the peroxisome proliferator-activated receptor agonist ... · pdf filevery low-density...

The Peroxisome Proliferator-Activated Receptor �/�Agonist, GW501516, Regulates the Expression ofGenes Involved in Lipid Catabolism and EnergyUncoupling in Skeletal Muscle Cells

UWE DRESSEL, TAMARA L. ALLEN, JYOTSNA B. PIPPAL, PAUL R. ROHDE, PATRICK LAU, AND

GEORGE E. O. MUSCAT

Institute for Molecular Bioscience, The University of Queensland, St. Lucia, Queensland 4072,Australia

Lipid homeostasis is controlled by the peroxisomeproliferator-activated receptors (PPAR�, -�/�, and-�) that function as fatty acid-dependent DNA-binding proteins that regulate lipid metabolism. Invitro and in vivo genetic and pharmacological stud-ies have demonstrated PPAR� regulates lipid ca-tabolism. In contrast, PPAR� regulates the con-flicting process of lipid storage. However, relativelylittle is known about PPAR�/� in the context oftarget tissues, target genes, lipid homeostasis, andfunctional overlap with PPAR� and -�. PPAR�/�, avery low-density lipoprotein sensor, is abundantlyexpressed in skeletal muscle, a major mass pe-ripheral tissue that accounts for approximately40% of total body weight. Skeletal muscle is ametabolically active tissue, and a primary site ofglucose metabolism, fatty acid oxidation, and cho-lesterol efflux. Consequently, it has a significantrole in insulin sensitivity, the blood-lipid profile,and lipid homeostasis. Surprisingly, the role ofPPAR�/� in skeletal muscle has not been investi-gated. We utilize selective PPAR�, -�/�, -�, andliver X receptor agonists in skeletal muscle cells tounderstand the functional role of PPAR�/�, and thecomplementary and/or contrasting roles of PPARsin this major mass peripheral tissue. Activation ofPPAR�/� by GW501516 in skeletal muscle cells

induces the expression of genes involved in pref-erential lipid utilization, �-oxidation, cholesterol ef-flux, and energy uncoupling. Furthermore, weshow that treatment of muscle cells withGW501516 increases apolipoprotein-A1 specificefflux of intracellular cholesterol, thus identifyingthis tissue as an important target of PPAR�/� ago-nists. Interestingly, fenofibrate induces genes in-volved in fructose uptake, and glycogen formation.In contrast, rosiglitazone-mediated activation ofPPAR� induces gene expression associated withglucose uptake, fatty acid synthesis, and lipid stor-age. Furthermore, we show that the PPAR-depen-dent reporter in the muscle carnitine palmitoyl-transferase-1 promoter is directly regulated byPPAR�/�, and not PPAR� in skeletal muscle cellsin a PPAR� coactivator-1-dependent manner. Thisstudy demonstrates that PPARs have distinct rolesin skeletal muscle cells with respect to the regula-tion of lipid, carbohydrate, and energy homeosta-sis. Moreover, we surmise that PPAR�/� agonistswould increase fatty acid catabolism, cholesterolefflux, and energy expenditure in muscle, andspeculate selective activators of PPAR�/� mayhave therapeutic utility in the treatment of hyper-lipidemia, atherosclerosis, and obesity. (MolecularEndocrinology 17: 2477–2493, 2003)

LIPID HOMEOSTASIS IS regulated by dietary in-take, de novo synthesis, catabolism, and lifestyle.

Disorders of lipid metabolism are associated with hy-perinsulinemia, and anomalous levels of the lipid triad,

i.e. low high-density lipopoprotein (HDL) cholesterol,high low-density lipoprotein (LDL) cholesterol, and el-evated serum triglycerides. The increased incidence ofcardiovascular disease has been linked to dyslipi-demias associated with diet and lifestyle. Insulin resis-tance, diabetes, atherosclerosis, obesity, and hyper-tension are comorbidities with these lipid disorders,which are collectively described as “syndrome X.”HDLs have a defensive role in the prevention of athero-

Abbreviations: ABC, ATP binding cassette; ACS, acyl-CoAsynthetase; ADRP, adipocyte differentiation-related protein;ApoE, apolipoprotein; CD36/FAT, FA translocase; CMB, con-fluent myoblasts; CoA, coenzyme A; CPT, carnitine palmitoyltransferase; DMSO, dimethylsulfoxide; FA, fatty acid; FABP,FA binding protein; FAS, fatty acid synthase; FFA, free fattyacids; G-6-P, glucose-6-phosphate; GLUT, glucose trans-porters; GYG1, glycogenin; HDL, high-density lipoprotein;LDL, low-density lipoprotein; LPL, lipoprotein lipase; LUC,luciferase; LXR, liver X receptor; M-CPT1, muscle carnitine-palmitoyl-transferase-1 (M-CPT1); MUFAs, monounsaturatedfatty acids; NR, nuclear hormone receptor; PDC, pyruvate de-hydroxygenase complex; PDK, pyruvate dehydroxygenase

kinases; PGC-1, PPAR� coactivator-1; PMB, proliferatingC2C12 myoblasts; PPAR, peroxisome proliferator-activatedreceptor; PPRE, PPAR-dependent reporter; RXR, retinoid Xreceptor; SCD, stearoyl CoA desaturase; SFAs, saturatedfatty acids; TCA, tricarboxylic acid; tk, thymidine kinase;UCPs, uncoupling proteins; VLDL, very low-densitylipoprotein.

0888-8809/03/$15.00/0 Molecular Endocrinology 17(12):2477–2493Printed in U.S.A. Copyright © 2003 by The Endocrine Society

doi: 10.1210/me.2003-0151

2477Downloaded from https://academic.oup.com/mend/article-abstract/17/12/2477/2747399/The-Peroxisome-Proliferator-Activated-Receptorby gueston 28 September 2017

genic dyslipidemia by mediating cholesterol effluxfrom peripheral tissues. In contrast, the LDLs accu-mulate in the arterial wall leading to atheroscleroticcholesterol-laden foam cells (1).

Research demonstrates the evolution of a multi-layered autoregulated system involving nuclear hor-mone receptors (NRs) for sensing and metabolizingbiologically active lipids. NRs involved in control oflipid and cholesterol homeostasis, include the liver Xreceptors (LXRs), farnesoid X receptor, peroxisomeproliferator-activated receptors (PPARs) �, -�/�, and-� [NR1C1, -2, -3, respectively (2)] liver receptor ho-molog-1 and the small heterodimeric partner (3, 4).

PPARs regulate the transcription of genes involvedin lipid homeostasis, carbohydrate metabolism, en-ergy expenditure and reverse cholesterol transport in asubtype- and tissue-specific manner. They are acti-vated by a wide range of dietary factors, includingsaturated and unsaturated fatty acids (FAs), oxidizedFA metabolites derived through the lipoxygenase andcyclo-oxygenase pathways, and selective syntheticcompounds (e.g. hypolipidemic fibrates, and antidia-betic thiazolidinediones). From the viewpoint ofPPAR�/�, the putative natural agonists are prosta-noids, which are produced by the regulated conver-sion of poly-unsaturated FAs. In addition, PPAR�,-�/�, and -� form obligate and permissive het-erodimers with the retinoid X receptors (RXR) that canalso be activated by the RXR agonists 9-cis-retinoicacid, and/or specific synthetic agonists called rexi-noids (e.g. LG101305).

PPAR� and -� are predominantly expressed in liverand adipose tissue, respectively. The expression ofPPAR�/� is ubiquitous. Moreover, it is very abundantlyexpressed in brain, intestine, skeletal muscle, spleen,macrophages, lung, and adrenals (5–7). Mouse trans-genic, knockout, and knock-in studies coupled topharmacological investigations have exposed the dis-crete physiological functions of the PPAR� and -�isoforms in lipid and carbohydrate metabolism. Forexample, PPAR� promotes adipogenesis and in-creases lipid storage. In contrast, PPAR� enhancesthe conflicting process of lipid catabolism/FA oxida-tion in the liver (5, 6). These physiological functionscorrelate with the hypolipidemic and antidiabetic (typeII) effects of the synthetic and selective fibrate andglitazone drugs, which activate PPAR� and PPAR�,respectively.

Relatively less is known about PPAR�/�, which hasbeen implicated in bone and fat metabolism (8–10).Recently, the potent, synthetic and selective PPAR�/�agonist, GW501516, a phenoxyacetic acid derivative,has been reported (11). It was demonstrated that thetriglyceride component of native very low-density li-poproteins (VLDLs) activate PPAR�/�. GW501516 cor-rects hyperinsulinemia in insulin-resistant and obeseprimates. Furthermore, it raises ABCA1 mRNA expres-sion, and serum HDL cholesterol, while lowering trig-lycerides. However, PPAR�/� agonists also promotelipid absorption and storage in macrophages. More-

over, serum apolipoprotein (Apo) CIII levels and totalcholesterol are raised. Hence, the overall effect ofPPAR�/� agonists on whole body cholesterol ho-meostasis, lipid metabolism, target tissues and modeof action remain unclear (10).

The PPAR�-mediated FA oxidation in the liver playsa major role in ketosis that supports fuel requirementsduring fasting. Similar but distinct mechanisms mustexist within peripheral tissues to implement localizedresponses to energy requirements and burdens inthese tissues. For example, one would hypothesizethat a PPAR� knockout would have major conse-quences on skeletal muscle fuel metabolism and geneexpression. However, Muoio et al. (12) observed theskeletal muscle metabolic/�-oxidation phenotype wasnot compromised in PPAR��/� mice, in contrast tothe dramatic deleterious effects in liver and heart tis-sue. A plausible hypothesis suggests that PPAR�/�regulates fuel metabolism in skeletal muscle, a majormass peripheral tissue that accounts for 40% of thetotal body mass.

Skeletal muscle is one of the most metabolicallydemanding tissues that relies heavily on FAs as anenergy source. PPAR�/� is the most abundant PPARin muscle tissue (12–14). It was first implicated in FAmetabolism from studies using the knockout animals.Most PPAR�/��/� embryos die at an early stage dueto a placental defect, the small number that surviveexhibit a reduction in fat mass/adiposity (8, 15). How-ever, this phenotype is absent in an adipocyte-specificPPAR�/� knockout model, suggesting a complex au-tonomous action regulating systemic lipid metabolism(15, 16). This idea was further strengthened by theobservation that treatment with the synthetic com-pound GW501516 in insulin resistant primates dra-matically improves the serum lipid profile, and im-proves hyperinsulinemia. However, it is unclear whichtissue is the major target for this activity. The classifi-cation of PPAR�/� as sensor of dietary triglyceride innative VLDLs released by lipoprotein lipase (LPL) ac-tivity suggests skeletal muscle is a potential targettissue (17, 18). In addition, exercise and/or starvationinduced up-regulation of FA oxidation genes in muscleremains intact in PPAR��/� mice.

Muscle is a major site of glucose metabolism and FAoxidation. Furthermore, it is an important regulator ofcholesterol homeostasis and HDL levels (19). Conse-quently, it has a significant role in insulin sensitivity, theblood lipid profile, and lipid metabolism. This under-scores the need to define the contribution of this majormass tissue to PPAR�/�. Surprisingly, the fundamen-tal role of PPAR�/� in skeletal muscle cholesterol,lipid, glucose, and energy homeostasis has not beenexamined. Correspondingly, the objective of this studyis to examine the functional role of PPAR�/� in skeletalmuscle, and to investigate the genes and regulatorygenetic programs activated by PPAR�/� involved inthe control of lipid and energy homeostasis.

In summary, we demonstrate that PPAR�/� directlyand/or indirectly regulates genes involved in triglycer-

2478 Mol Endocrinol, December 2003, 17(12):2477–2493 Dressel et al. • PPAR�/� Target Genes in Muscle

Downloaded from https://academic.oup.com/mend/article-abstract/17/12/2477/2747399/The-Peroxisome-Proliferator-Activated-Receptorby gueston 28 September 2017

ide-hydrolysis and FA oxidation [LPL, acyl-coenzymeA (CoA) synthetase 4 (ACS4), carnitine-palmitoyl-transferase (CPT1)], preferential lipid utilization(PDK4), energy expenditure [uncoupling protein(UCP)-1, -2, and -3], and lipid efflux (ABCA1/G1). Fur-thermore, we show that the muscle carnitine-palmi-toyl-transferase-1 (M-CPT1) is directly regulated byPPAR�/� in skeletal muscle, in a PPAR� coactivator-1(PGC-1)-dependent manner. In summary, we showthat PPAR�/� activates the entire cascade of geneexpression involved in lipid-uptake to FA oxidation,and in addition, activates the UCPs, thereby uncou-pling oxidation from the production of energy, andincreasing energy expenditure and thermogenesis.This provides the molecular basis for the lipid loweringeffects of PPAR�/� agonists previously described inobese primates (11), and we speculate that PPAR�/�agonists would have therapeutic utility against a high-fat diet and obesity.

RESULTS

GW501516 Is a Potent Agonist for PPAR�/� inSkeletal Muscle C2C12 Cells

The yet unclear distinct physiological role of PPAR�/�in major mass peripheral tissues led us to investigatethe role of this PPAR subtype in skeletal muscle. Wetherefore performed RT-PCR using total RNA fromC2C12-muscle cells to synthesize mouse PPAR�/�cDNA into the expression vector pSG5 as a tool for ourstudies. Furthermore, to verify the integrity of thecloned PPAR�/� constructs after sequencing, and theefficacy of the PPAR�/� agonist GW501516 (11), weused the GAL4-hybrid system. Full-length PPAR�/�,the C-terminal D/E-domain (that encodes the ligand-binding-domain; LBD), and the N-terminal A/B-region(that encodes the AF-1 domain) were fused to theDNA-binding domain (DBD) of the yeast transcriptionfactor GAL4 (Fig. 1A). If these regions encode func-tional transcriptional activation domains they will in-duce the GAL4-responsive reporter construct, G5E1b-LUC [containing a basal E1b-promoter with five 17-oligomer GAL4-binding sites linked to a luciferase(LUC) reporter gene] in an agonist-dependent mannerin skeletal muscle C2C12-cells and nonmuscleCV1-cells.

We cotransfected the GAL4-PPAR�/�-LBD togetherwith the G5E1b-LUC reporter into CV1-cells and ex-amined the dose-dependent activation by GW501516.A maximum activity is reached at approximately 150nM (with an EC50 �20 nM), in agreement with the studyof Oliver et al. (11) (who reported an EC50 of 24 nM formouse PPAR�/�), thereby validating the potency andefficacy of our agonist preparation, and the integrity ofthe PPAR�/�-cDNA (data not shown). GW501516 (1�M) was used in all latter experiments, as used in allcell culture experiments by Oliver et al. (11) to inducea reproducible maximal PPAR�/� response. Moreover,

at this concentration Oliver et al. demonstrated thatGW501516 was highly selective and did not activate orbind RXR and other nuclear receptors.

Subsequently, we examined the ability of this ago-nist to activate the different PPAR�/�-constructs inCV1 (data not shown) and C2C12 cells (Fig. 1B). Wecotransfected the various GAL4-PPAR�/� constructs(full length, LBD, AF1) together with the G5E1b-LUCreporter into CV1 (data not shown), and C2C12-cells(Fig. 1B), in the presence or absence of GW501516 (1�M). The AF1-domain of PPAR�/� inefficiently acti-vated the LUC reporter, and did not respond to agonisttreatment. In contrast, both GAL4-PPAR�/�, andGAL4-PPAR�/�-LBD-transactivated gene expressionin an efficacious and agonist-dependent manner, inmuscle (Fig. 1B) and nonmuscle cells (data notshown). Similar transactivation patterns were ob-served when using another GAL4-dependent reporterconstruct, tkMH100-LUC, which utilizes the thymidinekinase (tk)-promoter backbone (20) instead of E1b(data not shown).

Subsequently, we examined the ability of thePPAR�/� agonist GW501516 to activate a PPAR-de-pendent reporter (PPRE) in muscle cells. Moreover we

Fig. 1. GW501516 Is a Potent Agonist in Muscle- and Non-muscle Cells

A, Schematic representation of the PPAR�/� constructsused in this study. pSG5-PPAR�/� encoding for full-lengthPPAR�/�, encompassing the entire coding region [440 aminoacids (aa)]; pSV40-GAL4-PPAR�/�, encoding the GAL4-DNA-binding domain fused to full-length PPAR�/�; pSV40-GAL4-PPAR�/�-LBD, encoding the GAL4-DBD fused to theHinge/LBD-Region (aa 138–440); pSV40GAL4-PPAR�/�-AF1, encoding the GAL4-DBD fused to the AF1 (aa 1–72). B,The indicated constructs were transiently transfected to-gether with the G5E1B-LUC reporter into C2C12-musclecells. Twelve hours after transfection, cells were treated for24 h with GW501516 (1 �M), or DMSO as control. LUC activityis shown as relative light units (RLU).

Dressel et al. • PPAR�/� Target Genes in Muscle Mol Endocrinol, December 2003, 17(12):2477–2493 2479


examined the ability of the cofactors PGC-1, p300 andSRC-2/GRIP-1 to coactivate GW501516 dependentactivation of gene expression in skeletal muscleC2C12 cells. We used the PPRE-tk-LUC reporter thatcontains three copies of a consensus binding sitecloned upstream of the heterologous herpes simplexvirus tk promoter linked to the LUC reporter gene.Furthermore, these experiments were performed in theabsence of exogenous/ectopic PPAR�/� expressionvector (because these cells contain endogenousPPAR�/�). As shown in Fig. 2A the PPAR�/� agonistGW501516 activated the expression of the PPRE-containing reporter approximately 2-fold in skeletalmuscle C2C12 cells. No response was observed whenthe tk-LUC-backbone, lacking the PPRE, was used(data not shown). Furthermore, GW501516-depen-dent PPRE activation was enhanced when PGC-1,relative to p300 and SRC-2/GRIP-1, was cotrans-fected. For example, GW501516 activated the expres-sion of the PPRE-reporter approximately 2.5-fold, andapproximately 4-fold in the presence of the RXRagonist.

Subsequently, we validated the ability of the co-factor PGC-1 to coactivate GW501516-PPAR�/�-dependent transactivation of the PPAR-dependent

PPRE-containing reporter in nonmuscle CV-1 cells.Therefore, we cotransfected PPRE-tk-LUC, pSG5-PPAR�/� and the expression vector encoding PGC-1in the presence or absence of the PPAR�/� agonistinto nonmuscle CV1-cells (Fig. 2B). A PPAR�/�- andGW501516-dependent, 4-fold activation of the PPRE-tk-LUC reporter is clearly observed. Furthermore, theexperiment demonstrates the specific coactivation ofPPRE-tk-Luc expression by PGC-1 expression. Thesestudies demonstrate the integrity of the clonedPPAR�/� constructs, and verify the potent and effica-cious function of the GW501516 agonist preparation innonmuscle and skeletal muscle cells. Furthermore, itdemonstrates the selective coactivation of PPAR�/�-mediated gene expression by PGC-1 in skeletal mus-cle cells.

In addition, we further examined the ability ofPPAR� and PPAR� agonists (fenofibrate and rosigli-tazone, respectively) to regulate PPAR-dependentPPRE-containing reporter in muscle cells (Fig. 2C) andnonmuscle CV1 cells (data not shown) in the presenceand absence of the coactivators PGC-1, p300, andSRC-2/GRIP-1. These experiments were performed todemonstrate these agonists regulate gene expressionin skeletal muscle cells, as we subsequently wished to

Fig. 2. PGC-1 Acts as a Transcriptional Coactivator for PPAR�/� in Muscle and Nonmuscle CellsA, Skeletal muscle C2C12 cells which endogenously express PPAR�/� were transfected with PPRE-tk-LUC and the indicated

coactivators (or cDNA3.1 as control) in the absence (Vehicle), or presence of the indicated agonists (RXR: LG101305, 0.1 �M;PPAR�/�, GW501516, 1 �M), or both together (LG & GW). Fold activation is shown relative to the LUC activity obtained aftercotransfection of PPRE-tk-LUC and cDNA3.1 in the absence of agonists. B, Nonmuscle CV1 cells were transiently transfectedwith PPRE-tk-LUC, pSG5-PPAR�/�, and cDNA-PGC-1 in the presence, or absence of GW501516. LUC activity is shown asrelative light units (RLU). C and D, C2C12 cells were transfected with PPRE-tk-LUC and the indicated coactivators in the absence(Vehicle), or presence of the indicated agonists [PPAR�: Fenofibrate (FF); 100 �M, PPAR�: Rosiglitazone (Rosi); 10 �M, RXR: 9-cisretinoic acid (9cRA); 100 nM]. Fold activation is shown relative to the LUC activity obtained after cotransfection of PPRE-tk-LUCand cDNA3.1 in the absence of agonists.



compare the relative effects of PPAR�, -�/�, and -�agonists on the expression of the genes involved inskeletal muscle lipid and carbohydrate metabolism.Figure 2, C and D, clearly demonstrates that PPAR�and -� agonists efficiently regulate gene expression inskeletal muscle cells. In addition, we show that SRC-2/GRIP-1 and PGC-1 selectively coactivate PPAR�and -�, respectively, in skeletal muscle cells (Fig. 2, Cand D). Finally, these experiments demonstrate thatthe C2C12 skeletal muscle cells express functionalPPAR�, -�/�, and -� receptors that support the acti-vation of PPAR-dependent gene expression by selec-tive agonists.

In summary, we demonstrate that PGC-1 expres-sion in C2C12 cells selectively coactivatesGW501516 and Rosiglitazone mediated activationof the PPAR-dependent PPRE. The selective coac-tivation of PPRE expression by cofactors in thepresence of the selective PPAR agonists in the skel-etal muscle cells was performed in the absence ofexogenous/ectopic (high level) receptor expression,and provides an unbiased demonstration of cofactorselectivity, and receptor functionality in skeletalmuscle cells. Clearly, PGC-1 expression in skeletalmuscle cells increases GW501516 and Rosiglita-zone inducibility, and the absolute level of PPRE-dependent expression. In contrast, SRC-2/GRIP1expression preferentially increases Fenofibrate-mediated activation.

Regulation of Gene Expression in Skeletal MuscleCells by PPAR�, -�/�, and -� Agonists

We investigated the expression of the genes involvedin skeletal muscle lipid and carbohydrate metabolism(see Table 1) in the presence and absence of thePPAR�, -�/�, and -� agonists. We undertook thesestudies in the C2C12 skeletal muscle cell culturemodel. In this system, proliferating C2C12 skeletalmyoblasts differentiate into post-mitotic multinucle-ated myotubes that acquire a muscle-specific, con-tractile phenotype. This in vitro system has been usedto investigate the regulation of cholesterol homeosta-sis and lipid metabolism by LXR agonists (19). Muscatet al. demonstrated that the selective and syntheticLXR agonist, T0901317 induced similar effects onmRNAs encoding ABCA1/G1, ApoE, stearoyl CoA de-saturase (SCD-1), SREBP-1c, etc. in differentiatedC2C12-myotubes and Mus musculus quadriceps skel-etal muscle tissue. The physiological validation of thecell culture model in the mouse corroborates the utilityof this model system. This evidence, coupled to theflexibility and utility of cell culture in terms of cost,agonist treatment, RNA extraction, and target valida-tion provides an ideal platform to identify the PPAR�/�-dependent regulation of metabolism. In addition,and more importantly this cell line (16, 21–23) andother rodent skeletal muscle cell lines (13, 14) havebeen demonstrated to express functional PPAR�,

Table 1. Key Target Genes in this Study

ABCA1 and ABCG8 ATP binding cassette. Transporters that transfer cholesterol to the HDL acceptors, i.e.reverse cholesterol efflux.

ACS4 Acyl-CoA synthetase-4. Enhances the uptake of fatty acids by catalyzing theiractivation to acyl-CoA esters for subsequent use in catabolic fatty acid oxidationpathways.

ADRP/Adipophilin Adipocyte differentiation-related protein. Involved in lipid storage.ApoE Apolipoprotein-E. Facilitates cholesterol and lipid efflux.CPT-1 Carnitine palmitoyl transferase-1. Transfers the long-chain fatty acyl group from

coenzyme A to carnitine, the initial reaction of mitochondrial import of long-chainfatty acids and their subsequent oxidation.

FAS Fatty acid synthase. Involved in de novo fatty acid production.FAT/CD36 and FABP3 Fatty acid translocase, and fatty acid binding protein. Facilitate uptake of long chain

fatty acids (LFCAs) and LDLs.GLUT-4 and -5 Glucose transporters. GLUT4 facilitates glucose uptake in response to insulin

stimulation. GLUT5 catalyzes uptake of fructose.Glycogenin/GYG1 Initiates the synthesis of glycogen, the principal storage form of glucose in skeletal

muscle.LPL Lipoprotein lipase. Hydrolysis of lipoprotein triglycerides into free fatty acids and

responsible for the uptake of free fatty acids.PDK-2 and -4 Pyruvate dehydrogenase kinases. Inhibiting the pyruvate dehydroxygenase complex,

thereby controlling glucose oxidation and maintaining pyruvate for gluconeogenesis.SCD-1 and -2 Stearoyl CoA desaturase-1 and -2. Enzymes associated with adiposity, i.e. storage

and esterification of cholesterol, and responsible for the cis saturation of stearoyland palmitoyl-CoA converting them to oleate and palmitoleate, which are themonounsaturated fatty acids of triglycerides.

SREBP-1c Sterol regulatory element binding protein-1c, the hierarchical transcriptional activatorof lipogenesis.

UCP-1, -2, and -3 Uncoupling proteins. Mitochondrial proteins that uncouple metabolic fuel-oxidationfrom ATP synthesis, regulating energy expenditure.



-�/�, and -� receptors. Our quantitative real time anal-ysis in Fig. 3C verifies the published reports that thePPAR mRNAs are expressed in skeletal muscleC2C12 cells. Our analysis demonstrates PPAR� and�/� are expressed at similar levels in 96 h differentiatedmyotube cells. PPAR� mRNA is abundantly ex-pressed, however, the primers reflect mRNA expres-sion from all three PPAR� isotypes (i.e. �1 � �2 � �3).

Proliferating C2C12 myoblasts (PMB), cultured inDMEM supplemented with 20% FCS were grown toconfluency (confluent myoblasts; CMB) and inducedto differentiate into postmitotic multinucleated myo-tubes by serum withdrawal in culture over a 96-h pe-riod. This transition from a nonmuscle phenotype tocontractile phenotype is associated with the repres-sion of nonmuscle proteins concurrent with the acti-vation of the contractile apparatus and metabolic en-

zymes (Fig. 3). We examined the consequences of24 h treatment with agonists for PPAR�/� (GW501516;1 �M), RXR (LG101305; 100 nM), PPAR� (fenofibrate;100 �M), PPAR� (Rosiglitazone; 10 �M) or the vehicle[dimethylsulfoxide (DMSO)] on these predifferentiatedmyotubes. We isolated total RNA from differentiatedmyotubes, which were treated with GW501516 for24 h (compare Fig. 3A), and analyzed the expressionlevels of several mRNAs. Northern blot analysis dem-onstrated the induction of myogenin, repression of thecytoskeletal nonmuscle �-, �-actin, and the activationof the sarcomeric �-actins which confirmed that thesecells had differentiated into myotubes (Fig. 3B). More-over, the repression of cyclin D1, and activation of p21confirmed that these cells were exiting the cell cycleand differentiated terminally. This expression patternis not altered by treatment with the RXR or PPAR�/�agonists (LG101305 or GW501516, respectively), norcotreatment with both agonists. Similarly, PPAR� and-� agonists had minimal (1.5-fold) effects on the myo-genic expression patterns after 24 h treatments (datanot shown). This suggests that these agonists do notsignificantly effect proliferation, cell cycle withdrawaland/or differentiation of these skeletal muscle cells.

Subsequently, we used quantitative real-time PCRto investigate the expression pattern of genes involvedin lipid/cholesterol absorption (CD36/FAT, FABP3; Fig.4A), lipogenesis (SREBP-1c, FAS, SCD-1 and -2; Fig.4B), triglyceride hydrolysis, and FA oxidation (LPL,M-CPT1, ACS4; Fig. 4C), glucose/fructose absorbtionand utilization (Glut-4, and -5; Fig. 4D, PDK-2 and -4;Fig. 4E), lipid efflux (ABCA1 and -G1, ApoE; Fig. 4F),energy expenditure (UCP-1, -2, and -3; Fig. 4G), andglucose and lipid storage (Glycogenin1/GYG1, adi-pophilin/ADRP; Fig. 4H).

The majority of candidate target genes investigatedshowed modest response (�2-fold) to either the RXR,or the PPAR�/� agonist alone. However, the obviousexceptions were the mRNAs for UCP-1 and -2, whichencode UCPs involved in thermogenesis and energy-expenditure (Fig. 4G). UCP-1 and -2 were inducedapproximately 7- and 4-fold, respectively, by treat-ment with the PPAR�/� agonist GW501516. More,importantly, these mRNAs were not induced by ago-nists for PPAR� or -�. Although not abundantly ex-pressed in adult muscle tissue, UCP-1 has been re-ported to be expressed in C2C12-cells (24).

Other candidate mRNAs that showed a modest, butsignificant increase in expression (�2-fold) upon treat-ment with the GW501516 were FABP3 (lipid uptake;Fig. 4A), LPL and M-CPT1 (triglyceride-hydrolysis andFA oxidation, respectively; Fig. 4C), UCP-3 (anothermember of the UCP family, involved in energy expen-diture; Fig. 4G), and ADRP (lipid storage; Fig. 4H). Allof these mRNAs also responded to treatment with theRXR agonist, LG101305, and were synergistically ac-tivated upon treatment with both agonists. Notewor-thy, the level of mRNA encoding for UCP-2 was onlymarginally activated by LG101305, when comparedwith treatment with the PPAR�/� agonist. ADRP

Fig. 3. PPAR�/� and RXR Agonists Do Not Affect MyogenicDifferentiation

A, Schematic illustration of the experimental procedure:PMB were grown in DMEM supplemented with 20% fetal calfserum (FCS). After reaching confluency (CMB) cells weredifferentiated by changing the medium into DMEM supple-mented with 2% adult horse serum (HS) for 4 d. Subse-quently, the myotubes were treated with agonists for RXR(LG101305; 0.1 �M), PPAR�/� (GW501516; 1 �M), both to-gether (LG & GW), or the vehicle (DMSO) as control. After24 h, total RNA was harvested and analyzed using Northernblot experiments or quantitative real-time PCR. B, Northernblot analysis. After blotting, RNA was hybridized with 32P-radiolabeled cDNAs for key-indicators for myogenic differen-tiation (myogenin, sarcomeric �-actin, cytoskeletal �-, and�-actin), cell-cycle exit (cyclin-D1), and terminal differentia-tion (p21). C, Quantitative real-time PCR analysis of PPARexpression levels in muscle cells. Total RNA from differenti-ated myotubes was analyzed for the expression of PPAR�,-�/�, and -�. Expression levels are normalized to GAPDH. Theprimers for PPAR� detect all isoforms for PPAR�.



Fig. 4. Regulation of Gene Expression in Skeletal Muscle Cells by PPAR�, -�/�, and -� AgonistsDifferentiated myotubes were treated as described in Fig. 3A for 24 h with agonists for RXR (LG101305; 100 nM), PPAR�/�

(GW501516; 1 �M), PPAR� (Fenofibrate; 100 �M), PPAR� (Rosiglitazone; 10 �M), or PPAR agonists together with the RXR agonist.After extraction, total RNA was analyzed by quantitative real-time PCR for the expression of genes involved in (A) lipid/cholesterolabsorption (CD36/FAT, FABP3), (B) lipogenesis (SREBP-1c, FAS, SCD-1 and -2), (C) triglyceride hydrolysis, FA transport andoxidation (LPL, M-CPT1, ACS4), (D) glucose transport (Glut-4 and -5), (E) fuel utilization (PDK-2 and -4), (F) lipid efflux (ABCA1and -G1, ApoE), (G) energy expenditure (UCP-1, -2, and -3), and (H) glucose and lipid storage (glycogenin1/GYG1, adipophilin/ADRP). Results are shown as fold induction relative to the respective mRNA level (normalized to GAPDH) in the absence of agonists.



mRNA expression was also induced by rosiglitazonetreatment.

The increase in mRNA expression level subsequentto treatment with both agonists was also observedwith a number of candidate target genes investigated.In the context of lipid and FA uptake, we observed a6-fold increase in the mRNA encoding FABP3, and a2-fold increase in CD36 (Fig. 4A). Some regulators andmarkers of lipogenesis (SREBP-1c, SCD-1 and -2; Fig.4B) were relatively refractory to treatment with one ofthe agonists, but showed significant induction aftercotreatment (�2- to 3-fold). Interestingly, FAS wasreproducibly repressed upon treatment with thePPAR�/� agonist. In contrast, rosiglitazone increasedFAS mRNA expression approximately 2-fold. Interest-ingly, SREBP-1c induction did not result in the induc-tion of the downstream targets, FAS, SCD-1 and -2. Inmuscle, PPAR�/� activation of SREB1c may be un-coupled from FA metabolism, similar to the uncouplingof LXR activity and FA metabolism observed in quad-ricep tissue (19).

The transcripts encoding LPL, M-CPT1, ACS4, andPDK4 that are involved in triglyceride-hydrolysis, FAoxidation and preferential fuel utilization were inducedapproximately 7-, 4-, 3-, and 7-fold by cotreatment,respectively (Fig. 4C). The significance of the syner-gistic activation of LPL and CPT1 by cotreatment withthe PPAR�/� and RXR agonists, are highlighted by theobservation that the cotreatment with agonists forPPAR� and -� in the presence of an RXR agonist doesnot induce LPL and CPT1 expression (Fig. 4C). Inter-estingly, PDK4 mRNA was activated by PPAR�, -�/�,and -� agonists. The glucose, and fructose transport-ers (Glut-4 and -5) were induced by rexinoid treatment,but completely refractory to the PPAR�/� agonist (Fig.4D). In contrast, we observed Glut-4, and -5 were acti-vated by PPAR� and PPAR� agonists, respectively.

As mentioned earlier, cotreatment with agonists forPPAR�/� and RXR led to a dramatic increase in thelevel of mRNAs encoding the UCPs that regulate en-ergy expenditure. UCP-1, -2, and -3 were activatedapproximately 23-, 8-, and 16-fold, respectively (Fig.4G). The significance, and specificity of the UCP-1 to-3 response by cotreatment with PPAR�/� and RXRagonists, are further highlighted by the observationthat the cotreatment with the agonists for PPAR� and-� in the presence of an RXR agonist relatively poorlyinduced UCP-2 and -3 mRNA expression (Fig. 4G).

We also examined the expression of genes in-volved in lipid efflux, lipid storage, and glycogendeposition (Fig. 4F). ABCA1 mRNA was synergisti-cally induced approximately 11-fold by cotreatmentwith both agonists, ABCG1 approximately 4-fold.ApoE was induced by rexinoid treatment, but refrac-tory to GW501516. Cotreatment did not lead to fur-ther activation. Finally ADRP/adipophilin was syner-gistically induced approximately 7-fold by PPAR�/�and RXR agonist cotreatment. Furthermore, ADRPmRNA increased approximately 2- to 3-fold to treat-ment with PPAR�/� and -�, and the RXR agonists

alone (Fig. 4H). The observed synergistic effect ofcotreatment by both agonists is consistent with thefact that PPARs bind to DNA as heterodimers withRXR. Glycogenin was only induced approximately2-fold by cotreatment. However, fenofibrate treat-ment induced glycogenin-1 mRNA levels approxi-mately 4-fold.

To verify some of the results obtained from real-timePCR analysis, we performed Northern blot analysisusing RNA extracted from C2C12-myotubes differen-tiated for 96 h and subsequently treated for 24 h withPPAR�/� and/or RXR agonists (Fig. 5, A and B). Theseresults unconditionally confirm that the mRNAs ofUCP-2/-3 and LPL are induced upon treatment withGW501516, and validate the real-time PCR analysis.Figure 5B also demonstrates that the activation ofUCP-2 occurs after a short time, such as 4 h.

Furthermore, we explored whether some of the sig-nificant effects we observed only after cotreatmentwith GW501516 and LG101305 were specific to thePPAR�/� agonist, and not due to another RXR partner.For example, we examined the expression of ADRP,ACS4, glycogenin/GYG1 (Fig. 6), and ABCA1/G1 (Fig.7, A and B) mRNA expression in the presence of theLXR agonist, T0901317. Clearly, the LXR agonist doesnot activate the expression of mRNAs encoding ACS4,glycogenin-1 and ADRP (Fig. 5, C–E). However, LXR (a

Fig. 5. Activation of UCP-2, -3, and LPL Is Confirmed inNorthern Blot Analysis

A, Total RNA isolated from differentiated myotubes treatedwith RXR and/or PPAR�/� agonists, as described in Fig. 3was analyzed using Northern analysis. After blotting, RNAwas hybridized with 32P-radiolabeled cDNAs encodingGAPDH, UCP-2 and -3, and LPL. B, Myotubes differentiatedfor 4 d (MT4s) were subsequently treated with GW501516 (1�M) for the indicated time points. Cells treated for 24 h withDMSO (MT5s) were used as control.



demonstrable efficacious and potent ABCA1 activator)dramatically induced ABCA1 mRNA expression in theabsence and presence of RXR agonists (Fig. 6, A and B).

Obviously, LXR is a more potent activator of ABCA1mRNA expression than PPAR�/�. However, Oliver etal. (11) demonstrated also that GW501516 increasesABCA1 mRNA expression and induces ApoA1-depen-dent cholesterol efflux in macrophages (although notas efficaciously as the LXR agonist). Moreover theyobserved a dramatic dose dependent rise in serumhigh density lipoprotein cholesterol. Hence, we exam-ined whether GW501516 promoted ApoA1-dependentreverse efflux in skeletal muscle cells, relative to theLXR agonist, T0901317 (Fig. 7C). LXR agonists arepotent activators of ABCA1 mRNA expression andApoA1-specific cholesterol efflux in peripheral tissuesand cells including macrophages, adipose and skele-tal muscle (Ref. 19 and references therein). We treateddifferentiated skeletal muscle cells with LXR, RXR andPPAR�/� specific agonists. The LXR agonist,T0901317 induced approximately 3.5-fold increase inefflux relative to vehicle alone, and cotreatment re-sulted in a approximately 10-fold increase in ApoA1-specific efflux. Although not as effective as T0901317,the PPAR�/� agonist produced an approximately 2.5-fold increase in reverse efflux to ApoA1, and cotreat-ment with the RXR agonist produced a 4.5-fold in-crease. The relative levels of PPAR�/� and LXRApoA1-dependent efflux (Fig. 7C) are entirely consis-tent with the ABCA1 mRNA levels in skeletal musclecells (Fig. 7A), and those reported for LXR andPPAR�/� agonist in macrophages.

In summary, we observed that the PPAR�/� agonistGW101516 dramatically activates the mRNAs encod-ing the UCPs, suggesting that PPAR�/� has an im-portant role in energy uncoupling. Furthermore itactivates the expression of genes involved in pref-

erential lipid utilization, FA catabolism, and energyexpenditure. Interestingly, fenofibrate inducesgenes involved in fructose uptake, and glycogen

Fig. 6. LXR Agonists Do Not Induce the mRNAs Encodingfor ADRP, ACS4, or GYG1

Total RNA from differentiated myotubes treated as de-scribed in Fig. 3A with agonists for RXR (LG101305; 0.1 �M),LXR (T0901317; 1 �M), or both together (RXR & LXR) wasanalyzed by quantitative real-time PCR for the expression ofADRP, ACS4, and GYG1. Results are shown as fold inductionrelative to the respective mRNA level (normalized to GAPDH)in the absence of agonists.

Fig. 7. PPAR�/� and LXR Agonists Induce ABCA1 mRNAand ApoA1-Dependent Cholesterol Efflux in Skeletal MuscleCells

A and B, Total RNA isolated from differentiated myotubestreated with agonists for RXR (LG101305; 100 nM), PPAR�/�(GW501516; 1 �M), both together (LG & GW), LXR (T0901317;1 �M), or RXR and LXR together (LG & T09) was analyzed byquantitative real-time PCR for the expression of ABCA1 (A)and ABCG1 (B). Results are shown as fold induction relativeto the respective mRNA level (normalized to GAPDH) in theabsence of agonists. C, PPAR�/�-mediated activation of re-verse cholesterol transport in differentiated myotubes. Con-fluent C2C12 cells were allowed to differentiate into myo-tubes in the absence of serum for 72 h. After differentiation,cells were cultured for an additional 24 h in the absenceor presence of agonists. After ligand treatment, ApoA1-dependent cholesterol efflux was measured as described inMaterials and Methods.



formation in skeletal muscle. In contrast, rosiglita-zone-mediated activation of PPAR� induces geneexpression associated with glucose uptake, FA syn-thesis and lipid storage. This demonstrates thatPPARs have distinct, complementary, and opposingroles in skeletal muscle.

M-CPT1 Is a Primary Target of PPAR�/� inSkeletal Muscle

We further explored the molecular basis of PPAR�/�-mediated gene activation in skeletal muscle cells byevaluating whether direct, or indirect mechanisms me-diated the observed increase in mRNA levels. We in-vestigated whether the promoters of selected targetgenes were active in skeletal muscle cells, and testedthe responsiveness of the promoters to PPAR�/� andRXR agonists in a cell-based reporter assay. Becausethe promoters were introduced into skeletal musclecells in the absence of exogenous receptors, theligand-dependent responses reflect the functionalproperties of the endogenous receptors.

We transiently transfected C2C12 cells with the reg-ulatory sequences of selected target genes that wereaccessible to us, including ABCA1 (19), CD36/FAT(25), LPL (26), M-CPT1 (27), SREBP-1c (19), andUCP-2 (28), cloned in front of the pGL2/3-basic LUCbackbone and examined the response after treatment

with GW501516 and/or LG101305. Interestingly, onlythe M-CPT1 promoter responded to the PPAR�/� ag-onist and was further activated by cotreatment withboth agonists (Fig. 8A). All other promoters tested,even though active in C2C12-skeletal muscle cells, didnot respond to treatment with the PPAR�/� agonist,GW501516 (data not shown).

The transcriptional coactivator PGC-1 is expressedin skeletal muscle and has been demonstrated to in-duce mitochondrial biogenesis, oxidative metabolism,and thermogenesis (29–32). Furthermore, we haddemonstrated that PGC-1 selectively coactivatesGW501516 induced PPRE expression in skeletal mus-cle cells (Fig. 2A), and PGC-1 has been shown tocoactivate the liver-specific isoform of CPT1 (L-CPT1)(33). Hence, we investigated the ability of PGC-1 tocoactivate the observed activation of the muscle-CPT1 promoter. We observed that PGC-1 significantlyenhanced the transactivation of the M-CPT1 promoterafter treatment with PPAR�/� agonist in skeletal mus-cle cells (Fig. 8B). Furthermore, the synergistic activa-tion after treatment with both agonists was also sig-nificantly increased.

We then investigated the regulation of the M-CPT1promoter in CV1 cells, which do not endogenouslyexpress PPAR�/�. The M-CPT1 promoter was co-transfected into CV1 cells with PPAR�/�, PGC-1, or

Fig. 8. The M-CPT1 Promoter Is Activated by PPAR�/� in a PGC-1-Dependent MannerA, pGL2-basic, or pGL2-MCPT1(-1025/-12) were transfected into skeletal muscle C2C12-cells which endogenously express

PPAR�/� and subsequently treated with agonists for RXR (LG101305), PPAR�/� (GW501516), or both together (LG & GW).B, The same constructs were transfected into C2C12-cells with, or without cDNA-PGC-1, and treated as describedabove. C, Nonmuscle CV1-cells that lack endogenous PPAR�/� were transfected with PPRE-tk-LUC, pSG5-PPAR�/�,cDNA-PGC-1 in the absence or presence of agonists for PPAR�/� and RXR. D, A similar experiment was carried out tocompare the effect of PGC-1 with that of the coactivators SRC2/GRIP1 and p300 in nonmuscle CV1 cells. Reporter activityis shown as relative light units (RLU).



both together. As seen in Fig. 8C, PPAR�/� activatedthe M-CPT1 promoter in nonmuscle CV1 cells signif-icantly only in the presence of agonists and exogenousPGC-1. We also demonstrated that PGC-1, relative toSRC-2/GRIP-1 and p300 most efficiently coactivatedthe M-CPT1 promoter (Fig. 8D). In summary, theseresults clearly demonstrate that M-CPT1 is a target forPPAR�/�, and selectively coactivated by PGC-1. Co-factor expression increases GW501516 inducibilityand the absolute levels of CPT1 expression.

To rigorously define that M-CPT1 was regulated byGW501516 in a PPAR�/�-PPRE-dependent manner,we mutated the previously defined PPAR� responseelement in the M-CPT1 promoter between 775 and763 bp upstream of the initiator codon (27, 34). Weshowed that the wild-type M-CPT1 promoter and notthe PPRE mutant M-CPT1m1 was specifically acti-vated by the PPAR�/�-specific agonist (Fig. 9A). Thisdemonstrated that GW501516 mediated activation isdependent on the M-CPT1 PPRE. This element waspreviously defined as a PPAR�-regulated motif in car-diac muscle and primary cardiomyocytes (27, 34).

Consequently, we examined the ability of the syn-thetic and selective PPAR�, -�/�, and -� agonists toactivate the expression of the wild type M-CPT1 pro-moter and the PPRE mutant M-CPT1m1 in skeletal mus-cle cells in the presence and absence of the coactivator,PGC-1. We observed that in skeletal muscle cells thatM-CPT1 was regulated preferentially by the selectivePPAR�/� and not the PPAR� agonist (Fig. 9 B/C).

In summary, M-CPT1 is an established target forPPAR� in cardiac muscle (27, 34, 35). However, we

clearly demonstrate by transfection in the presence ofPPAR�, -�/�, and -� agonists that the M-CPT1 pro-moter in skeletal muscle cells responds preferentiallyto PPAR�/� agonist activation (and not a selectivePPAR� agonist) (Fig. 9, B and C). This is reminiscent ofthe differential cell specific regulation of the PPRE inthe LPL promoter by PPAR� and -� agonists in adi-pose and liver (32).

Moreover, we showed that the wild type M-CPT1promoter and not the PPRE mutant M-CPT1m1 wasspecifically activated by the PPAR�/�-specific agonist(Fig. 9, A–C). This demonstrated that GW501516-mediated activation was dependent on the M-CPT1PPRE. This element was previously defined as aPPAR�-regulated motif in cardiac muscle (27, 34, 35).

Moreover, we demonstrate that the native LPL pro-moter responds to PPAR�, not PPAR�/�, agonists inmuscle cells in the absence of exogenous PPAR� (Fig.10A), further validating the specificity of the PPAR�/�response on the CPT1 promoter in skeletal musclecells. The previous literature demonstrates that thesecells express functional PPAR�, �/�, and -� receptors(16, 21–23). In addition, our data demonstrate the mul-timerized DR-1 PPRE reporter is efficiently activatedby PPAR�, -�/�, and -� agonists in the absence ofexogenous receptors. The LPL promoter data, trans-fection data in the absence of exogenous receptorsand the previous reports above clearly demonstratethe selective and specific activation of M-CPT1 byPPAR�/� and not -� agonists, is not due to lack ofPPAR� expression, and/or nonfunctional PPAR�. Fi-nally, to rigorously demonstrate that the selective ac-

Fig. 9. M-CPT1 Is a Direct Target of PPAR�/� in Skeletal MuscleA, Schematic of the characterized PPRE in the M-CPT1 promoter (�1025/�12) and the introduced point mutation M-CPT1-m1,

according to Brandt et al. (27), is shown. pGL2-basic, pGL2-MCPT1-wt, or pGL2-MCPT1-m1 were transfected into C2C12-cellsand subsequently treated with agonists for RXR (LG101305), PPAR�/� (GW501516), both together (LG & GW), or DMSO. Reporteractivity is shown as relative light units (RLU). B and C, pGL2-MCPT1-wt (B), or pGL2-M-CPT1-m1 (C) were transfected intoC2C12-cells and subsequently treated with agonists for RXR (LG101305), PPAR�/� (GW501516), PPAR� (rosiglitazone, 10 �M),PPAR� (Wy14634, 10 �M), or the vehicle (DMSO). Reporter activity is shown as RLU.



tivation of the M-CPT1 promoter is not due to theelevated expression of PPAR�/�, relative to PPAR�mRNA, after agonist treatment we examined the ex-pression of PPAR� and -�/� mRNA expression after

24 h RXR agonist, PPAR�/� agonist, and cotreatment(Fig. 10B). As observed earlier, PPAR� and -�/�mRNAs are similarly expressed relative to GAPDHmRNA before agonist treatment; however, RXR andPPAR�/� agonist treatment preferentially inducedPPAR� mRNA expression (Fig. 10B). This definitivelydemonstrates that the selective activation of theM-CPT1 promoter by the PPAR�/� agonist (and notthe PPAR� agonist) in skeletal muscle cells is not dueto lack of PPAR� expression.

Lastly, we observe that the induction of M-CPT1mRNA expression by GW501516 was also observedwith cycloheximide treatment, suggesting that this ef-fect is independent of de novo protein synthesis (Fig.10C). In summary, we have shown that GW501516directly regulates the M-CPT1 promoter in a PPAR�/�/PPRE-dependent manner.

DISCUSSION

Studies with selective agonists and knockout micedemonstrate that PPAR� regulates FA catabolism,and that PPAR� controls lipid storage. The functionof the ubiquitously expressed PPAR�/� remainedelusive in major mass peripheral tissues (36, 37). Inthis investigation, we demonstrate that the PPAR�/�agonist, GW501516, induces the expression ofgenes involved in lipid absorption, preferential lipidutilization, �-oxidation, cholesterol efflux, and en-ergy uncoupling in skeletal muscle cells. Similar ef-fects in lipid metabolism are observed after exercisetraining in human skeletal muscle (38). Interestingly,the PPAR� agonist fenofibrate induces genes in-volved in fructose uptake, and glycogen formation inskeletal muscle. In contrast, rosiglitazone-mediatedactivation of PPAR� induces gene expression asso-ciated with glucose uptake, FA synthesis and lipidstorage. This study demonstrates that PPARs havedistinct complementary, and contrasting roles inskeletal muscle with respect to the regulation ofgene expression involved in lipid, carbohydrate andenergy homeostasis (see Fig. 11).

PPAR�/� has been implicated in fat (8–10) and bone(39) metabolism. Recently, the potent, synthetic andselective PPAR�/� agonist GW501516, a phenoxyace-tic acid derivative, has been reported, which correctshyperinsulinemia and hypertriglyceridemia in insulin-resistant and obese primates (11). However, PPAR�/�target genes, target cells/tissues and mode of actionremained unclear. Very recently, Evans and colleagues(16) demonstrated that expression of activatedPPAR�/� in adipose tissue leads to a lean phenotype,with a normo-phagic diet. They showed the phenotypeis associated with increased FA oxidation and energyuncoupling in adipose tissue.

Our investigation demonstrates that the PPAR�/�agonist activates gene expression in skeletal musclecells, which is involved in preferential lipid utilization,

Fig. 10. PPAR� Is Expressed and Fuctional in Muscle CellsA, pGL2E-LPL (�565/�181), or the vector backbone pGL-

Enhancer were transfected into muscle C2C12 cells (whichendogenously express PPARs) and treated with selectiveagonists for PPAR� (fenofibrates), PPAR� (rosiglitazone),PPAR�/� (GW501516), or the vehicle DMSO as control. Re-porter activity is shown as relative light units (RLU). B, TotalRNA from differentiated C2C12 myotubes treated as de-scribed in Fig. 3A with agonists for RXR (LG101305),PPAR�/� (GW501516), or cotreatment (LG & GW) was ana-lyzed by quantitative real-time PCR for the expression ofPPAR� and -�/� mRNAs. Expression levels are normalized toGAPDH. C, Differentiated myotubes were treated for 8 h withthe agonist for PPAR�/� (GW501516) in the absence or pres-ence of cycloheximide (10 �g/ml). Total RNA was analyzedby quantitative real-time PCR for the expression of M-CPT1.Results are shown as fold induction relative to the respectivemRNA level (normalized to GAPDH) in the absence of drugs.



FA catabolism and energy uncoupling. Muoio et al. (12)observed that skeletal muscle metabolism/�-oxidationand regulation of three well-characterized PPAR� targetgenes UCP-3, CPT1, and PDK4 (in other tissues) werealmost identical in skeletal muscle from either wild typeor PPAR��/� mice (40–45). Furthermore, metabolismand gene expression in skeletal muscle were not com-promised in PPAR��/� mice, in contrast to the dra-matic deleterious effects in liver and heart tissue. Ourdata account for these observations and suggestsPPAR�/� in peripheral tissues functions in a complimen-tary manner to PPAR� in the liver and the heart.

In the context of the data from Evans and colleagues(16) in adipose tissue, we provide further data thatsuggest that PPAR�/� targets skeletal muscle cells.Furthermore, our demonstration that M-CPT1 is pref-erentially regulated by PPAR�/�, and not PPAR� inskeletal muscle cells illustrates distinct mechanismsexist within different cell types to implement localizedresponses to energy requirements and burdens inthese tissues.

The Oliver et al. 2001 study (11) also demonstratedthat GW501516 raised cholesterol efflux in macro-phages and serum HDL cholesterol. We demonstratethat GW501516 activated ABCA1 mRNA expressionwith the subsequent metabolic consequence of in-creased cholesterol efflux from skeletal muscle cells.Therefore, the effects of PPAR�/� agonists on skeletalmuscle cell gene expression is entirely consistent with

the beneficial impact of GW501516 on dyslipidemiaand hyperinsulinemia in obese primates, especially whenone considers that muscle is a metabolically demandingtissue that accounts for 40% of the total body mass.

Interestingly, in contrast to the role of PPAR� in theliver and the heart, fenofibrate induces genes involvedin fructose uptake, and glycogen formation in skeletalmuscle. Furthermore, we observed a repression inSREBP-1c expression, similar to the effect observedin hepatic cells (46). However, gene expression in-volved in preferential FA catabolism was not activatedby the PPAR� agonist. In congruence with the obser-vations that �-oxidation in skeletal muscle was notcompromised in PPAR��/� mice. Furthermore, theinduction of fructose uptake by fenofibrates is in ac-cordance with the amelioration of high fructose in-duced insulin resistance, fat accumulation and hyper-lipidemia in rats by fenofibrate treatment (47). Thissuggests that PPAR�/�, not PPAR�, regulates lipidcatabolism in skeletal muscle cells. We speculate the�/� isoform also activates FA oxidation in skeletalmuscle, in vivo.

Rosiglitazone-mediated activation of PPAR� in-duces gene expression associated with glucose up-take, FA synthesis, and lipid storage, consistent withprevious studies. We did not observe robust changesin gene expression after agonist treatment. Thiazo-lidinediones induce dramatic changes in diseased, notnormal healthy animals (48).

Fig. 11. Schematic Overview of Metabolic PPAR�/� ActionEnzymes and functions found to be activated by PPAR�/� agonist are marked in green. Red indicates inhibition of pathways.

The green arrows underline FA uptake and oxidation, followed by uncoupling oxidation from ATP synthesis.



We demonstrate that PPAR�/� agonists have a sig-nificant role in the regulation of the mRNAs encodingthe UCPs (UCP-1 to -3, mitochondrial proton carriers)that control metabolic efficiency, energy expenditure,adaptation to nutrient (i.e. preferential lipid utilization)and thermogenesis by uncoupling oxidation/respira-tion from ATP synthesis (see Fig. 11). These data areconsistent with the observations that mRNA expres-sion associated with selective utilization of lipid sub-strates is augmented during exercise, starvation, andphysiological states that are associated with increasedsystemic delivery and utilization of FAs. In adult or-ganisms, UCP-1 is almost exclusively expressed inbrown adipose tissue, whereas UCP-2 and UCP-3 areexpressed in adipose and skeletal muscle tissue, al-though UCP-3 is predominantly found in muscle.However, UCP-1 mRNA expression has been ob-served previously in muscle cells (24) and may bean artifact of the myogenesis (muscle differentia-tion) program in cell culture, and/or reflect an expres-sion profile associated with differentiation duringembryogenesis.

A number of studies have investigated ectopic andmuscle specific overexpression of UCP-2 and -3 intransgenic mice, and in cell culture. These investiga-tions have reported: 1) reduced metabolic efficiencyand increased rates of energy expenditure; 2) prefer-ential FA oxidation vs. glucose utilization/oxidation; 3)resistance to high fat diet induced weight gain, andobesity in the context of hyperphagic behavior; 4)lower fasting plasma glucose and insulin levels, andincreased glucose tolerance and clearance rate; and 5)adaptive thermogenesis. These studies emphasize theregulatory role of UCP-2 and -3 in metabolic efficien-cy/energy expenditure, thermogenesis, and in prefer-ential substrate utilization (49–55). Similarly, whenUCP-1 (normally expressed in brown adipose tissue) isoverexpressed in the muscle, the transgenic micehave a lower body weight, increased food intake ac-companied by energy expenditure (56). We hypothe-size that the effects of PPAR�/� agonists on skeletalmuscle, a major mass peripheral tissue would haveutility and protect against diet-induced obesity andglucose intolerance.

In addition, we confirm that M-CPT1 (and thePPRE), an established target for PPAR� in cardiacmuscle (27, 34, 35) responds preferentially toPPAR�/� agonist activation (and not selectivePPAR� agonist) in skeletal muscle cells. This is rem-iniscent of the differential cell specific regulation ofthe LPL promoter by PPAR� and -� agonists inadipose and liver. This observation highlights thatPPARs have distinct tissue specific functions, andthat a single DNA motif can mediate a cell-specifictranscriptional phenotype. Furthermore, it suggeststhat PPAR� and PPAR�/� function in a complemen-tary but tissue-specific manner.

Furthermore, we demonstrate the PGC-1-depen-dent nature of muscle-CPT1 transcriptional activation,and PPRE trans-activation by GW501516-PPAR�/� in

skeletal muscle cells. The studies by Spiegelman andcolleagues (31, 57) exquisitely demonstrate thatPGC-1 regulates adaptive thermogenesis, and mito-chondrial biogenesis. Moreover, PGC-1 is regulatedby exercise (57, 58). Our studies in cells are in conso-nance with these in vivo studies.

During the preparation of this manuscript, a numberof manuscripts appeared in the literature describingthe role of PPAR�/� agonists in cardiac myocytes andmacrophages. For example, Gilde et al. (59) publishedwork describing the role of PPAR�/� in cardiac lipidmetabolism. They demonstrated that the long chainFA induced regulation of gene expression in primarycardiomyocytes is controlled by PPAR� and PPAR�/�.Lipid catabolism was activated in response to PPAR�and -�/� agonists, concluding that PPAR� andPPAR�/� have overlapping functions in the control ofcardiac lipid homeostasis. Our investigation, and thestudy by Wang et al. (16) suggest that PPAR� and -�/�have distinct functions in adipose and muscle. More-over, work from Vosper et al. (1) demonstrated thatPPAR�/� agonists induce lipid absorption and storagein macrophages. Paradoxically, ApoE and cyp27mRNA expression is repressed, and in contrast,ABCA1 mRNA expression and ApoA1-dependentcholesterol efflux is induced. This is entirely consistentwith the observations reported in this study. Further-more, increased lipid absorption and ApoA1-depen-dent cholesterol efflux in macrophages and skeletalmuscle cells are entirely consistent with the profoundeffects observed by Oliver et al. (11) in lowering circu-lating levels of triglycerides and LDL, with a corre-sponding increase in HDL cholesterol. We commentthat this compound is in clinical trials, and the Oliveret al. 2001 manuscript reported that the beneficialeffects of GW501516 on HDL cholesterol and trig-lycerides were observed at 1 and 3 mg/kg withcorresponding circulating serum concentrations ofapproximately 265 and 700 ng/ml, or 0.5 and 1.5 �M,respectively. This is consistent with the concentra-tion used in this study. Finally, Chawla et al. (17)state that triglyceride-enriched VLDLs activatePPAR�/� in macrophages and lead to the inductionof ADRP/adipophilin (lipid storage droplets), whichis consistent with the induction of ADRP mRNAexpression we observed in skeletal muscle cellsafter agonist treatment. In conclusion, we suggestthe activation of PPAR�/� in skeletal muscle cellsprograms a cascade of gene expression designed toactivate catabolism, and energy expenditure.

MATERIALS AND METHODS

Plasmids

Mouse PPAR�/� was reverse transcribed from differentiatedC2C12 myotubes, using total RNA, and the following primers:5�-full-length and -AF1: GCGGGATCCTCACCATGGAA-CAGCCACAGGAGGAGACC (BamHI); 5�-hinge/LBD: GCGG-



GATCCTCACCATGTCGCACAACGCTATCCGC (BamHI); 3�-full-length and hinge/LBD: GCGGGATCCTTAGTACATGT-CCTTGTAGATTTCC (BamHI); 3�-AF1: GCGTCTAGACATGT-TGAGGCTGCCGCCTGAGGCC (XbaI). The PCR productswere cut with the respective enzymes and cloned into thecorresponding sites of pSG5, and/or pSV40-GAL0. CDNA4-PGC-1 was kindly provided by B. M. Spiegelman (32). PPRE-tkLUC was kindly provided by X-Ceptor Therapeutics. TheCPT1 promoter (�1025/�12) was kindly provided by D. P.Kelly (27). cDNA-GRIP1/SRC2 and cDNA-p300 have beendescribed previously (60).

RNA Extraction and Northern Hybridization

Total RNA used for RT-PCR cloning and Northern blot anal-ysis was extracted using TRI-Reagent (Sigma Aldrich Aus-tralia Pty Ltd, Castle Hill, New South Wales, Australia), ac-cording to manufacturer’s protocol. For quantitative real-timeRT-PCR, RNA was further purified using RNeasy (QIAGEN,Clifton Hill, Victoria, Australia), after manufacturer’s instruc-tions. Northern blot hybridization was carried out as de-scribed previously (61).

Cell Culture, Transient Transfections, and CholesterolEfflux Assay

Mouse myogenic C2C12 cells were cultured in growth me-dium [DMEM supplemented with 10% Serum Supreme (Bio-Whittaker, Edward Keller Pty Ltd, Hallam, Victoria, Australia)]in 6% CO2. For differentiation assays, cells were grown toconfluency, at which point media was changed into differen-tiation medium (DMEM supplemented with 2% horse serum).Cells were harvested at indicated time points. For drug as-says, cells were differentiated into myotubes for 4 d (MT4s),and the medium was changed into phenol red-free differen-tiation medium supplemented with the agonists for PPAR�/�(GW501516, 1 �M), RXR (LG101305, 100 nM), PPAR� (Feno-fibrate, 100 �M or Wyeth14643, 10 �M), PPAR� (Rosiglita-zone, 10 �M), or the vehicle (DMSO) as control. Cells wereharvested at the indicated time points (usually 24 h, if notindicated differently). African green monkey kidney CV1 cellswere grown in DMEM supplemented with 10% heat-inacti-vated fetal calf serum.

Transfections were carried out using a DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate)(Biontex Laboratories GmbH, Munich, Germany)/DOSPER(1,3-di-oleoyloxy-2-(6-carboxy-spermyl)-propylamid) (RocheDiagnostics Pty Ltd, Castle Hill, New South Wales, Australia)3:1 liposome mixture in HEPES buffered saline [42 mM

HEPES, 275 mM NaCl, 10 mM KCl, 0.4 mM Na2HPO4, 11 mM

dextrose (pH 7.1)], with 1�g of total DNA per well. Medium wasreplaced after 16 h with the respective fresh medium, supple-mented with agonists for PPARs and/RXR (as described above),harvested after 24 h and assayed for LUC activity using theLuclite kit (PerkinElmer Life Science, Knoxfield, Victoria, Austra-lia) according to manufacturer’s protocol.

ApoA1-dependent cholesterol efflux was performed as de-scribed previously (19).

Quantitative RT-PCR

Target cDNA levels were quantitated by real-time RT-PCRusing an ABI Prism 7700 Sequence Detector system utilizingSYBRE green I (Molecular Probes, Eugene, OR; catalog no.S-7562, used at 0.8�) as a nonspecific PCR product fluo-rescence label. Quantitation was over 45 cycles of 95 C for 15sec and 60 C for 1 min two-step thermal cycling preceded byan initial 95 C for 2 min for activation of 0.75 U Platinum TaqDNA polymerase (Invitrogen Australia Pty Ltd, Mulgrave, Vic-toria, Australia). The 25-�l reaction also contained 20 mM

Tris-HCl (pH 8.4), 50 mM KCl, 5 mM MgCl2, 200 �M each of

deoxy (d) GTP, dATP, dCTP, 400 �M deoxyuridine triphos-phate, 0.5 U uracil-N-glycosylase, 500 nM ROX reference dye(Invitrogen) and 200 nM each forward and reverse primers.Mus musculus primer sequences (forward and reverse, re-spectively): ABCA1: GCTCTCAGGTGGGATGCAG, GGCTC-GTCCAGAATGACAAC;

ABCG1: CTGAGGGATCTGGGTCTGA, CCTGATGCCAC-TTCCATGA;

ACS4: GGTTTGGTAACAGATGCCTTCAA, CCCATACAT-TCGCTCAATGTCTT; ADRP: CCCTGGTTCTAAGAAGCTGC-TTT, GGCCAGATGACCCCTTTTG;

ApoE: GCTGTTGGTCACATTGCTGA, TGCCACTCGAGC-TGATCTG;

CD36: GGCCAAGCTATTGCGACAT, CAGATCCGAACA-CAGCGTAGA;

CPT1: ATCATGTATCGCCGCAAACT, CCATCTGGTAGG-AGCACATGG;

FABP3: CCCCTCAGCTCAGCACCAT, CAGAAAAATCCC-AACCCAAGAAT;

FAS: CGGAAACTTCAGGAAATGTCC, TCAGAGACGTG-TCACTCCTGG;

GAPDH: GTGTCCGTCGTGGATCTGA, CCTGCTTCACC-ACCTTCTTG;

Glut4: ATGGCTGTCGCTGGTTTCTC, ACCCATACGATC-CGCAACAT;

Glut5: CTTGCCTTTACCGGGTTGAC, CATCTGGTCTTG-CAGCAACTCT;

GYG1: CCCAAACCCCTCATCTGATG, GCACGTTTCCAT-ACATAGTATGTGAA;

LPL: CCAATGGAGGCACTTTCCA, TGGTCCACGTCTCC-GAGTC;

PDK2: TGCTCCGGCTTGCCTTAT, CACTCCATCCTTCTT-AACATTGACA;

PDK4: AAAGGACAGGATGGAAGGAATCA, TTTTCCTCT-GGGTTTGCACAT;

PPAR�: TCTTCACGATGCTGTCCTCCT, GGAACTCGCC-TGTGATAAAGC

PPAR�/�: TCCAGAAGAAGAACCGCAACA, GGATAGCG-TTGTGCGACATG;

PPAR�: CAGGCCGAGAAGGAGAAGCT, GGCTCGCAGA-TCAGCAGACT

SCD1: TGTACGGGATCATACTGGTTCC, CCCGGCTGTG-ATGCC;

SCD2: ACTGTGACTCAAGTTCAACTCTTGAAA, TGCCC-ACAAATTGAGGATAGC;

SREBP-1c: CGTCTGCACGCCCTAGG, CTGGAGCATG-TCTTCAAATGTG;

UCP-1: ACAGAAGGATTGCCGAAAC, AGCTGATTTGCC-TCTGAATG;

UCP-2: GTTCCTCTGTCTCGTCTTGC, GGCCTTGAAAC-CAACCA;

UCP-3: TGACCTGCGCCCAGC, CCCAGGCGTATCATG-GCT.

Amplification specificity was verified by visualizing PCRproducts on an ethidium bromide-stained 2.5% agarose gel.GAPDH was used for normalization between samples forquantitation.

Acknowledgments

We thank Dr. Richard Heyman and X-Ceptor TherapeuticsInc. for kindly providing the PPAR�/�, and RXR agonists,GW501516, and LG101305, respectively. Rosiglitazone waskindly provided by Thomas A. Gustafson (Metabolex Inc.). Wethank Shayama Wijedasa and Rachel Burrow for excellent tech-nical assistance.

Received April 22, 2003. Accepted September 29, 2003.Address all correspondence and requests for reprints to:

George Muscat, Institute Molecular Bioscience, St. Lucia,Queensland 4072, Australia. E-mail: [email protected].



U.D., T.L.A., and J.B.P. contributed equally to this study.This work was supported by the National Health and Med-

ical Research Council (NHMRC) of Australia. G.E.O.M. is anNHMRC Principal Research Fellow, and U.D. is a Universityof Queensland Postoctoral Research Fellow.

REFERENCES

1. Vosper H, Khoudoli GA, Graham TL, Palmer CN 2002 Per-oxisome proliferator-activated receptor agonists, hyperlipi-daemia, and atherosclerosis. Pharmacol Ther 95:47–62

2. Hihi AK, Michalik L, Wahli W 2002 PPARs: transcriptionaleffectors of fatty acids and their derivatives. Cell Mol LifeSci 59:790–798

3. Chawla A, Repa JJ, Evans RM, Mangelsdorf DJ 2001Nuclear receptors and lipid physiology: opening the X-files. Science 294:1866–1870

4. Lu TT, Repa JJ, Mangelsdorf DJ 2001 Orphan nuclearreceptors as eLiXiRs and FiXeRs of sterol metabolism.J Biol Chem 276:37735–37738

5. Berger J, Moller DE 2002 The mechanisms of action ofPPARs. Annu Rev Med 53:409–435

6. Kliewer SA, Xu HE, Lambert MH, Willson TM 2001 Per-oxisome proliferator-activated receptors: from genes tophysiology. Recent Prog Horm Res 56:239–263

7. Michalik L, Desvergne B, Wahli W 2003 Peroxisome pro-liferator-activated receptors �/�: emerging roles for apreviously neglected third family member. Curr Opin Lipi-dol 14:129–135

8. Peters JM, Lee SS, Li W, Ward JM, Gavrilova O, EverettC, Reitman ML, Hudson LD, Gonzalez FJ 2000 Growth,adipose, brain, and skin alterations resulting from tar-geted disruption of the mouse peroxisome proliferator-activated receptor �(�). Mol Cell Biol 20:5119–5128

9. Rosenberger TA, Hovda JT, Peters JM 2002 Targeteddisruption of peroxisomal proliferator-activated receptor� (�) results in distinct gender differences in mouse brainphospholipid and esterified FA levels. Lipids 37:495–500

10. Vosper H, Patel L, Graham TL, Khoudoli GA, Hill A,Macphee CH, Pinto I, Smith SA, Suckling KE, Wolf CR,Palmer CN 2001 The peroxisome proliferator-activatedreceptor � promotes lipid accumulation in human mac-rophages. J Biol Chem 276:44258–44265

11. Oliver Jr WR, Shenk JL, Snaith MR, Russell CS, PlunketKD, Bodkin NL, Lewis MC, Winegar DA, Sznaidman ML,Lambert MH, Xu HE, Sternbach DD, Kliewer SA, HansenBC, Willson TM 2001 A selective peroxisome proliferator-activated receptor � agonist promotes reverse choles-terol transport. Proc Natl Acad Sci USA 98:5306–5311

12. Muoio DM, MacLean PS, Lang DB, Li S, Houmard JA,Way JM, Winegar DA, Corton JC, Dohm GL, Kraus WE2002 Fatty acid homeostasis and induction of lipid reg-ulatory genes in skeletal muscles of peroxisome prolif-erator-activated receptor (PPAR) � knock-out mice. Ev-idence for compensatory regulation by PPAR �. J BiolChem 277:26089–26097

13. Son C, Hosoda K, Matsuda J, Fujikura J, Yonemitsu S,Iwakura H, Masuzaki H, Ogawa Y, Hayashi T, Itoh H,Nishimura H, Inoue G, Yoshimasa Y, Yamori Y, Nakao K2001 Up-regulation of uncoupling protein 3 gene expres-sion by fatty acids and agonists for PPARs in L6 myo-tubes. Endocrinology 142:4189–4194

14. Hatakeyama Y, Scarpace PJ 2001 Transcriptional regu-lation of uncoupling protein-2 gene expression in L6myotubes. Int J Obes Relat Metab Disord 25:1619–1624

15. Barak Y, Liao D, He W, Ong ES, Nelson MC, Olefsky JM,Boland R, Evans RM 2002 Effects of peroxisome prolifera-tor-activated receptor � on placentation, adiposity, andcolorectal cancer. Proc Natl Acad Sci USA 99:303–308

16. Wang YX, Lee CH, Tiep S, Yu RT, Ham J, Kang H, EvansRM 2003 Peroxisome-proliferator-activated receptor �

activates fat metabolism to prevent obesity. Cell 113:159–170

17. Chawla A, Lee CH, Barak Y, He W, Rosenfeld J, Liao D,Han J, Kang H, Evans RM 2003 PPAR� is a very low-density lipoprotein sensor in macrophages. Proc NatlAcad Sci USA 100:1268–1273

18. Lee CH, Olson P, Evans RM 2003 Minireview: lipid me-tabolism, metabolic diseases, and peroxisome prolifera-tor-activated receptors. Endocrinology 144:2201–2207

19. Muscat GE, Wagner BL, Hou J, Tangirala RK, BischoffED, Rohde P, Petrowski M, Li J, Shao G, Macondray G,Schulman IG 2002 Regulation of cholesterol homeosta-sis and lipid metabolism in skeletal muscle by liver Xreceptors. J Biol Chem 277:40722–40728

20. Chen JD, Evans RM 1995 A transcriptional co-repressorthat interacts with nuclear hormone receptors. Nature377:454–457

21. Cabrero A, Alegret M, Sanchez RM, Adzet T, Laguna JC,Carrera MV 2002 Increased reactive oxygen species pro-duction down-regulates peroxisome proliferator-acti-vated alpha pathway in C2C12 skeletal muscle cells.J Biol Chem 277:10100–10107

22. Hunter JG, van Delft MF, Rachubinski RA, Capone JP2001 Peroxisome proliferator-activated receptor � li-gands differentially modulate muscle cell differentiationand MyoD gene expression via peroxisome proliferator-activated receptor �-dependent and -independent path-ways. J Biol Chem 276:38297–38306

23. Holst D, Luquet S, Nogueira V, Kristiansen K, Leverve X,Grimaldi PA 2003 Nutritional regulation and role of per-oxisome proliferator-activated receptor � in fatty acidcatabolism in skeletal muscle. Biochim Biophys Acta1633:43–50

24. Shimokawa T, Kato M, Ezaki O, Hashimoto S 1998 Tran-scriptional regulation of muscle-specific genes duringmyoblast differentiation. Biochem Biophys Res Commun246:287–292

25. Shore P, Dietrich W, Corcoran LM 2002 Oct-2 regulatesCD36 gene expression via a consensus octamer, whichexcludes the co-activator OBF-1. Nucleic Acids Res 30:1767–1773

26. Homma H, Kurachi H, Nishio Y, Takeda T, Yamamoto T,Adachi K, Morishige K, Ohmichi M, Matsuzawa Y, MurataY 2000 Estrogen suppresses transcription of lipoproteinlipase gene. Existence of a unique estrogen responseelement on the lipoprotein lipase promoter. J Biol Chem275:11404–11411

27. Brandt JM, Djouadi F, Kelly DP 1998 Fatty acids activatetranscription of the muscle carnitine palmitoyltransferaseI gene in cardiac myocytes via the peroxisome prolifera-tor-activated receptor �. J Biol Chem 273:23786–23792

28. Kizaki T, Suzuki K, Hitomi Y, Taniguchi N, Saitoh D,Watanabe K, Onoe K, Day NK, Good RA, Ohno H 2002Uncoupling protein 2 plays an important role in nitricoxide production of lipopolysaccharide-stimulated mac-rophages. Proc Natl Acad Sci USA 99:9392–9397

29. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G,Mootha V, Troy A, Cinti S, Lowell B, Scarpulla RC,Spiegelman BM 1999 Mechanisms controlling mitochon-drial biogenesis and respiration through the thermogeniccoactivator PGC-1. Cell 98:115–124

30. Michael LF, Wu Z, Cheatham RB, Puigserver P, Adel-mant G, Lehman JJ, Kelly DP, Spiegelman BM 2001Restoration of insulin-sensitive glucose transporter(GLUT4) gene expression in muscle cells by the tran-scriptional coactivator PGC-1. Proc Natl Acad Sci USA98:3820–3825

31. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, MichaelLF, Puigserver P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R, Spiegelman BM 2002 Transcriptional co-activa-tor PGC-1 � drives the formation of slow-twitch musclefibres. Nature 418:797–801



32. Puigserver P, Wu Z, Park CW, Graves R, Wright M,Spiegelman BM 1998 A cold-inducible coactivator of nu-clear receptors linked to adaptive thermogenesis. Cell 92:829–839

33. Louet JF, Hayhurst G, Gonzalez FJ, Girard J, Decaux JF2002 The coactivator PGC-1 is involved in the regulationof the liver carnitine palmitoyltransferase I gene expres-sion by cAMP in combination with HNF4 � and cAMP-response element-binding protein (CREB). J Biol Chem277:37991–38000

34. Huss JM, Levy FH, Kelly DP 2001 Hypoxia inhibits theperoxisome proliferator-activated receptor �/retinoid Xreceptor gene regulatory pathway in cardiac myocytes: amechanism for O2-dependent modulation of mitochon-drial fatty acid oxidation. J Biol Chem 276:27605–27612

35. Barger PM, Brandt JM, Leone TC, Weinheimer CJ, KellyDP 2000 Deactivation of peroxisome proliferator-acti-vated receptor-� during cardiac hypertrophic growth.J Clin Invest 105:1723–1730

36. Bocher V, Pineda-Torra I, Fruchart JC, Staels B 2002PPARs: transcription factors controlling lipid and lipopro-tein metabolism. Ann NY Acad Sci 967:7–18

37. Duval C, Chinetti G, Trottein F, Fruchart JC, Staels B2002 The role of PPARs in atherosclerosis. Trends MolMed 8:422–430

38. Tunstall RJ, Mehan KA, Wadley GD, Collier GR, Bonen A,Hargreaves M, Cameron-Smith D 2002 Exercise trainingincreases lipid metabolism gene expression in human skel-etal muscle. Am J Physiol Endocrinol Metab 283:E66–E72

39. Mano H, Kimura C, Fujisawa Y, Kameda T, Watanabe-Mano M, Kaneko H, Kaneda T, Hakeda Y, Kumegawa M2000 Cloning and function of rabbit peroxisome prolif-erator-activated receptor �/� in mature osteoclasts.J Biol Chem 275:8126–8132

40. Pilegaard H, Ordway GA, Saltin B, Neufer PD 2000 Tran-scriptional regulation of gene expression in human skel-etal muscle during recovery from exercise. Am J PhysiolEndocrinol Metab 279:E806–E814

41. Sugden MC, Kraus A, Harris RA, Holness MJ 2000 Fibre-type specific modification of the activity and regulation ofskeletal muscle pyruvate dehydrogenase kinase (PDK)by prolonged starvation and refeeding is associated withtargeted regulation of PDK isoenzyme 4 expression. Bio-chem J 346(Pt 3):651–657

42. Cortright RN, Zheng D, Jones JP, Fluckey JD, DiCarloSE, Grujic D, Lowell BB, Dohm GL 1999 Regulation ofskeletal muscle UCP-2 and UCP-3 gene expression byexercise and denervation. Am J Physiol 276:E217–E221

43. Kelly LJ, Vicario PP, Thompson GM, Candelore MR,Doebber TW, Ventre J, Wu MS, Meurer R, Forrest MJ,Conner MW, Cascieri MA, Moller DE 1998 Peroxisomeproliferator-activated receptors � and � mediate in vivoregulation of uncoupling protein (UCP-1, UCP-2, UCP-3)gene expression. Endocrinology 139:4920–4927

44. Wu P, Inskeep K, Bowker-Kinley MM, Popov KM, HarrisRA 1999 Mechanism responsible for inactivation of skel-etal muscle pyruvate dehydrogenase complex in starva-tion and diabetes. Diabetes 48:1593–1599

45. Weigle DS, Selfridge LE, Schwartz MW, Seeley RJ, Cum-mings DE, Havel PJ, Kuijper JL, BeltrandelRio H 1998Elevated free fatty acids induce uncoupling protein 3expression in muscle: a potential explanation for theeffect of fasting. Diabetes 47:298–302

46. Yoshikawa T, Ide T, Shimano H, Yahagi N, Amemiya-Kudo M, Matsuzaka T, Yatoh S, Kitamine T, Okazaki H,Tamura Y, Sekiya M, Takahashi A, Hasty AH, Sato R,Sone H, Osuga J, Ishibashi S, Yamada N 2003 Cross-talkbetween peroxisome proliferator-activated receptor(PPAR) � and liver X receptor (LXR) in nutritional regula-tion of fatty acid metabolism. I. PPARs suppress sterolregulatory element binding protein-1c promoter throughinhibition of LXR signaling. Mol Endocrinol 17:1240–1254

47. Nagai Y, Nishio Y, Nakamura T, Maegawa H, Kikkawa R,Kashiwagi A 2002 Amelioration of high fructose-inducedmetabolic derangements by activation of PPAR�. Am JPhysiol Endocrinol Metab 282:E1180–E1190

48. Kim JK, Fillmore JJ, Gavrilova O, Chao L, Higashimori T,Choi H, Kim HJ, Yu C, Chen Y, Qu X, Haluzik M, ReitmanML, Shulman GI 2003 Differential effects of rosiglitazoneon skeletal muscle and liver insulin resistance in A-ZIP/F-1 fatless mice. Diabetes 52:1311–1318

49. Garcia-Martinez C, Sibille B, Solanes G, Darimont C, MaceK, Villarroya F, Gomez-Foix AM 2001 Overexpression ofUCP3 in cultured human muscle lowers mitochondrialmembrane potential, raises ATP/ADP ratio, and favors fattyacid vs. glucose oxidation. FASEB J 15:2033–2035

50. Clapham JC, Arch JR, Chapman H, Haynes A, Lister C,Moore GB, Piercy V, Carter SA, Lehner I, Smith SA,Beeley LJ, Godden RJ, Herrity N, Skehel M, ChanganiKK, Hockings PD, Reid DG, Squires SM, Hatcher J, TrailB, Latcham J, Rastan S, Harper AJ, Cadenas S, Buck-ingham JA, Brand MD, Abuin A 2000 Mice overexpress-ing human uncoupling protein-3 in skeletal muscle arehyperphagic and lean. Nature 406:415–418

51. Zhang CY, Baffy G, Perret P, Krauss S, Peroni O, GrujicD, Hagen T, Vidal-Puig AJ, Boss O, Kim YB, Zheng XX,Wheeler MB, Shulman GI, Chan CB, Lowell BB 2001Uncoupling protein-2 negatively regulates insulin secre-tion and is a major link between obesity, � cell dysfunc-tion, and type 2 diabetes. Cell 105:745–755

52. Boss O, Samec S, Kuhne F, Bijlenga P, Assimacopoulos-Jeannet F, Seydoux J, Giacobino JP, Muzzin P 1998Uncoupling protein-3 expression in rodent skeletal mus-cle is modulated by food intake but not by changes inenvironmental temperature. J Biol Chem 273:5–8

53. Dulloo AG, Samec S, Seydoux J 2001 Uncoupling protein3 and fatty acid metabolism. Biochem Soc Trans 29:785–791

54. Dulloo AG, Samec S 2001 Uncoupling proteins: theirroles in adaptive thermogenesis and substrate metabo-lism reconsidered. Br J Nutr 86:123–139

55. Samec S, Seydoux J, Dulloo AG 1998 Role of UCPhomologues in skeletal muscles and brown adiposetissue: mediators of thermogenesis or regulators of lipidsas fuel substrate? FASEB J 12:715–724

56. Couplan E, Gelly C, Goubern M, Fleury C, Quesson B,Silberberg M, Thiaudiere E, Mateo P, Lonchampt M,Levens N, De Montrion C, Ortmann S, Klaus S, Gonzalez-Barroso MD, Cassard-Doulcier AM, Ricquier D, BigardAX, Diolez P, Bouillaud F 2002 High level of uncouplingprotein 1 expression in muscle of transgenic mice selec-tively affects muscles at rest and decreases their IIb fibercontent. J Biol Chem 277:43079–43088

57. Baar K, Wende AR, Jones TE, Marison M, Nolte LA, ChenM, Kelly DP, Holloszy JO 2002 Adaptations of skeletalmuscle to exercise: rapid increase in the transcriptionalcoactivator PGC-1. FASEB J 16:1879–1886

58. Pilegaard H, Saltin B, Neufer PD 2003 Exercise inducestransient transcriptional activation of the PGC-1� gene inhuman skeletal muscle. J Physiol 546:851–858

59. Gilde AJ, van der Lee KA, Willemsen PH, Chinetti G, van derLeij FR, van der Vusse GJ, Staels B, van Bilsen M 2003Peroxisome proliferator-activated receptor (PPAR) � andPPAR�/�, but not PPAR�, modulate the expression ofgenes involved in cardiac lipid metabolism. Circ Res 92:518–524

60. Chen SL, Dowhan DH, Hosking BM, Muscat GE 2000The steroid receptor coactivator, GRIP-1, is necessaryfor MEF-2C-dependent gene expression and skeletalmuscle differentiation. Genes Dev 14:1209–1228

61. Dressel U, Bailey PJ, Wang SC, Downes M, Evans RM,Muscat GE 2001 A dynamic role for HDAC7 in MEF2-mediated muscle differentiation. J Biol Chem 276:17007–17013



the peroxisome proliferator-activated receptor agonist ... · pdf filevery low-density...

Documents