B resulted in the

depolymerisation of the majority of the actin cytoskeleton

(Figure 6d). In both cases, depolymerisation of the actin

cytoskeleton induced cessation of long-range Golgi move-

ment but BFA treatment still resulted in disappearance of

the ¯uorescent Golgi bodies and ¯uorescence of the ER

Figure 6. Merged images showing af®nity labelling of actin and microtubules (red channel) in BY2 cells expressing ST-GFP (green channel) before andafter treatment with cytoskeletal disrupting agents and BFA.(a,b) The cortical actin cytoskeleton (a) is not disrupted by 180 mM BFA treatment for 5 h and large sheets of green ER can be seen associated with thecortical actin (b). Bars = 10 mm.(c,d) Disruption of the actin cytoskeleton with 39.4 mM cytochalasin D for 1.3 h, which leaves some short stubs of ®laments (c), and 10 mm latrunculin B for1 h which completely disperses the actin cytoskeleton (d), results in some clumping of Golgi stacks. Bars = 10 mm (c), 25 mm (d).(e,f) Disruption of the actin cytoskeleton with 39.4 mM cytochalasin D for 1.5 h (e) and 25 mm latrunculin B for 1 h (f) does not disturb the effect of BFAwhich results in the formation of large cortical sheets of ER. Bars = 25 mm.(g,h) The cortical microtubule cytoskeleton (g) is not disrupted by 180 mM BFA treatment for 3 h (h). Bars = 10 mm (g), 25 mm (h).(i,j) Depolymerisation of the microtubule cytoskeleton with 28.9 mM oryzalin for 1 h (i) does not affect Golgi distribution (or movement) and does notdisturb the BFA affect (j). Bars = 10 mm.



Figure 7. Recovery of Golgi ¯uorescence after BFA removal does not require the cytoskeleton and can be independent of protein synthesis.(a) Reformation of ¯uorescent Golgi in BY2 cells expressing ST-GFP after removal into fresh medium minus BFA for 3.5 h. Note some residual ER¯uorescence remains. Bar = 25 mm.(b) Reformation of Golgi in the presence of 28.9 mM oryzalin for 7 h. Bar = 10 mm.(c,d) Reformation of Golgi in the presence of 39.4 mM cytochalsin D for 7 h (c) and 25 mM latrunculin B for 15 h (d). Bars = 10 mm (c), 25 mm (d).(e) Reformation of Golgi in the presence of 100 mm cycloheximide for 15 h. Bar = 10 mm.(f,g) ST-GFP in ®xed cells after 7 h recovery from BFA (f) colocates with the JIM84 epitope (g) con®rming anterograde transport of the construct into newlyformed Golgi bodies. Bar = 10 mm.(h±k) Reformation of Golgi in tobacco leaf epidermal cells after incubation of BFA treated leaves for 15 h in water (h), cycloheximide (i), cytochalasin D (j)and 9 h in oryzalin (k).Note, some residual ¯uorescence in the ER can be seen in the cells. Bars = 25 mm.



often in the form of large cortical sheets (Figure 6e,f).

Similarly, BFA had no effect on the arrangement of the

cortical microtubule cytoskeleton (Figure 6g,h), whilst

depolymerisation of the microtubule cytoskeleton with

oryzalin had no effect on the distribution of the Golgi

apparatus (Figure 6i) nor on BFA induced redistribution of

the Golgi targeted GFP constructs (Figure 6j and compare

with Figure 2o).

The effect of cytochalasin D on ST-GFP labelled Golgi

has previously been reported in tobacco leaves (Boevink

et al., 1998). Using the freeze-shatter technique to immuno-

stain tobacco leaf epidermal cell microtubules we con-

®rmed that oryzalin induced depolymerisation of leaf

microtubules. In the presence of either drug, BFA-induced

redistribution of ST-GFP into the ER was observed as in

BY2 cells (data not shown).

Figure 8. Co-expression of AtRab1b(N121I) with ST-GFP and N-secYFP in tobacco leaf epidermal cells slows the recovery of Golgi ¯uorescence after BFAtreatment.Treatment of ST-GFP and N-secYFP expressing tobacco leaf epidermal cells (a) with 180 mM BFA for 3 h results in ¯uorescence of the ER (b) and Golgi¯uorescence recovers after 7 h incubation in water (c).Co-expression of ST-GFP/N-secYFP with AtRab1b(N121I) results in ¯uorescence of ER and Golgi (d,see also Batoko et al., 2000) and treatment with 180 mM BFA for 4 h results in disappearance of Golgi ¯uorescence along with an increase in ER¯uorescence (e).After 8 h incubation in water, recovery from the drug can be seen to be impeded by co-expression of AtRab1b(N121I) while the ER remains brightly¯uorescent (f). A comparison of the two BFA recovery experiments at higher magni®cation: (g) recovery in absence of Rab mutant, (h) recovery inpresence of Rab mutant. Bars = 25 mm.



Reformation of Golgi stacks can take place in the

absence of the cytoskeleton

On removal of BFA from treated BY2 cells, new Golgi

bodies are formed over a period of about 5 h along with a

loss of ¯uorescence intensity in the ER (Figure 7a) as has

previously been demonstrated in tobacco leaves using a

viral expression system (Boevink et al., 1998). This recov-

ery can also occur in the presence of the three cytoskeletal

inhibitors (Figure 7b,c,d) and remarkably in the presence

of cycloheximide (Figure 7e). This reformation of the Golgi

can also be monitored not only by the presence of the GFP

constructs in the ¯uorescent Golgi bodies but also by the

presence of the JIM84 epitope after immuno¯uorescence

staining (Figure 7f,g). A similar pattern of recovery after

treatment with cycloheximide, cytochalasin D and oryzalin,

was also observed in BFA treated leaf segments

(Figure 7h-k).

At-Rab1b(N121I) inhibits recovery of Golgi stacks on

withdrawal of BFA

To investigate whether BFA-induced alterations in ER and

Golgi organisation are dependent on normal vesicle

transport, we investigated the effect of a mutant form of

the regulatory GTPase, At-Rab1 which has been shown to

inhibit transport of a secretory GFP marker between the ER

and Golgi (Batoko et al., 2000). In order to con®rm that

mutant protein was expressed in the cells imaged, plants

were co-in®ltrated with ST-GFP and a secretory version of

YFP (N-secYFP) which, like secGFP (Batoko et al., 2000),

accumulates in the ER upon any blockage of ER to Golgi

transport (¯uorescence data from GFP and the accumu-

lated N-secYFP were collected from the same confocal

detector). Using transient expression in tobacco leaves,

BFA induced accumulation and/or redistribution of ¯uor-

escence in the ER, with recovery of Golgi bodies after

removal of the drug (Figure 8a-c,g). Co-expression of the

AtRab1b(N121I) mutant protein with ST-GFP and N-secYFP

in tobacco leaves resulted in increased accumulation of

¯uorescence in the ER compared with control leaves as

reported by Batoko et al. (2000), without signi®cant loss of

Golgi ¯uorescence (compare Figure 8a and Figure 8d).

This con®rmed some inhibition of ER to Golgi transport by

the dominant-inhibitory Rab1 mutant. Treatment of such

leaf cells with BFA for 4 h resulted in total loss of Golgi

¯uorescence along with an increase in intensity of ER

¯uorescence (Figure 8e), due to ST-GFP redistribution

alongside accumulation of N-secYFP, indicating that redis-

tribution of ST-GFP is not affected by Rab1 inhibition. In

control leaves incubated in water for an equivalent period

there was no disruption of Golgi. However, in the leaves

expressing the At-Rab1b(N121I) mutant there was a greatly

reduced recovery of Golgi ¯uorescence 7 h after removal

of BFA while the ER remaining brightly ¯uorescent as

expected in the presence of N-secYFP and the At-

Rab1b(N121I) mutant (Figure 8f, and compare Figure 8g

with Figure 8h). This retention of ER ¯uorescence was

apparent up to 20 h after removal of the BFA and was not

observed in leaves recovering from BFA treatment without

AtRab1b(N121I) expression where Golgi reformed. The

BFA recovery phenotype was also rescued by the co-

expression of wild type AtRab1b along with the mutant

(data not shown) indicating that the inhibition of recovery

from the BFA phenotype was indeed due to loss of

AtRab1b function (see Batoko et al., 2000 for discussion).

Discussion

Targeting GFP to the plant Golgi apparatus

It has been shown that the signal anchor sequences of

both mammalian and plant glycosyl transferases are

suf®cient to target GFP to the Golgi apparatus in tobacco

(Boevink et al., 1998; Essl et al., 1999). Here we also show

that the C-terminal 60 amino acids of a human b-1,4-

galactosyl transferase composing the signal anchor

sequence is also suf®cient to target GFP to the plant

Golgi. Targeting of GFP constructs to the plant Golgi has

now been reported using various expression systems: viral

(Boevink et al., 1998; Essl et al., 1999); biolistics (Baldwin

et al., 2001; Takeuchi et al., 2000); Agrobacterium-mediated

(Batoko et al., 2000 and this report); and stable in suspen-

sion culture cells (this report). Similar ¯uorescent patterns

also result from the expression of complete Golgi protein-

GFP constructs in leaves and suspension cultures (Baldwin

et al., 2001; NebenfuÈ hr et al., 1999; this report). We have

also successfully expressed the AtERD2 and ST constructs

reported here in transformed Arabidopsis plants (Saint-

Jore, Moore and Hawes unpublished). Co-expression of

the AtERD2-GFP with ST-DsRed (Matz et al., 1999) in leaves

and immunolabelling of ST-GFP cells with JIM 84 in BY2

cells con®rmed that in all cases, all the Golgi stacks in cells

were targeted with the ¯uorescent proteins and we have

no evidence of differential targeting to subsets of Golgi.

Expression of AtERD2-GFP and GT-GFP also con®rmed the

previous report (Boevink et al., 1998) that leaf Golgi are

closely associated with the cortical endoplasmic reticulum

and track over the polygonal network of ER tubules. Of the

three constructs, as ST-GFP showed the lowest level of ER

labelling, it was decided to use this as the marker of choice

for further experiments.

BFA induces retrograde redistribution of GFP constructs

to the ER

BFA has long been used as a drug by which the mechan-

isms of protein transport within the secretory system can



be investigated (Klausner et al., 1992; Satiat-Jeunemaitre

et al., 1996). The most apparent effect in mammalian cells

is the induction of a rapid recycling of Golgi enzymes and

membrane into the ER via a tubule mediated fusion

process driven by microtubules (Lippincott-Schwartz

et al., 1990). At the molecular level BFA prevents the

budding of COPI vesicles on membranes by inhibiting the

recruitment of the GTP form of ADP ribosylation factor

(ARF) onto cisternae, thus preventing the construction of

the vesicle coat from the coatomer subunits (Donaldson

et al., 1992; Helms and Rothman, 1992). One molecular

target of the drug is a 200 amino acid domain identi®ed

from the sec7 gene product found in various guanine

nucleotide exchange factors (GEF, Mansour et al., 1999;

Robineau et al., 2000). Speci®c residues in Sec7p appear to

be critical for BFA action (Peyroche et al., 1999; Sata et al.,

1998) preventing the GDP/GTP exchange on ARF

(Donaldson et al., 1992).

Before the advent of GFP technology the structural

effects of BFA on plant cells were described, mainly form

ultrastructural observations coupled with a few immuno-

cytochemical reports (Satiat-Jeunemaitre and Hawes,

1992; Satiat-Jeunemaitre et al., 1996; Staehelin and

Driouich, 1997). In roots it had been shown that in some

species the drug induces a trans-face vesiculation of the

Golgi and the formation of so called `BFA compartments'

(Satiat-Jeunemaitre and Hawes, 1992; Wee et al., 1998). In

other tissues authors reported on the redistribution of

Golgi membranes to the ER, but with no marker proteins to

visualise the Golgi, such evidence was weak (Rutten and

Knuiman, 1993; Yasuhara et al., 1995).

With the publication of the ®rst Golgi targeted GFP

constructs in planta, it was shown that in tobacco leaves

BFA appeared to induce a retrograde delivery of Golgi

targeted ST signal anchor sequence and AtERD2-GFP

chimeras back to the ER (Boevink et al., 1998). The wild

type, slow folding GFP, was utilised in this latter study,

suggesting that the BFA induced ER ¯uorescence was due

to retrograde transport and not the translation and folding

of new GFP within the ER. However, no evidence was

available to prove that the ER resident GFP originated from

the Golgi. In this report we have shown the protein

synthesis inhibitor cycloheximide can inhibit the produc-

tion of a secretory form of GFP, as the BFA induced ER

retention of secGFP, previously reported by Batoko et al.

(2000), was inhibited by the drug. We therefore carried out

BFA experiments in the presence of the inhibitor demon-

strating that ER ¯uorescence is indeed a result of redistri-

bution of pre-existing GFP chimeric proteins and not a

result of blockage of GFP export from the ER followed by

accumulation of newly folded GFP in the ER. This result

was also con®rmed by the presence of an endo-H resistant

form of a glycosylated GFP construct in BFA treated

leaves suggesting the relocation of some Golgi transferase

activity to the ER. In contrast, inhibition of anterograde

transport by the expression of a dominant inhibitory

mutant of At-Rab1 did not cause accumulation of an

endo-H resistant form of ER resident GFP. Similar GFP

redistribution was also observed in both tobacco leaves

and BY2 cells, and immunocytochemical staining with the

Golgi marker antibody JIM 84 showed redistribution of the

JIM84 Lewis A type glycan epitope into the ER of BY2 cells.

Previously, such immunocytochemistry on BFA treated

maize roots showed JIM84 staining to be located in the

Golgi derived `BFA compartments' and not in the ER

(Satiat-Jeunemaitre and Hawes, 1992; Wee et al., 1998).

Recently BFA has been shown to induce clumping of Golgi

in onion epidermal cells expressing a GFP tagged

Arabidopsis GDP-mannose transporter with no apparent

redistribution of the protein into the ER (Baldwin et al.,

2001), indicating that there can indeed be a variety of

responses of plant tissues to BFA.

The molecular target and major site of action of BFA in

plant cells has yet to be con®rmed. However, at the

structural level it has been shown, using both virus and

Agrobacterium-based expression systems in tobacco

leaves, that BFA treatment results in the inhibition of the

export of a secretory form of GFP and its accumulation in

the fused ER-Golgi compartment that arises from BFA

treatment (Batoko et al., 2000; Boevink et al., 1999). If BFA

initially causes inhibition of export from ER prior to its

fusion with the Golgi, and, if a continual recycling of Golgi

material to and from the ER occurs, inhibition of the

anterograde pathway by BFA could result in an imbalance

in the usual Golgi membrane cycling, resulting in reab-

sorption into the ER. However, this data does not preclude

a lesser effect of BFA on the trans-Golgi as previously

reported in roots. Interestingly, reports in the mammalian

literature have suggested that remnants of Golgi can

remain after BFA treatments which are free of glycosyla-

tion enzymes but contain matrix proteins such as Golgin

(Seeman et al., 2000). The other, and more generally

accepted possibility is that the principal site of BFA action

would be, as suggested for mammals and yeast, in the

inhibition of COPI coats on retrograde Golgi derived

transport vesicles (Donaldson et al., 1992; Helms and

Rothman, 1992). This would result in the breakdown of

the physical discontinuity between Golgi and ER and the

formation of tubular connections between the organelles

resulting in an effective merging of the two structures

(Lippincott-Schwartz et al., 1989, 1990). The intracellular

accumulation of secreted markers such as secGFP may

then result secondarily from the inability of this fused

organelle to sustain anterograde transport to post-Golgi

compartments. However, tubulation of the GFP expressing

Golgi at the confocal level was not seen in any of our

experiments, though considering the close physical prox-

imity of the two organelles and the possibility that sites of



membrane exchange are localised and transient, any such

tubules may well be missed.

As previously reported, the BFA phenotype can easily be

reversed on removal of the drug (Boevink et al., 1998;

Satiat-Jeunemaitre and Hawes, 1992) with the Golgi

reforming, over a number of hours, apparently from the

ER network. Surprisingly there was also some reformation

of Golgi-like structures in the presence of cycloheximide,

which suggests that the proteins required for Golgi

reformation, including the many that are required to

sustain ER to Golgi transport (Andreeva et al., 2000), can

retain activity over the time course of such an experiment.

A feature of BFA treated cells was the appearance of

mitotic pro®les due to extensive ER ¯uorescence, con®rm-

ing the extensive accumulation of ER at the mitotic spindle

poles, around the spindle and at the phragmoplasts, as

previously reported by electron microscopy (Hawes et al.,

1981) and immunolabelling (Gunning and Steer, 1996).

Such a result indicates that redistribution of membrane

from the Golgi to the ER can take place during the division

process and that the membrane protein can disperse

around the ER into areas that were previously devoid of

Golgi (compare Figure 3f and Figure 3i). Alternatively, and

in our opinion a more unlikely scenario, is that BFA treated

cells could continue the mitotic process in the absence of

functional Golgi stacks. It is accepted that in mammalian

cells during mitosis, anterograde export from the ER is

inhibited and the Golgi is dispersed (Lippincott-Schwartz

and Zaal 2000), but experiments with GFP tagged galacto-

syl transferase have shown continued retrograde transport

of the construct into the ER during early stages of mitosis

resulting in a complete reabsorption of Golgi enzymes into

the ER (Zaal et al., 1999). In plant cells Golgi bodies remain

intact during mitosis and cytokinesis and there is no

information as to whether the secretory pathway is

inactivated at any stage during the division process.

Interestingly NebenfuÈ hr et al. (2000) reported faint ER

¯uorescence during anaphase in a BY2 line expressing a

soybean a-1,2-mannosidase-GFP chimera. One explan-

ation was that this represented an up-regulation of the

retrograde pathway during mitosis. However, in our ST-

GFP cells we saw no evidence of ER ¯uorescence during

mitosis and cytokinesis (Figure 3d). The distribution of ER

at the spindle poles, around the spindle apparatus and at

the phragmoplast revealed by BFA treatment, corres-

ponded exactly to that previously reported in non-drug

treated plant cells by electron microscopy (Hawes et al.,

1981), by immuno¯uorescence (Gunning and Steer, 1996)

and with a GFP-HDEL construct (NebenfuÈ hr et al., 2000).

The cytoskeletal networks do not mediate the BFA effect

Transport from the ER to the Golgi in mammalian cells is

mediated by the microtubule cytoskeleton and is sensitive

to microtubule inhibitors (Thyberg and Moskalewski,

1999). However, as it has previously been shown that

actin is responsible for Golgi positioning and movement in

plant cells (Boevink et al., 1998; NebenfuÈ hr et al., 1999;

Satiat-Jeunemaitre et al., 1996), the role of the cytoskeleton

in the BFA effect in leaves and BY2 cells was investigated.

Both F-actin inhibiting drugs, cytochalasin D and latruncu-

lin B suppressed Golgi movement as expected but sur-

prisingly did not inhibit the retrograde transport of ST-GFP

in the presence of BFA. This indicates that an actin network

is not required for the BFA induced redistribution of Golgi

to ER. Likewise the microtubule depolymerising drug

oryzalin did not inhibit either Golgi movement or the

BFA effect. Recovery of Golgi bodies was observed on

removal of BFA after depolymerisation of the cytoskeleton

indicating that formation of new Golgi membrane from the

ER is also independent of the microtubule and actin

networks. Therefore, it is tempting to speculate that direct

transport from the ER to the Golgi, in the systems

investigated here, may be free from cytoskeletal regulation

even though their motility is actin dependent. This could

well be a consequence of the close proximity of the two

organelles to each other, moving over actin tracks,

indicating a fundamental difference between plant and

mammalian early secretory pathways.

In the leaf system it has been shown that the Golgi

stacks and ER are very closely aligned (Batoko et al., 2000;

Boevink et al., 1998). So much so that only very rarely can

Golgi stacks be visualised apart from an ER tubule or

lamellar region in the slower streaming cortical cytoplasm.

As a result of this observation the `vacuum cleaner' model

for Golgi ER exchange has been postulated, whereby the

Golgi stacks travel over the ER network picking up

products from the ER either through direct connections,

tubules or vesicles (Boevink et al., 1998; Hawes et al.,

1999a). An alternative `recruitment' model, based on the

fact that some Golgi stacks undergo periods of stasis on

ER tubules, suggests they rest, in response to a `stop'

signal, to pick up vesicles produced at exit sites on the ER

(NebenfuÈ hr and Staehelin 2001; NebenfuÈ hr et al., 1999).

This is in effect a close range and transient version of the

mammalian model of ER to Golgi traf®c. The results

presented here indicate that the short distance travelled by

any cargo-carrying vector between ER and Golgi is insuf-

®cient to warrant a mechanochemical motor system based

on the cytoskeleton. Therefore, one has to postulate a

short-range regulated transport of ER derived vesicles or

some form of direct connection between the two orga-

nelles either permanent or transient. As we also show BFA

induced redistribution and recovery of the Golgi can take

place when Golgi bodies are static, they must halt at

putative exit sites, if these events depend on normal

retrograde traf®cking pathways. Previously it has been

shown that on disruption of the actin cytoskeleton with



cytochalasin D, Golgi clustered on small islands of ER

lamellae at the vertices of the tubules of the polygonal

cortical network (Boevink et al., 1998). How these struc-

tures relate to exit sites has yet to be determined. It is

therefore pertinent to investigate the location and role of

the gamut of accessory proteins such as Rab1, Sar1 and

Sec12, that regulate the formation of putative ER/Golgi

transport vesicles in leaves and also in a system that is not

so spatially limited.

One of the advantages of the transient expression

system in leaves described in this and previous papers

(Andreeva et al., 2000; Batoko et al., 2000) is that not only

can a number of different constructs be tested quickly, but

also several genes can be co-expressed at the same time,

such as the combination of GFP and DsRed tagged

proteins. Also the system enables the testing of the

function of regulatory proteins within the secretory path-

way. In a recent publication Batoko et al. (2000) presented

the ®rst evidence for the membrane traf®cking function of

a plant Rab GTPase in plant cells. Expression of

AtRab1b(N121I) inhibited transport of a secretory form of

GFP and the membrane bound glycosylated form of ST-

GFP (N-ST-GFP) out of the ER. Here we have shown that

expression of the same mutant Rab1, which is defective in

its ability to be converted to the active GTP-bound form,

suppresses the recovery of Golgi after BFA treatment but

has no effect on the retrograde transport of ST-GFP back to

the ER. This indicates that even if the transport distance

between ER and Golgi is minimal, regulatory proteins still

exert a level of control over the ER to Golgi transport step.

Experimental procedures

Construction of AtERD2-GFP

The binary vector pVKH18En6-GUS was generated by insertingthe expression cassette of pE6113-GUS (gift of M. Ugaki, Ibaraki,Japan; see Mitsuhara et al., 1996) as a PvuII and HindIII into theSacI and HindIII sites of the polylinker of binary vector pVKH18, aderivative of pVK18 (Moore et al., 1998) where the methotrexateresistance marker of pVK18 had been replaced by an hygromycinselectable marker (Zheng and Moore, unpublished). To createpVKH18En6-ERD2-GFP, the coding sequence of GFP5 (Haseloffet al., 1997) was ampli®ed from pBINmGFP5ER (kindly providedby J. Haseloff, Cambridge, UK) by PCR using primers GFP5¢: 5¢-tttaagcttcctgcgtcgactttcagtaaaggagaagaacttttca and GFP3¢: 5¢-tttggatccttacaaatcctcctcagagataagtttctgctctttgtatagttcatccatgc (c-myc epitope tag sequence is in italics). The cDNA encoding theArabidopsis H/KDEL receptor ± AtERD2 ± (provided by N. Raikhel,Michigan, USA) was inserted as a HindIII fragment at the HindIIsite introduced into the 5¢ end of GFP5. The GFP-fusion wassubcloned in pVKH18En6 as a BamHI fragment, replacing theGUS coding region of the E6113 cassette to generate plasmidpVKH-ERD2-GFP.

Construction of STtmd-GFP, STtmd-DsRed and GTtmd-

GFP

The trans-membrane domain and short cytoplasmic tail (52amino acids) of a rat a-2,6-sialyltransferase (gift of S. Munro,Cambridge, UK) was ampli®ed by PCR (ST5¢: 5¢-aaatctagaccat-gattcataccaacttgaag; ST3¢: 5¢-ccaaagtcgacatggccactttctcctg) andfused to the 5¢ end of GFP5 in place of ERD2 in p pVKH-ERD2-GFPusing SalI and XbaI restriction sites, in pVKHEn6Erd2 plasmid.DsRed (BD Clontech UK, Cat. # 6923±1) was ampli®ed by PCR(RFP5¢- ggcggcgtcgactatgaggtcttccaagaatgttatcaaggagttcatgagg;RFP3¢: 5¢-gcgcggggatccctaaaggaacagatggtggcgt-ccctcgg). GFP5was then replaced by DsRed (BD Clontech UK, Cat. # 6923±1)using SalI and BamHI restriction sites.

The trans-membrane domain and short cytoplasmic tail (60amino acids) of a human b-1,4-galactosyltransferase (gift of J.Lippincott-Schwartz, Bethesda, USA) was ampli®ed by PCR (GT5¢:5¢aaaatctagaccatgaggcttcgggagccg; GT3¢: 5¢aaaaagtcgactgcagc-ggtgtggagactccg) and fused to the 5¢ end of GFP5 at the place ofERD2 using SalI and XbaI restriction sites, in the pVKH-Erd2-GFPplasmid.

Agrobacterium-mediated BY2 cells transformation

pBINPLUS, which carries a kanamycin resistance marker, wasused to select transgenic BY2 cells. ST-GFP was subcloned inpBINPLUS using HindIII and BglII/BamH I restriction sites(Figure 1). The construct derived (pBIN-ST-GFP) was transferredinto Agrobacterium (strain GV3101 pMP90, Koncz and Schell,1986) by electroporation. Transgenic Agrobacterium were se-lected on YEB medium (per litre: beef extract 5 g, yeast extract1 g, sucrose 5 g, MgSO4±7H2O 0.5 g) containing kanamycin(100 mgml±1) and gentamycin (10 mgml±1) and were used totransform BY-2 cells, as described in Gomord et al. (1998).Transformed tobacco cells were selected in the presence ofkanamycin (100 mgml±1) and cefotaxime (250 mgml±1). Afterscreening by ¯uorescence microscopy and immunodetection,calli expressing ST-GFP were used to initiate suspension culturesof transgenic cells.

Agrobacterium-mediated transient expression in

Nicotiana tabacum

pVHK18En6GFP fusions transformed A. tumefaciens was culturedat 28°C, until the stationary phase ( approximately 24 h), washedand resuspended in in®ltration medium (MES 50 mM pH 5.6,glucose 0.5% (w/v), Na3PO4 2 mM, acetosyringone (Aldrich)100 mM from 10 mM stock in absolute ethanol). The bacterialsuspension was pressure injected into the abaxial epidermis ofplant leaves using a 1-ml plastic syringe by pressing the nozzleagainst the lower leaf epidermis (Hawes et al., 1999b). Plants wereincubated for 2±3 days at 20±25°C. GFP ¯uorescence was detectedby illuminating leaves with a long wavelength UV lamp.

Cycloheximide treatments

Tobacco leaves were incubated for 3 days after in®ltration withAgrobacterium transformed with pVKH-secGFP (see Batoko et al.,2000) resulting in the expression of a secreted form of GFP. Leafsegments were then incubated in 100 mm cycloheximide, 180 mmBFA (from 36 mM stock in DMSO, Sigma) or a mixture of BFA andcycloheximide for 3-4 h before confocal analysis.



Brefeldin A and cytoskeletal inhibitor treatments

All the experiments were carried out using 3- to 4-day-old-cells or2-3 day post-infection leaves. BFA was kept as a 36-mM stocksolution in DMSO, at ±20°C. BY2 cells were resuspended in culturemedium with brefeldin A (36 or 180 mM). Transfected leafsegments were incubated in a solution of brefeldin A (180 mM).For time-lapse visualisation of BFA on BY2 cells, cells were lain ona thin layer of 2% agar made with culture medium on a slide, BFAadded and the cells viewed immediately by confocal microscopyusing the Zeiss LSM410 time lapse software.

Leaves transiently expressing a myc-tagged, glycosylated N-GFP-HDEL construct were treated with BFA (180 mM for 3 h) andproteins extracted to biochemically test the retrograde transportof Golgi enzymes. Extraction, endoglycosidase H (endo H) treat-ment and immuno-blot analysis were as previously described inBatoko et al. (2000).

Cytochalasin D (Sigma, 1.97 mM stock in DMSO, ±20°C) orlatrunculin B (Calbiochem, 1 mM stock in DMSO, ±20°C) was usedto depolymerise actin. BY2 cells were resuspended in culturemedium containing cytochalasin D (39.4 mM) or latrunculin B(25 mM). Transfected leaf discs were incubated in a solution ofcytochalasin D (39.4 mM) or latrunculin B (10±25 mM). To disruptmicrotubules, BY2 cells were resuspended in culture mediumcontaining 28.9 mM oryzalin (Dow Elanco) from a stock solution(0.15 M in acetone). Transfected leaf discs were incubated in asolution of oryzalin (28.9 mM). Controls contained an equivalentconcentration of DMSO or acetone.

Immunolabelling

For microtubules, BY2 cells were ®xed for 1 h in 4% (w/v)paraformaldehyde (PFA) in microtubule stabilising buffer(MTSB, 0.1 M PIPES, pH 6.9, EGTA 10 mM, MgSO4 10 mM), weredigested for 20 min in 1% (w/v) cellulase (Onozuka R10, YakultHonusha Co. Ltd, Japan), 0.1% (w/v) pectinase (Sigma), 1% (w/v)BSA in buffer, and were permeabilised with 0.5% (v/v) Triton X-100 in MTSB, for 15 min. For immunolocalisation, cells weretreated with 1% BSA and 1% ®sh gelatin before incubation withanti a-tubulin (YOL1/34, Serotec, UK) (diluted 1 : 20) for 2 h atroom temperature followed by incubation with Texas-Red-conju-gated goat antirat antibodies (Molecular Probes) for 1 h at roomtemperature, washing and mounting in Citi¯uor antifade (AgarScienti®c, UK). For Golgi labelling, cells were incubated in thepresence of JIM84 culture supernatant (Horsley et al., 1993) for 2 hat room temperature followed by Texas-Red-conjugated antirat asabove.

Actin staining

BY2 cells were pre-incubated for 2 min in 100 mM 3-maleido-benzoyl N-hydroxysuccinimide ester (MBS, Sigma) and 0.025%Triton X-100 to stabilise the actin and permeabilise the cells, andstained in a solution of rhodamine-phalloidin (SIGMA, 10±5

M inMTSB) buffer for 4 min. Excess stain was removed by washes inMTSB.

Expression of AtRab1b(N121I)

Plasmids encoding the Arabidopsis Rab GTPase AtRab1b and thedominant interfering mutant N121I were described in Batoko et al.

(2000). The YFP variant of N-secGFP was constructed by ampli-fying the chitinase signal peptide and synthetic N-glycosylatedpeptide exactly as described for N-secGFP (Batoko et al., 2000)and inserting it as an XbaI ± XhoI fragment into the XbaI and SalIsites upstream of YFP in the plasmid pVKH-N-ST-YFP to generatepVKH-N-secYFP. pVKH-N-ST-YFP is identical to pVKH-N-ST-GFP(Batoko et al., 2000) except that the GFP coding region wasreplaced with a YFP coding region using the SalI and BamHI sites.Co-expression of these constructs with the Golgi-targeted ST-GFPinto tobacco leaf epidemal cells was achieved by Agrobacterium-mediated transient expression. ST-GFP was introduced at OD6000.1, AtRab1b(N121I) at OD600 0.03 and N-secYFP at OD600 0.01.The infected plant was incubated at 20°C for 3 days and samplesfrom infected areas subjected to BFA treatment as describedabove.

Confocal microscopy

All specimens were imaged with a Zeiss LSM-410 or LSM 510confocal laser scanning microscope (CLSM) with a 488-nm argonion laser and a 510±525 or 505±530 nm bypass ®lter to excludechlorophyll auto¯uorescence. Texas-Red and rhodamine wereexcited with a 543-nm argon ion laser line with a 570-nm bypass®lter.

Note added in proof

In a recently published paper immuno¯uorescence and proteinblot labelling of BY2 cells expressing a GFP-Golgi marker hasdemonstrated a relatively rapid loss of g-COP and a slower loss ofArf1 from Golgi in BFA treated cells (Ritzenthaler et al., 2002).

Acknowledgements

We acknowledge the BBSRC for a grant to CH supporting thiswork. Jennifer Lippincott-Schwartz (NIH Bethesda) for the b1±4galactosyl transferase, Jim Haseloff (Cambridge) for pBINmGFP5ER, Huanquan Zheng (Oxford Brookes) for the sec-GFPconstruct and Ulla Neumann (Oxford Brookes) for taking imagesin Figure 1i-k.

References

Allan, V.J. and Schroer, T.A. (1999) Membrane motors. Curr. Op.Cell Biol. 11, 476±482.

Andreeva, A.V., Zheng, H., Saint-Jore, C.M., Kutuzov, M.A.,Evans, D.E. and Hawes, C. (2000) Organization of transportfrom the endoplasmic reticulum to the Golgi in higher plants.Biochem. Soc. Trans. 28, 505±512.

Baldwin, T.C., Handford, M.G., Yuseff, M.-I., Orellana, A. andDupreee, P. (2001) Identi®cation and characterization ofGONST1, a Golgi-localised GDP-mannose transporter inArabidopsis. Plant Cell 13, 2283±2295.

Bar-Peled, M., da Silva ConceicË |o, A., Frigerio, L. and Raikhel, N.V.(1995) Expression and regulation of aERD2, a gene encodingthe KDEL receptor homolog in plants, and other genesencoding protein involved in ER-Golgi vesicular traf®cking.Plant Cell 7, 667±676.

Batoko, H., Zheng, H.-Q., Hawes, C. and Moore, I. (2000) A Rab1GTPase is required for transport between the endoplasmicreticulum and Golgi apparatus and for normal Golgimovements in plants. Plant Cell 12, 2201±2218.



Boevink, P., Martin, B., Oparka, K., Santa Cruz, S. and Hawes, C.(1999) Transport of virally expressed green ¯uorescent proteinthrough the secretory pathway in tobacco leaves is inhibited bycold shock and brefeldin A. Planta 208, 392±400.

Boevink, P., Oparka, K., Santa Cruz, S., Martin, B., Betteridge, A.and Hawes, C. (1998) Stacks on tracks: the plant Golgiapparatus traf®cs on an actin/ER network. Plant J. 15, 441±447.

Boevink, P., Santa Cruz, S., Hawes, C., Harris, N. and Oparka, K.J.(1996) Virus-mediated delivery of the green ¯uorescent proteinto the endoplasmic reticulum of plant cells. Plant J. 10, 935±941.

Buss, F., Kendrick-Jones, J., Lionne, C., Knight, A.E., Cote, G.P.and Luzio, J.P. (1998) The localization of myosin VI at the Golgicomplex and leading edge of ®broblasts and itsphosphorylation and recruitment into membrane ruf¯es ofA431 cells after growth factor stimulation. J. Cell Biol. 143,1535±1545.

Donaldson, J.G., Finazzi, D. and Klausner, R.D. (1992) Brefeldin Ainhibits Golgi membrane-catalyzed exchange of guaninenucleotide onto ARF protein. Nature 360, 350±352.

Essl, D., Dirnberger. D., Gomord, V., Strasser, R., Faye, L., GloÈ ssl,J. and Steinkellner, H. (1999) The N-terminal 77 amino acidsfrom tobacco N-acetylglucosoaminyltransferase I are suf®cientto retain a reporter protein in the Golgi apparatus of Nicotianabenthamiana cells. FEBS Lett. 453, 169±173.

Fitchette, A.-C., Cabanes-Macheteau, M., Marvin, L., Martin, B.,Satiat-Jeunemaitre, B., Gomord, V., Crooks, K., Faye, L. andHawes, C. (1999) Biosynthesis and immunolocalization of Lewisa-containing N-glycans in the plant cell. Plant Physiol. 121, 333±343.

Gomord, V., Fitchette-LaineÂ , A.-C., Michaud, D. and Faye, L.(1998) Production of foreign proteins in tobacco suspensionculture. In: Methods in Biotechnology, Vol. 3 (Cunningham C.and Porter, A.J.R. eds). Humana Press, Towota, NJ. pp. 155±164.

Gunning, B.E.S. and Steer, M.W. (1996) Plant Cell Biology:Structure and Function. Boston: Jones and Bartlett Publishers.

Harada, A., Takei, Y., Kanai, Y., Tanaka, Y., Nonaka, S. andHirokawa, N. (1998) Golgi vesiculation and lysosomedispersion in cells lacking cytoplasmic dynein. J. Cell Biol.141, 51±59.

Hara-Nishimura, I., Schimada, T., Hatano, K., Takeuchi, Y. andNishimura, M. (1998) Transport of storage proteins to proteinstorage vacuoles is mediated by large precursor accumulatingvesicles. Plant Cell 10, 825±836.

Harris, N. and Oparka, K. (1983) Connections betweendictyosomes, ER and GERL in cotyledons of mung bean(Vigna radiata L.). Protoplasma 114, 93±102.

Haseloff, J., Siemering, K.R., Prasher, D.C. and Hodge, S. (1997)Removal of a cryptic intron and subcellular localization of green¯uorescent protein are required to mark transgenic Arabidopsisplants brightly. Proc. Natl Acad. Sci. USA 94, 2122±2127.

Hawes, C., Boevink, P. and Moore, I. (1999b) Green ¯uorescentprotein in plants. In: Protein Localization by FluorescenceMicroscopy: a Practical Approach. (Allen, V. ed). Oxford:Oxford University Press, pp. 163±177.

Hawes, C.R., Brandizzi, F. and Andreeva, A. (1999a)Endomembranes and vesicle traf®cking. Curr. Op. Plant Biol.2, 454±461.

Hawes, C., Faye, L. and Satiat-Jeunemaitre, B. (1996) The Golgiapparatus and pathways of vesicle traf®cking. In: Membranes:Specialized Functions in Plants (Smallwood, M., Knox J.P. andBowles, D.J., eds). Oxford: Bios Scienti®c Publishers, pp. 337±365.

Hawes, C.R., Juniper, B.E. and Horne, J.C. (1981) Low and high

voltage electron microscopy of mitosis and cytokinesis in maizeroots. Planta 152, 397±407.

Helms, J.B. and Rothman, J.E. (1992) Inhibition by Brefeldin A of aGolgi membrane that catalyses exchange of guanine nucleotidebound ARF. Nature, 360, 352±354.

Horsley, D., Coleman, J., Evans, D., Crooks, K., Peart, J., Satiat-Jeunemaitre, B. and Hawes, C. (1993) A monocolonal antibody,JIM 84, recognizes the Golgi apparatus and plasma membranein plant cells. J. Exp. Bot. 44, 223±229.

Klausner, R.D., Donaldson, G.J. and Lippincott-Schwartz, J.(1992) Brefeldin A: Insights into the control of membranetraf®c and organelle structure. J. Cell Biol. 116, 1071±1080.

Klumperman, J. (2000) Transport between ER and Golgi. Curr. Op.Cell Biol. 12, 445±449.

Koncz, C. and Schell, J. (1986) The promoter of T-DNA gene 5controls the tissue-speci®c expression of chimeric genescarried by a novel type of Agrobacterium binary vector. Mol.General Genet. 204, 383±396.

Liebe, S. and Quader, H. (1994) Myosin in onion (Allium cepa)bulb scale epidermal cells: involvement in dynamics oforganelles and endoplasmic reticulum. Physiol. Plant. 90,114±124.

Lippincott-Schwartz, J., Donaldson, J.G., Schweizer, A., Berger,E.G., Hauri, H.D., Yuan, L.C. and Klausner, R.D. (1990)Microtubule-dependant retrograde transport of proteins intothe ER in the presence of Brefeldin A suggests an ER recyclingpathway. Cell 80, 821±836.

Lippincott-Schwartz, J., Yuan, L., Bonifacino, J. and Klausner, R.(1989) Rapid redistribution of Golgi proteins into the ER in cellstreated with Brefeldin A: evidence for membrane recycling fromGolgi to ER. Cell 56, 801±813.

Lippincott-Swartz, J. and Zaal, K.J.M. (2000) Cell cyclemaintenance and the biogensis of the Glgi complex.Histochem. Cell Biol. 114, 93±103.

Mansour, S.J., Skaug, J., Zhao, X.-H., Giordana, J., Scherer, S.W.and MelancËon, P. (1999) p200 ARF-GEP1: a Golgi-localizedguanine nucleotide exchange protein whose Sec7 domain istargeted by the drug brefeldin A. Proc. Natl Acad. Sci. USA 96,7968±7973.

Matz, M.V., Fradkov, A.F., Labas, Y.A., Savitsky, A.P., Zaraisky,A.G., Markelov, M.L. and Lukyanov, S.A. (1999) Fluorescentproteins from nonbioluminescent Anthozoa species. NatureBiotech. 17, 969±973.

Mitsuhara, I., Ugaki, M., Hirochika, H., Ohshima, M., Murakami,T., Gotoh, Y., Katayose, Y., Nakamura, S., Honkura, R.,

Nishimiya, S., Ueno, K., Mochizuki, A., Tanimot, H., Tsukawa,H., Otsuki, Y. and Ohashi, Y. (1996) Ef®cient promoter cassettesfor enhanced expression of foreign genes in dicotyledonousand monocotyledonous plants. Plant Cell Physiol. 37, 49±59.

Moore, I., Galweiler, L., Grosskopf, D., Schell, J. and Palme, K.(1998) A transcription activation system for regulated geneexpressioon in transgenic plants. Proc. Natl Acad. Sci. USA 95,376±381.

Movafeghi, A., Happel, N., Pimpl, P., Tai, G.H. and Robinson, D.G.(1999) Arabidopsis Sec21p and Sec23p homologs. Probablecoat proteins of plant COP-coated vesicles. Plant Physiol. 119,1437±1445.

NebenfuÈ hr, A., Frohlick, J.A. and Staehelin, L.A. (2000)Redistribution of Golgi stacks and other organelles duringmitosis and cytokinesis in plant cells. Plant Physiol. 124, 135±151.

NebenfuÈ hr, A., Gallagher, L.A., Dunahay, T.G., Frohlick, J.A.,Mazurkiewicz, A.M., Meehl, J.B. and Staehelin, L.A. (1999)



Stop-and-go movements of plant Golgi stacks are mediated bythe acto-myosin system. Plant Physiol. 121, 1127±1141.

NebenfuÈ hr, A. and Staehelin, L.A. (2001) Mobile factories: Golgidynamics in plant cells. Trends Plant Sci. 6, 160±167.

Peyroche, A., Antonny, B., Robineau, S., Acker, J., Cher®ls, J. andJackson, C.L. (1999) Brefeldin A acts to stabilize an abrortiveARF-GDP-sec7 domain protein complex: Involvement ofspeci®c residues of the sec7 domain. Mol Cell. 3, 275±285.

Pimpl, P., Movafeghi, A., Coughlan, S., Denecke, J., Hillmer, S.and Robinson, D.G. (2000) In situ localization and in vitroinduction of plant COPI-coated vesicles. Plant Cell 12, 2219±2236.

Quader, H. (1990) Formation and disintegration of cisternae of theendoplasmic reticulum visualized in live cells by conventional¯uorescence and confocal laser scanning microscopy: evidencefor the involvement of calcium and the cytoskeleton.Protoplasma 155, 166±175.

Ritzenthaler, C., NebenfuÈ r, A., Movafeghi, A., Stussi-Garaud, C.,Behnia, L., Pimpl, P., Staehelin, L.A. and Robinson, D.G. (2002)Reevaluation of the effects of brefeldin A on plant cells usingtobacco bright yellow 2 cells expressing Golgi-targeted green¯uorescent protein and COPI antisera. Plant Cell 14, 237±261.

Robineau, S., Chabre, M. and Antonny, B. (2000) Binding site ofbrefeldin A at the interface between the small G protein ADP-ribosylation factor 1 (ARF1) and the nucleotide-exchange factorSec 7 domain. Proc. Natl Acad. Sci. USA 97, 9913±9918.

Roghi, C. and Allan, V.J. (1999) Dynamic association ofcytoplasmic dynein heavy chain 1a with the Golgi apparatusand intermediate compartment. J. Cell Sci. 112, 4673±4685.

Rutten, T.L.M. and Knuiman, B. (1993) Brefeldin A effects ontobacco pollen tubes. Eur. J. Cell Biol. 61, 247±255.

Sata, M., Donaldson, J.G., Moss, J. and Vaughan, M. (1998)Brefeldin A-inhibited guanine nucleotide-exchange activity of

Sec7 domain from yeast Sec7 with yeast and mammalian ADPribosylation factors. Proc. Natl Acad. Sci. USA 95, 4204±4208.

Satiat-Jeunemaitre, B., Cole, L., Bourett, T., Howard, R. andHawes, C. (1996) Brefeldin A effects in plant and fungal cells:Something new about vesicle traf®cking? J. Microsc. 181, 162±117.

Satiat-Jeunemaitre, B. and Hawes, C. (1992) redistribution of aGolgi glycoprotein in plant cells treated with Brefeldin A. J. CellSci. 103, 1153±1166.

Seeman, J., Jokitalo, E., Pypaert, M. and Warren, G. (2000) Matrixproteins can generate the higher order architecture of the Golgiapparatus. Nature 407, 1022±1026.

Staehelin, L.A. and Driouich, A. (1997) Brefeldin A effects inplants. Plant Physiol. 114, 410±403.

Takeuchi, M., Ueda, T., Sato, K., Abe, H., Nagata, T. and Nakano,A. (2000) A dominant negative mutant of Sar1 GTPase inhibitsprotein transport from the endoplasmic reticulum to the Golgiapparatus in tobacco and Arabidopsis cultured cells. Plant J. 23,517±525.

Thyberg, J. and Moskalewski, S. (1999) Role of microtubules inthe organisation of the Golgi complex. Exp. Cell Res. 246, 263±279.

Wee, E.-G., Sherrier, D.J., Prime, T. and Dupree, P. (1998)Targeting of active sialyltransferase to the plant Golgiapparatus. Plant Cell 10, 1759±1768.

Yasuhara, H., Sonobe, S. and Shibaoka, H. (1995) Effects ofBrefeldin-a on the formation of the cell plate in tobacco BY-2cells. Europ, J. Cell Biol. 66, 274±281.

Zaal, K.J.M., Smith, C.L., Polishchuk, R.S., Altan, N., Cole, N.B.,Ellenberg, J., Hirschberg, K., Preseley, J.F., Roberts, T.H.,Siggia, E., Phair, R.D. and Lippincott-Schwartz, J. (1999) Golgimembranes are absorbed into and reemerge from the ERduring mitosis. Cell 99, 599±601.



the plant journal (2002) 29 redistribution of membrane ...fb/saint-jore.pdf664 claude m. saint-jore...

Documents