THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

VOl. 269, No. Issue of July 1, pp. 17677-17683, 1994 Printed in U.S.A.

Two Isoforms of a Chloride Channel Predominantly Expressed in Thick Ascending Limb of Henle’s Loop and Collecting Ducts of Rat Kidney*

(Received for publication, February 2, 1994, and in revised form, April 20, 1994)

Susumu Adachi, Shinichi UchidaS, Hiroshi Ito, Mimi Hata, Michiaki Hiroe, Fumiaki Marumo, and Sei Sasaki From the Second Department ofznternal Medicine, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo l i 3 , J a p a n ’

Complementary DNAs encoding rat kidney chloride channels (ClC-K2L and ClC-K2S) were isolated by a po- lymerase chain reaction cloning strategy. Degenerate primers were designed based on the significant amino acid identity of the previously cloned chloride channels (ClC-0, -1, -2, and -Kl). The 687-amino acid protein en- coded by ClC-K2L is about 80% identical to rat ClC-K1 and about 40%0 identical to ClC-0, -1, and -2. ClC-K2S encodes a 632-amino acid protein in which 55 amino acids containing the putative second membrane-span- ning domain of ClC-K2L are deleted. Chloride currents induced by both clones were very similar in terms of inhibitor sensitivity and anion selectivity (Br- > I- > C1- >> cyclamate-). Northern blot with total ClC-K2L as a probe under high stringency revealed its message pre- dominantly in kidney, especially in the outer and inner medulla. Reverse transcription polymerase chain reac- tion technique using microdissected nephron segments revealed that the main site of expression of both clones in kidney was the thick ascending limb of Henle’s loop and collecting ducts, where the existence of a variety of chloride channels and their importance for maintaining body fluid homeostasis have been demonstrated. These results suggest that ClC-K2L and -K2S are chloride chan- nels in the thick ascending limb and collecting ducts and may be important routes for transcellular chloride transport like ClC-K1.

Numerous physiological approaches have revealed the exist- ence of a variety of chloride channels in the plasma membranes of kidney epithelia as well as their physiological significance as routes for transcellular chloride transport (1). Paracellular chlo- ride flux also exists in kidney (2, 31, but the transcellular chlo- ride transport is more important because it is regulated by hor- mones to maintain body fluid homeostasis (1). Recent molecular biology techniques make the isolation of cDNAs encoding these chloride channels possible. Expression cloning strategy using Xenopus oocytes led to the isolation of a chloride channel from Madin-Darby canine kidney cells (4). Recently, this protein was identified as not a chloride channel itself but a regulator of stretch-activated chloride channel (5). p64 is the other chloride

nese Ministry of Education, Science, and Culture, the Ichiro Kanehara * This study was supported in part by research grants from the Japa-

Foundation, and the Mitsubishi Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the GenBankmIEMBL Data Bunk with accession number(s) 026111. The nucleotide sequence(s1 reported in this paper has been submitted

$ To whom correspondence should be addressed. Tel.: 81-3-3813-6111 (ext. 3658); Fax: 81-3-3818-7177.

channel that was recently isolated from bovine kidney (61, but it probably represents the chloride channel of intracellular or- ganelles (7) and may not be functioning for transcellular chlo- ride transport. Recently, we have isolated ClC-K1 by polymerase chain reaction (PCR)’-based cloning strategy (8). The C1C family consists of four members at present: C1C-0 (91, -1 (101, -2 (ll), and -K1(8). Other than C1C-K1, ClC-2 is a member of the C1C family expressed in kidney; however, it is not open under the physiological membrane potential and needs the swelling of membrane to be open at the physiological membrane potential (12). Thus, C1C-2 may be important for cell volume regulation but may not be involved in transcellular chloride transport. P- glycoprotein may have the same role in kidney because it is also identified as a stretch-activated chloride channel (13). C1C-K1 is exclusively expressed in the inner medulla of kidney. Its ex- pression was augmented by dehydration, suggesting its impor- tant role in urinary concentrating mechanisms (8). Polyclonal antibody raised against ClC-K1 demonstrated the existence of the channel in both apical and basolateral plasma membranes only in the thin ascending limb of Henle’s loop (14).

Because ClC-K1 is present in the plasma membrane and restricted to the thin ascending limb of Henle’s loop, we hy- pothesized that other members of the C1C family could exist in the plasma membrane of other nephron segments and serve for transcellular chloride transport. To obtain cDNAs for new members of the C1C family expressed in kidney, we designed degenerate PCR primers based on the region where amino acid sequences are completely conserved in the four C1C families of chloride channels. To eliminate C1C-K1, we used mRNA from cortex or outer medulla as materials for reverse transcription instead of using whole kidney mRNA.

We report here the isolation of new members (ClC-K2L and ClC-K2S) of the C1C chloride channel family that are expressed in distally located nephron segments, especially in the medul- lary thick ascending limb of Henle’s loop (MTAL) and cortical collecting ducts (CCD) where C1C-K1 is not present. About 20-30% of chloride ions filtered at the glomerulus are reab- sorbed in these nephron segments (151, and this chloride trans- port has important roles for body fluid homeostasis, such as production of free water (15) and control of glomerular filtra- tion rate as a signal molecule in the tubuloglomerular feedback mechanism (16).

EXPERIMENTAL PROCEDURES Reverse Danscription PCR-PCR primers used were as follows:

sense strand, CCGAATTCGG(G/C)TC(T/C)GG(A/C)(A/C)TCCCNGA(G/

The abbreviations used are: PCR, polymerase chain reaction; MTAL, medullary thick ascending limb of Henle’s loop; CCD, cortical collecting ducts; kb, kilobase(s); bp, base pair(s); DIDS, 4,4‘-diisothio- cyanostilbene-2,2’-disulfonic acid; TAL, thick ascending limb.

17677

17678 ?tu0 Isoforms of a Chloride Channel in Kidney

FIG. 1. Nucleotide sequence and de- duced amino acid seauence of C1C- K2L. The portion underlined was deleted from ClC-WS.

1 8

7 5

1 2 6

1 7 7

2 2 8

2 7 9

330

381

4 3 2

4 8 3

5 3 4

5 8 5

63 6

6 8 7

7 3 8

7 8 9

8 4 0

8 9 1

9 4 2

9 9 3

1 0 4 4

1 0 9 5

1 1 4 6

1 1 9 7

1 2 1 8

1 2 9 9

1350

1 4 0 1

1 4 5 2

1503

1 5 5 4

1 6 0 5

1656

1 7 0 7

1 7 5 8

1 8 0 9

1 8 6 0

1 9 1 1

1 9 6 2

2 0 1 3

2 0 6 4

2 1 1 5 2 1 1 4 2 2 4 1

2 3 7 5 2 3 0 8

C A A A C A A A G A A G C T G T G T T G G A G G A G G G C C T T C C GGAGCTA

Met G l u G l u 110 V a l G l y L e u A r g G l u G l y Ser P r o A r q L y s P r o V a l P r o ATG GAG GAA ATA GTG GGG CTT CGA GAG GGC TCC CCC AGG AAG CCA GTG CCT

L e u G l n G l u L e u T r p A r g P r o C y s P r o A r g I l e A r q A r g A s n I l e G l n G l y CTG CAA GAA CTC TGG AGG CCG TGC CCA CGA ATC CGC AGA AAC ATC CAG GGG

AGC CTA GAG TGG CTG AAA GAG CGG CTG TTC CGT GTG GGT GAG GAC TGG TAC Ser L e u G l u T r p L e u L y r G l u A r g L e u P h e A r g V a l G l y G l u A s p T r p T y r

P h e L e u V a l A l a L e u G l y V a l L e u Met A l a L e u I l e S e r T y r A l a Met A s n TTC CTG GTG GCT CTC GGG GTG CTC ATG GCT CTG ATC AGC TAT GCC ATG AAC

TTT GCT ATT GGA CGT GTG GTC AGA W G T I C P h e A l a I l e G l y A r g V a l V a l A r g A l a His L y s T r p L e u T y r A r g G l u I l e

G l y A s p G l y His L e u L e u A r g T y r L e u Ser T r p T h r V a l T y r P r o V a l A l a G G L G A C GGC C-G CTC C m TCT TGC ACC GTG

L e u L e u S e r P h e S e r Ser G l y P h e Ser G l n S e r I l e T h r P r o S e r Ser G l y

G l y Ser G l y I l e P r o G l u V a l L y s T h r I l e L e u T h r G l y V a l I l e L e u G l u 1 GGT GTG ATC CTG GAG

A s p T y r L e u A s p I l e L y s A m P h e G l y A l a L y s V a l V a l G l y L e u Ser C y s GAC TAC CTA GAC ATT AAG AAC TTC GGG GCC AAG GTG GTG GGC CTC TCC TGC

T h r L e u A l a T h r G l y S e r T h r I l e P h e L e u G l y L y s L e u G l y P r o P h e V a l ACC CTG GCA ACA GGC ACT ACC ATC TTC CTG GGA AAA CTG GGC CCC TTT GTG

His L e u S e r V a l Met I le A l a A l a T y r L e u G l y A r g V a l A r g T h r L y s T h r CAC CTG AGC GTG ATG ATC GCT GCT TAC CTG GGC CGC GTG CGC ACC AAG ACC

V a l G l y G l u P r o G l u A s n L y s T h r L y a G l u Met G l u L e u L e u A l a A l a G l y GTC GGG GAA CCT GAG LAC AAG ACC AAA GAA ATG GAA TTG TTG GCT GCA GGA

Ala A l a V a l G l y V a l A l a T h r V a l P h e A l a A l a P r o I l e Ser G l y V a l L e u GCA GCA GTG GGT GTG GCC ACG GTC TTC GCC GCC CCA ATC AGT GGT GTT CTG

P h e Ser I l e G l u V a l Met Ser Ser His P h e Ser V a l T r p A s p T y r T r p A r g

TTC T m GGC TTC -C TCT

TTC AGC ATC GAG GTC ATG TCC TCT CAC TTC TCC GTC TGG GAT TAC TGG AGG

G l y P h e P h e A l a A l a T h r C y s G l y A l a P h e Met P h e His L e u L e u A l a V a l GGC TTC TTC GCT GCC ACC TGC GGG GCC TTC ATG TTT CAC CTC CTG GCG GTC

P h e A s n Ser G l u G l n G l u T h r l l e T h r s e e I le T y r L y s T h r ser P h a P r o TTC AAC AGT GAA CAG GAG ACC ATC ACC TCC ATT TAC AAG ACC AGC TTC CCA

V a l A a p I l e P r o P h a A 3 p L e u P r o GTG GAC ATA CCC TTT GAC TTA CCA

A l a I l e C y s G l y I l e L e u S e r C y s GCC ATC TGT GGC ATC CTG AGT TGC

L e u P h e P h e L e u L y s S e r A a n G l y TTA TTT TTC CTC AAG TCC AAT GGG

L y s P r o L e u T y r S e r A l a L e u A l a AAG CCC TTG TAC TCA GCT CTG GCT

G l u I l e GAG ATC

G l y T y r GGG TAC

P h e T h r TTC ACC

A l a V a l GCT GTG

P h e P h e TTC TTT

A s n T y r AAC TAC

TCC AAA S e r L y s

V a l L e u GTC CTG

P h e V a l TTT GTG

cys G l n TGC CAG

L e u L e u CTG CTG

A l a S e r GCC TCC

A l a L e u GCC TTG

A r q T h r CGG ACT

A l a T h r GCT ACC

ATC ACC I le T h r

G l Y GcC

Ser

AGC ser

T Y r

TCC

TAT

P r o P r o G l y V a l G l y A r g P h e Met A l a Ser A r g L e u S e r Met Ser G l u T y r CCA CCT GGT GTG GGT CGC TTC ATG GCT TCC CGG CTG TCT ATG TCA GAG TAC

L e u Glu T h r L e u P h e A s p A a n A s n S e r T r p A l a L e u Met T h r L y s A s n S e r

S e r P r o P r o T r p Ser A l a G l u P r o A s p P r o G l n A l n L e u T r p L e u G l u T r p TCC CCA CCC TGG TCA GCG GAG CCT GAT CCC CAG AAC CTG TGG TTG GAA TGG

C y s His P r o G l n Met T h r V a l P h e G l y T h r L e u V a l P h e P h e L e u V a l Met TGT CAT CCA CAG ATG ACT GTC TTT GGG ACA CTA GTC TTC TTC CTG GTC ATG

TTG GAG ACA CTG TTT GAC AAC AAC TCT TGG GCA CTG ATG ACC AAG AAC TCG

AAG TTC TGG ATG CTG ATT TTG GCC ACC ACC ATC CCC ATC CCC GCA GO. TAC L y s P h e T r p Met L e u I l e L e u A l a T h r T h r l l e P r o I l e P r o A l a G l y T y r

TTT TTG CCC ATC TTT GTC TAC GGA GCT GCC ATC GGG CGC CTC TTT GGG GAG P h e L e u P r o I l e P h e V a l T y r G l y A l a A l a I l e G l y A r g L e u P h e G l y G l u

V a l L e u Ser L e u A l a P h e P r o G l u G l y I l e V a l A l a G l y G l y L y s V a l ser GTT CTA TCT TTG GCC TTC CCA GAG GGC ATT GTG GCT GGA GGC AAG GTC AGT

P r o I l e Met P r o G l y A l a T y r A l a L e u A l a G l y A l a A l a A l a P h e Ser G l y CCC ATC ATG CCC GGG GCC TAT GCT CTG GCA GGT GCT GCT GCC TTC TCA GGG

A l a V a l T h r His T h r L e u S e r T h r A l a L e u L e u A l a P h e G l u V a l S e r G l y GCG GTG ACC CAC ACC CTC TCC ACA GCA TTG CTG GCC TTT GAG GTA TCC GGC

G l n I l e V a l H i 3 A l a L e u P r o V a l L e u Met A l a V a l L e u A l a A l a A s n A l a CAG ATC GTT CAT GCA CTG CCT GTG CTG ATG GCC GTG CTG GCG GCC AAT GCC

ATC TGT CAG AGC TAC CAG CCC TCT TTC TAC GAC GGC ACC ATC ATT GTC AAG Ile C y s G l n Ser T y r G l n P r o S e r P h e T y r A s p G l y T h r I l e I l e V a l L y s

L y s L e u P r o T y r L e u P r o T r p I l e A r g G l y A r g L y s I l e G l y Ser His L e u AAA CTG CCG TAC CTG CCG TGG ATC CGT GGT CGT l l A G ATT GGT TCC CAC CTT

Val T h r V a l G l y His P h e Met A s n C y 3 T h r L e u T h r T h r L e u A l a L y s A s p GTG ACT GTG GGT CAC TTC ATG AAC TGT ACC CTC ACC ACG CTG GCC AAG GAC

Met P r o L e u G l u G l u V a l I l e L y s V a l V a l I l e Ser T h r A s p V a l T h r G l n RTG CCC CTG GAG GAA GTG ATC AAA GTT GTG ATC TCC ACG GAT GTG ACT CAG

T y r P r o L e u V a l G l u T h r T h r G1U Ser G l n V a l L e u V a l G l y I l e V a l L y s rAC CCC CTG GTG GAG ACG ACA GAG TCT CAG GTC CTG GTG GGC ATT GTC AAA

A r g T h r His L e u V a l G l n S e r L e u H i 3 T h r A s p Ser A l a Ser T r p A l a P r o AGG ACC CAC TTG GTG CAG TCC CTC CAT ACC GAT TCA GCT TCC TGG GCT CCA

G l y G l n G l n P r o C y , L e u Gln A ~ l p I l e L e u A l a A s n G l y C y s P r o T h r G l n GGC CAG CAG CCC TGT CTC CAG GAT ATC TTG GCT AAC GGC TGC CCC ACC CAG

CCA GTG ACA CTT CAG CTG TCC ACG GAG ACC TCC CTG CAT GAG ACG CAC AAC P r o V a l T h r L e u G l n L e u S e r T h r G l u T h r Ser L e u H i a G l u T h r His A a n

L e u P h e G l u L e u L e u A a n L e u G l n L e u L e u P h e V a l T h r S e r A r q G l y A r g CTC TTT GAG CTG CTG AAC CTT CAG CTG CTG TTC GTG ACG TCA CGA GGC AGI\

A l a V a l G l y Ser V a l S e r T r p V a l G l u L e u L y s L y s A l a I l e S e r T h r L e u GCT GTG GGC TCT GTG TCC TGG GTG GAG CTG AAG AAA GCA ATT TCA ACC CTG Phr A s n Pro P r o A l a P v o L Y I s f o n "" ."" _. . .. _ " -, __.r

ACC AAT CCG CCC GCT CCC AAG TGA GTCAGCCTGGGAGTCGGCAGCCTGGCGCCCAGTCG 3TCTCAGCTGCTGCAGGGCATCTCCACTTTGCAGAGGAGAGGACTC~CATTCACCTCTCCCCACCC rGAAGGAGCTGGTTGTAAATGAAGACACCAATGCGTTCTGTCACATCGGACCCTTGGTCCTTCTA~ : T T G T C T G C T G C T A A C C A A G A C T T C T G A G A W A % T M A A C T G A T T T C T G G ~ 4A

1 7

3 4

51

68

85

1 0 2

1 1 9

1 3 6

153

1 7 0

1 8 7

2 0 4

2 2 1

2 3 8

2 5 5

2 7 2

2 8 9

306

3 2 3

3 4 0

3 5 7

3 7 4

3 9 1

4 0 8

4 2 5

4 4 2

4 5 9

4 7 6

4 9 3

510

5 2 7

5 4 4

561

5 7 8

5 9 5

6 1 2

6 2 9

6 4 6

663

680

6 8 7

lEvo Isoforms of a Chloride Channel in Kidney 17679

K2L and its alignment with that of FIG. 2. Amino acid sequence of ClC-

ClC-K1. Conserved residues are indi- cated by colons, putative transmembrane- spanning domains are underlined (20), potential N-linked glycosylation sites (21) are indicated by asterisks, and PCR primer sites are double-underlined.

C1C-K2

C1C-K1

C1C-K2

C1C-K1

C1C-K2

C1C-K1

C1C-K2

C1C-K1

ClC-K2

C1C-K1

C1C-K2

C1C-K1

C1C-K2

C1C-K1

ClC-K2

C1C-K1

C1C-K2

C1C-K1

C1C-K2

C1C-K1

C1C-K2

C1C-K1

C1C-K2

C1C-K1

MEEIVGLREG SPRKPVPLQE LWRPCPRIRR NIQGSLEWLK ERLFRVGEDW YFLVALGVLM 1

MEELVGLREG SSGKPVTLQE LWGPCPPIRR GVRRGLEWLK ERLFRVGED- Dl

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

ALISYAMNFA IGRVVRAHKW LYREIGDGHL PRYLSWTWP VALLSFSSGF SQSITPSSGg 61

ALISYAMNFA IGRVVRAHKW LYREVGDGHL LRYLS WTVYP VALLSFSSGF SOSLSPFSGG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

D2

121 SGIPEVKTIL TGVILEDYLD IKNFGAKWG LSCTLATGST IFLGKLGPFV HLSVMIAAYL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . SGLPELKTML S G V V L E D W G A K W G L S C W G S T I FLGKVGPFV HLSVMEAU

D3 D4

GRVRTKTVGE PENKTKEMEL LAAGAAVGVA TWAAPISGV LFSIEVMSSH FSVWDYWRGF 181

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . GRVW\KTIGE T E N K A K E I E M V G V A TVFAAPFSGV LFSIEVMSSH FSVWNYWRGE:

D5

FAATCGAFMF HLLAVFNSEQ ETITSIYKTS FPVDIPFDLP EIFFFVALGA ICGILSCGYN 24 1

FAATCGAFMF RLLGVFNSEQ ETITSIYKTR FRVDVPFDLP EIF- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

D6 D7

301 YCQRTSLFFL KSNGFTSKLL ATSKPLYSAL AAVVLASITY PPGVGRFMAS RISMSEYLET . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . KQRTFLRFI KTNRYTSRLL A T S K W VALVLASITY PPGVGRFMAS RLSMAQHLHS

D8

361* LFDNNSWALM TKNSSPPWSA EXDPQNLWLE WCHPQMTVFG TLVFFLVMKF WMLILATTIP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . LFDNNSWALM TRNSSPPWPA DADPQNLWPE WCHPRFTIFG TLAFFLVMKF W-P

D9

421 IPAGYFLPIF WGAAIGRLF GEVLSLAFPE GIVAGGKVSP IMPGAYALAG AAAFSGAVTH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . M P W M P I F m G R L L G EALSVAFPE GIVAGREVNP I M P G G Y W F S G A V U

Dl0 Dl1

481 TLSTALLAFE VSGQIVHALP VLMAVLAANA ICQSYQPSFY DGTIIVKKLP YLPWIRGRKI

-E L T G W A L P VLMAVLAANA ISONC QPSFY DGTIMAKKLP YLPWIRGRQI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Dl2

54 1 GSHLVTVGHF MNCTLTTLAK DMPLEEVIKV VISTDVTQYP LVETTESQVL VGIVKRTHLV

GSYPVTVEHF MNCNLTTLAK DTPLEEVVKV VTSTEVSQYP LVETRESQTL VGIVERTHLV

* . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

60 1 QSLHTDSASW APGQQPCLQD ILANGCPTQP VTLQLSTETS LHETHNLFEL LNLQLLFVTS

QALQTQPASW APGQERFLQD ILAGGCPTQP VTLQLSPETS LYQAHSL- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

RGRAVGSVSW VELKKAISTL TNPPAPK 661

KKAVGSVSW =STL INPPAPK . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Dl3

A)(A/C)TGAA(G/A)AC; antisense strand, CCGGATCCNACCTC(T/A/G)- ATGCTGAANAG(G/C)ACNCC. The sites of PCR primers are shown in Fig. 2. 1 pg of total RNA from outer medulla in kidney was reverse- transcribed with avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim) at 42 "C for 60 min and then heated a t 94 "C for 5 min. The synthesized cDNA was used for subsequent PCR in the following profile: 94 "C for 1 min, 55 "C for 1 min, 72 "C for 3 min, 40 cycles. The PCR product was cut with EcoRI and BamHI on both ends, ligated into EcoRI- and BamHI-cut pSPORTl (Life Technologies, Inc.), and then sequenced. One clone, PAD, had about 80% nucleotide se- quence identity with that of the corresponding region in C1C-K1 but was not completely identical.

Library Construction and Screening-An oligo(dT)-primed direc- tional rat kidney cDNA library in hgt22A (Superscript cDNA synthesis

kit, Life Technologies, Inc.) was prepared and screened under high stringency (6 x saline/sodium/phosphate/EDTA, 5 x Denhardt's solu- tion, 1% SDS, 100 pg/ml salmon sperm DNA, 50% formamide at 42 "C) with PCR clone (PAD) labeled with [a-3ZPldCTP (3000 Ci/mmol, Amer- sham Corp.). In addition to CIC-Kl clone, the 2.4-kb clone 5-1 and 2.2-kb clone 11-10 were isolated and subcloned into NotI- and SalI-cut pSPORT1.

cDNA Sequencing-Nested deletion clones were prepared using the Erase-A-Base system (Promega) and sequenced using T7 DNA po- lymerase in the chain termination method. Antisense strand was se- quenced using synthetic primers. Sequencing 5-1 and 11-10 clones revealed that both clones were completely the same except that there was a deletion (165 bp) in the 11-10 clone. 5-1 and 11-10 clones were designated ClC-K2L and ClC-K2S, respectively.

17680 lluo Isoforms of a Chloride Channel in Kidney Northern Blots-RNA was extracted from various rat tissues and

kidney cortex, outer medulla, and inner medullas (17). RNA was elec- trophoresed in agarose gel containing formamide. Equal loading was additionally checked with ethidium bromide staining. After transfer to nylon membranes, blots were hybridized under high stringency with a whole CIC-K2 cDNA as a probe or a portion of the cDNA (nucleotides 216&2311), which has low homology (-51%) to CIC-K1 sequence.

Reverse 7kanscription PCR Using Microdissected Nephron Seg- ments-Dissection of nephron segments (2 mm each) and reverse transcription of mRNA were performed as previously described (18). Primers used were as follows: sense strand, 5'-GTTGGGGTTTCG- GCAGGG-3'; antisense strand, 5'-TGCTCCTGCAGCCAACAATTC- CAT'ITCT-3'. The expected PCR product covers the region from nucle- otide 39 to 689 of ClC-K2L cDNA. The PCR profile was the same as that used for degenerate primers. The expected sizes of PCR products from K2L and K2S were 651 and 486 bp, respectively. After Southern trans- fer, the blot was hybridized with the probe covering nucleotides 230-260 in ClC-K2L as previously described (18). The relative abundance of the two isoforms was compared using an image analyzer system (BAS 2000, Fuji Corp., Tokyo).

Expression of C E K 2 in Xenopus Oocytes-DNA of B'-untranslated region (83 bp) of CIC-0 was synthesized and added to the first ATG of CIC-K2L and CIC-K2S by recombinant PCR (10, 11, 19). The sequence of the new chimeric clones was verified. This does not introduce any new amino acids into the original CIC-K2L and ClC-K2S. After linearization of the construct by restriction with NotI, capped RNA was synthesized in vitro using T7 RNA polymerase. 15-20 ng of transcript was injected into Xenopus oocytes prepared as previously described. Injected oocytes were maintained in modified Barth's solution (17) for 2-4 days. Elec- trophysiological analysis was performed in ND96 solution a t room tem- perature using a two-electrode voltage clamp technique and pCLAMP software (8-11).

RESULTS AND DISCUSSION

PCR products of expected size were subcloned and se- quenced. Sequencing revealed the existence of PCR clone (PAD) in outer medulla of kidney that was highly homologous (-80% nucleotide identity) but not completely identical to that of ClC- K1. Using this PCR clone as a probe, a rat kidney hgt22A cDNA library was screened under high stringency. All the clones iso- lated were subcloned and partially sequenced. As a result of sequencing, we learned that only two clones were not identical with ClC-K1. The rest were ClC-K1. These two clones, desig- nated 11-10 and 5-1, were fully sequenced. The longer cDNA (5-1), which is about 2.4 kb long, encodes the 687-amino acid protein of a relative molecular mass of 75,000. This cDNA was designated as ClC-K2L (long). The Kyte-Doolittle hydropathy profile (20) of C1C-K2L was also very similar to those of other ClC families, especially to CIC-K1 (8). The overall amino acid identity of ClC-K2L was about 40% with Torpedo channel (CIC- 0),43% with the rat skeletal muscle channel (ClC-l), 45% with C1C-2, and 82% with ClC-K1. The shorter clone (11-10) had the same nucleotide sequence as that of CIC-K2L even in the 5'- and 3"untranslated regions, except that there was a deletion (165 bp), which corresponded to the region of the putative sec- ond membrane-spanning domain in CIC-K2L. This clone (2.2 kb), designated as ClC-K2S (short), encodes the 632-amino acid protein of a relative molecular mass of 69,000. As shown in Fig. 1, 55 amino acids were absent in ClC-K2S. These two clones, ClC-K2L and ClC-K2S, were presumed to be the transcripts from a single gene and produced by alternative splicing because the nucleotide sequences of both clones were completely iden- tical except the deletion. In ClC-K2L, there are two potential N-linked glycosylation sites (21). One is at position 364 at the putative loop between D8 and D9, and the other is a t position 553 between Dl2 and Dl3 (Fig. 2). There is no typical consen- sus phosphorylation site for CAMP-dependent kinase, but other less typical potential phosphorylation sites for CAMP-depend- ent kinase (RXX(S/T) or Rx(S/T)) are present at positions 11, 95,305, and 353.

a h

c28S rRNA

' a c2.4kb c 1 8 S rRNA

c2.4kb

t 651 bp t 486bp

FIG. 3. a, Northern blot analysis of CIC-K2 expression in different rat tissues; b, expression in kidney. 10 pg (a) and 5 pg ( b ) of poly(A)' RNA were run on each lane. c, localization of CIC-K2L and ClC-K2S tran- scripts in rat nephron segments determined by reverse transcription- PCR. PST, proximal straight tubule; thin loop, thin limb of Henle's loop; CTAL, cortical thick ascending limb of Henle's loop; IMCD, inner med- ullary collecting duct.

Northern analysis revealed that ClC-K2 mRNA was pre- dominantly expressed in kidney (Fig. 3a). A major broad band around 2.4 kb and a faint band around 3.2 kb were detected, suggesting that another mRNA species of ClC-K2 may be pres- ent. Two mRNA species corresponding to K2L and K2S could not be resolved in Northern analysis, probably due to a short deletion (165 bp). Although ClC-K1 was expressed only in the inner medulla (8), ClC-K2 was expressed in the outer and inner medulla and even in the cortex (Fig. 3b). These results were obtained using the whole ClC-K2L clone as a probe, but the same results were also obtained using the probe that covers the 3'-untranslated region and has only -51% sequence identity

To get more detailed information about the localization of C1C-K2L and CIC-K2S expressions in kidney, we performed reverse transcription PCR using microdissected nephron seg- ments. The primers were designed to detect the difference be-

with ClC-K1.

terization of ClC-K!2L and ClC-K2S FIG. 4. Electrophysiological charac-

expressed in Xenopus oocytes. Stand-

from oocytes previously injected with ClC- ard two-electrode voltage clamp traces

K2L cRNA ( b ) , CIC-K2S (c), or H,O (a) in normal saline ND96 are shown. Inset, voltage clamp program. From a holding potential of -30 mV, voltage was clamped for intervals of 2 s each to values between +60 and -100 mV.

lluo Isoforms of a Chloride Channel in Kidney

a 17681

b

I sec

C

tween ClC-K2S and ClC-K2L, the expected size of which are 486 and 651 bp, respectively. Although this method does not accurately compare the quantity of the mRNA level along nephron segments, we can gain information about where C1C- K2L and ClC-K2S are mainly expressed in kidney. As shown in Fig. 3c, two signals were detected most abundantly in the med- ullary thick ascending limb of Henle’s loop and cortical collect- ing ducts. The signals were also detected in the cortical thick ascending limb of Henle’s loop and inner medullary collecting duct. The ratio of relative abundance of K2L to K2S was about 1.7 in the cortical thick ascending limb of Henle’s loop, MTAL, and the inner medullary collecting duct, but in CCD the ratio was about 1.1, indicating that the splicing of C1C-m could be nephron segment-specific. We speculated that the reason the signal in the inner medulla in Northern blot (Fig. 3a) was as high as that in the outer medulla might be that the tissue sample from the inner medulla could be contaminated by MTAL. It is unlikely that the thin limb had the expression of K!2 in view of the reverse transcription-PCR results.

In vitro synthesized transcripts using the putative full- length clone of K2L and K2S injected into oocytes did not ex-

press any current in Xenopus oocytes as seen before with the other C1C-channels (8,111. Therefore, we replaced the sequence 5‘ to the first ATG in ClC-K2L and ClC-K2S by a 5”untrans- lated sequence from C1C-0. We obtained a large time-independ- ent current (2980 * 150 and 2730 2 300 nA at 60 mV, respec- tively; mean 2 S.D., n = 4) inXenopus oocytes injected with the ClC-K2L and ClC-K2S transcripts (Fig. 4, b and c ) , compared with H,O-injected oocytes (200 2 45 nA at 60 mV; n = 5) (Fig. 4a). The channel appeared to be open at all membrane voltage, which would be a favorable feature of chloride channel in chlo- ride-transporting epithelia. Steady-state current-voltage curves of channels revealed outwardly rectifying current-volt- age relationships (Fig. 5, a and b) , which are very similar to that of ClC-Kl(8). Partial replacement of extracellular chloride by cyclamate reduced the overall currents and resulted in shifts of the reversal potential toward positive voltage (+30.4 2 5.0 mV, n = 61, indicating that the current was anion-selective (Fig. 5, a and b). The channels displayed a Br- > I- > C1- selectivity sequence (Fig. 5 , a and b). Niflumic acid (100 p~), an inhibitor of endogenous calcium-activated chloride channel in Xenopus oocyte (K, = 17 p ~ ) (22) did not inhibit the expressed current,

17682 lloo Isoforms of a Chloride Channel in

a 3

2

1

FA

0

-1 L 0 0 0 0 0 0 0 0 0 ==op'Dpp! " W

mV

b 3

"+ -1 L

0 0 0 0 0 0 0 0 0 q = o p y p q N V W

mV

FIG. 5. Current-voltage relationships of conductance expressed from ClC-K2L (a) and ClC-K2S ( b ) cRNA in ND96 (01, in low-chloride ND96 (7 mM Cl-, 96 mM cyclamate-) ( + 1, in NaBr solution (7 mM Cl-, 96 mM sodium bromide) (W), and in NaI solution (7 m~ Cl-, 96 mM sodium iodide) (A).

supporting the idea that the current we observed was not the endogenous calcium-activated chloride current in oocyte. How- ever, extracellular DIDS, a known inhibitor of chloride chan- nels, inhibited the conductance dose dependently as shown in Fig. 6, a and b. The effect of DIDS was only partially reversible (- 10%). Diphenylamine-2-carboxylate (1 mM) inhibited the cur- rent about 15%. Thus, K2S elicited almost the same currents in terms of anion selectivity, inhibitor sensitivity, and current- voltage relation as that of K2L, even if the region containing the putative second membrane-spanning domain and the highly conserved amino acid sequence between the second and third membrane-spanning domains were deleted. As expected from sequence identity to C1C-K1, the expressed currents by K2L and K2S resembled that by C1C-K1 in terms of current- voltage relation and inhibitor sensitivity. We tested the effect of 200 PM 8-(4-chlorophenylthio)-adenosine 3',5'-cyclic monophos- phate with 1 mM 3-isobutyl-1-methylxanthine and 10 PM fors- kolin on the expressed current but did not find any effect (data not shown).

The mechanism for chloride absorption in the thick ascend- ing limb (TAL) has been characterized by various methods (23, 24). Chloride ions are reabsorbed through furosemide-sensitive Na+, K', 2C1- cotransporters on the apical membrane of TAL. The driving force for this transporter is a sodium gradient generated by the abundant Na+/K+ ATPase on the basolateral membrane. By these mechanisms, chloride concentration within TAL cells would be kept above equilibrium so that the opening of a chloride channel on the basolateral membrane leads to the eMux of chloride ions to the peritubular space. Microelectrode analyses of rabbit and hamster TAL segments

Kidney

l o o m 80

- 5 - 4 - 3 log concentration (M)

- 6 - 5 - 4 - 3 log concentration (M)

FIG. 6. Dose-response curves of inhibition of DIDS (W) and di- phenylamine-2-carboxylate (0) on expressed chloride currents (a, =L; b, K2S) in oocytes. Currents were measured at +40 mV 2 min after adding the blockers ( n = 3, mean f S.D.). DIDS blockade was only partially reversible.

perfused in vitro suggested that the majority of basolateral membrane C1- efflux was mediated through C1- channels (23, 24). Moreover, a variety of compounds known to block C1- chan- nels also inhibit salt absorption in TAL segments, a result obviously consistent with the view that basolateral C1- trans- port is via chloride channels (25). Several patch clamp studies also indicate the existence of chloride channels on the basolat- era1 membrane of TAL (26, 27). Recently, Zimniak et al. (28) reported that C1- conductance can be expressed in Xenopus oocytes by the injection of size-selected fractions of mRNA from rabbit outer renal medulla. The current-voltage curve and cur- rent tracings were very similar to those by C1C-K2. At present, there is no direct evidence about cellular localization of C1C-K2 in TAL. However, the plasma membrane localization of ClC-K1, a highly homologous protein to ClC-K2, and the pre- vious physiological studies supporting the basolateral localiza- tion of a chloride channel in TAL lead us to speculate that ClC-K2 is located on the basolateral surface of TAL.

In CCD, the apical membrane has little, if any, conductance to chloride ion, but the basolateral membrane has high chloride conductance (29). Sansom et al. (30) reported the existence of a double-barreled chloride channel on the basolateral side of the principal cells in rabbit CCD. The channel gated between two conductance levels of 23 and 46 picosiemens. Because ClC-0 was reported to be a double-barreled chloride channel (9) and C1C-m is in the same family, it is possible that C1C-m would also be the basolateral chloride channel in rat CCD. Reverse transcription-PCR results demonstrated that K2S was rela- tively more abundant in CCD compared with other nephron segments. In this paper, we could not detect a functional dif- ference between K2L and K2S; however, the functional differ- ence other than inhibitor sensitivity and anion selectivity could exist and may be contributing to nephron segment-specific chloride transport.

In summary, complementary DNA encoding for a new mem- ber of a C1C chloride channel family was isolated from rat

Tho Isoforms of a Chloride Channel in Kidney 17683

kidney. Predominant expression in TAL and collecting ducts 759-762

important role in transepithelial chloride transport and Nephrol. 4,882 among rat tissues suggests that this may have an 14. Uchida, S., Kawasaki, M., Sasaki, S., and Marumo, F. (1993) J. Am. Soc.

thereby may contribute to the maintenance of body fluid bal- 15. Seldin, D. W., and Giebisch, G. (1992) The Kidney: Physiology and Pathophysi-

The Of the the understand- 16. Schnermann, J., Dloth, D. W., and Hermle, M. (1976) Pfliigers Arch. Eur: J .

17. Uchida, S., Kwon, H. M., Preston, A. S., and Handler, J. S. (1991) J. Biol.

reading of the manuscript. 18. Moriyama, T., Murphy, H. R., Martin, B. M., and Garcia-Perez, A. (1990) Am.

13. Gill, D. R., Hyde, S. C., and Higgins, C. F. (1992) Nature 355,830-833

ology, 2nd Ed., pp. 1975-2001, Raven Press, New York

ing of mechanisms of chloride transport in kidney epithelia. Physiol. 362,229-240

Acknowledgment-We are grateful to Dr. J. S. Handler for critical Chem. 266,9605-9609

2. 1.

3. 4.

5.

6.

7.

8.

10. 9.

REFERENCES Reeves, W. B., and Andreoli, T. E. (1992)Annu. Reu. Physiol. 54, 29-50 Stoner, L. C., Burg, M. B., and Orloff, J. (1974) Am. J. Physiol. 227,453459 Hanley, M. J., and Kokko, J. P. (1978) J. Clin. Inuest. 62, 3- Paulmichl, M., Li, Y., Wickman, K., Ackerman, M., Peralta, E., and Clapham,

D. (1992) Nature 356, 23S241 Krapivinsky, G. B., Ackerman, M. J., Gordon, E. A,, Krapivinsky, L. D., and

Clapham, D. E. (1994) Cell 76,439-448 Redhead, C. R., Edelman, A,, Brown, D., Landry, D. W., and Al-Awqati, Q.

(1992) Proc. Natl. Acad. Sei. U. S. A. 89,37163720 Landry, D., Sullivan, S., Nicolaides, M., Redhead, C., Edelman, A., Field, M.,

Al-Awqati, Q., and Edwards, J. (1993) J. Biol. Chem. 268, 14948-14955 Uchida, S., Sasaki, S., Furukawa, T., Hiraoka, M., Imai, T., Hirata, Y., and

Marumo, F. (1993) J. Biol. Chem. 268,38213824 Jentsch. T. J.. Steinmever. K.. and Schwarz. G. (1990) Nature 348.510-514

19.

20. 21. 22. 23.

24.

25.

26. 27. 28.

Higuchi, R. (1989) in PCR Zkchnology (Erlich, H. A,, ed) pp. 61-70, Stockton

Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 Kornfeld, R., and Kornfeld, S. (1985)Annu. Reu. Biochem. 54,631-664 White, M. M., and Aylwin, M. (1990) Mol. Pharmacol. 37, 720-724 Greger, R., and Schlatter, E. (1983) Pfliigers Arch. Eur. J . Physiol. 396, 325-

334 Yoshitomi, K., Koseki, C., Taniguchi, J., and Imai, M. (1987) Pfliigers Arch.

Eur: J . Physiol. 408, 60C-608 Wangemann, P., Wittner, M., DiStefano, A,, Englert, H. C., Lang, H. J., Schlat-

ter, E., and Greger, R. (1986) Pfliigers Arch. Eur: J . Physiol. 407, Suppl. 2,

J. Physiol. 258, F147lLF1474

Press, New York

s12as141 Schlatter, E., and Greger, R. (1991) Wiigers Arch. Eur. J . Physiol. 418, R75 Paulais, M., and Teulon, J. (1990) J. Membr. Biol. 113,253-260 Zimniak, L., Reeves, W. B., and Andreoli, T. E. (1992) Am. J. Physiol. 263,

Steinmeyer, K., Ortlani, C., and Jentsch, T.'J. (1991) Nature 354,'301-304 F979-F984

F291-F302 11. Thiemann, A,, Griinder, S., Michael, P., and Jentsch, T. J. (1992) Nature 356, 29. Sansom, S. C., Weinman, E. J., and O'Neil, R. G. (1984) Am. J. Physiol. 247,

12. Griinder, S., Thiemann, A., Pusch, M., and Jentsch, T. J. (1992) Nature 360, 30. Sansom, S. C., La, B.-Q., and Carosi, S. L. (1990)Am. J. Physiol. 259, F46-F52 57-60