the nip gene - unt digital library/67531/metadc5152/m2/... · lee, yi-ching. physical map between...

APPROVED: Rebecca Dickstein, Major Professor Robert C. Benjamin, Committee Member Kent Chapman, Committee Merber Art Goven, Chair of the Department of Biological

Sciences Sandra L. Terrell, Dean of the Robert B. Toulouse

School of Graduate Studies

PHYSICAL MAP BETWEEN MARKER 8O7 AND 146O17 ON THE

Medicago truncatula LINKAGE GROUP 1 THAT CONTAINS

THE NIP GENE

Yi-Ching Lee, B. Sc.

Thesis Prepared for the Degree of

MASTER OF SCIENCE

UNIVERSITY OF NORTH TEXAS

December 2007

Lee, Yi-Ching. Physical Map between Marker 8O7 and 146O17 on the Medicago

truncatula Linkage Group 1 that Contains the NIP Gene. Master of Science (Molecular Biology),

December 2007, 124 pp., 14 tables, 22 figures, references, 29 titles.

The Medicago truncatula NIP gene is located on M. truncatula Linkage Group 1.

Informative recombinants showed crossovers that localize the NIP gene between markers

146O17 and 23C16D. Marker 164N9 co-segregates with the NIP gene, and the location of

marker 164N9 is between markers 146O17 and 23C16D. Based upon data from the Medicago

genome sequencing project, a subset of the model legume Medicago truncatula bacterial

artificial chromosomes (BACs) were used to create a physical map on the DNA in this

genetic internal. BACs near the potential NIP gene location near marker 164N9 were

identified, and used in experiments to predict the physical map by a BAC-by-BAC strategy.

Using marker 164N9 as a center point, and chromosome walking outward, the physical map

toward markers 146O17 and 23C16D was built. The chromosome walk consisted of a virtual

walk, made with existing sequence of BACs from the Medicago genome project,

hybridizations to filters containing BAC DNA, and PCR reactions to confirm that predicted

overlapping BACs contained DNA that yielded similar PCR products. In addition, the

primers which are made for physical mapping via PCR could be good genetic markers helpful

in discovering the location of the NIP gene. As a result of efforts repotted here, gap in

physical map between marker 164N9 and 146O17 was closed.

ii

Copyright 2007

by

Yi-Ching Lee

iii

ACKNOWLEDGEMENTS

I would like to thank the following people, without whom this work would not be

done:

• Dr. Rebecca Dickstein

• Dr. Catalina Pislariu

• Viktoriya Morris, Brandon McKethan, Matthew Meckfessel, Dr. Laurent

Coque, Dr. Harita Veershlingam, Bill Casady, Erich Spoor, Tim Flewelen,

Lydia Lindrose, Rammyani Bagchi, M. Salehin and all other members of the

Dickstein lab

• My family for years of support and encouragement

• NSF for funding

iv

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS..................................................................................................... iii LIST OF TABLES................................................................................................................... vi LIST OF FIGURES ................................................................................................................ vii LIST OF ABBREVIATIONS................................................................................................ viii Chapters

1. INTRODUCTION ............................................................................................1

1.1 Symbiotic Nitrogen-Fixing and Legume-Rhizobium Symbiosis ..........1

1.2 Nodule Development .............................................................................1

1.2.1 Initiation of Nodulation..............................................................1

1.2.2 Bacterial Infection......................................................................2

1.2.3 Nodule Organogenesis ...............................................................3

1.3 The Model Legume Medicago truncatula .............................................4

1.4 Medicago truncatula Symbiotic Mutants ..............................................5

1.5 The Symbiotic Mutant nip .....................................................................5

1.6 The NIP Gene ........................................................................................7

1.7 The Medicago truncatula Genome Sequence Project ...........................7

1.8 Genetic Map for the Location of the NIP Gene on Medicago truncatula Chromosome 1 .......................................................................................9

1.9 Goal........................................................................................................9

1.10 Chromosome Walking .........................................................................11 2. RESULTS ........................................................................................................12

2.1 Marker 164N9, BAC mth2-164n9 and mth2-164P8............................12

2.2 Using mth2-164P8 as a Center Point to Walk out toward Centromere and Telomere .......................................................................................14

2.3 Physical Map between Markers 164N9 to 146O17 (Telomere) ..........18

2.4 Physical Map between Markers 164N9 to 8O7 (Centromere).............20

2.5 Physical Map from 1G13 1F+1R to Marker 8O7 (Centromere)..........32

2.6 PCR Results for Connection between mth2-9O20 to mth2-46C14.....33

2.7 Physical Map between Markers 146O17 to 8O7 .................................36

v

3. DISCUSSION..................................................................................................38 4. METHODS AND MATERIALS.....................................................................41

4.1 Medicago Bacterial Artificial Chromosome (BAC) Culture ...............41

4.2 BAC DNA Extraction ..........................................................................41

4.3 DNA Extraction from Plant Leaves.....................................................42

4.4 BAC Sequence on NCBI Website and Primer Predication .................42

4.5 Polymerase Chain Reaction (PCR)......................................................45

4.6 BAC Filters Hybridization...................................................................45

4.6.1 Making Probe...........................................................................46

4.6.2 Stripping BAC Filters ..............................................................47

4.6.3 Prehybridization.......................................................................47

4.6.4 Hybridization ...........................................................................48

4.6.5 Wash ........................................................................................48

4.6.6 Exposure ..................................................................................48

4.6.7 Decoding ..................................................................................49 APPENDIX: PCR REACTION CONDITIONS INCLUDING PRIMER SEQUENCE ........51 REFERENCES ......................................................................................................................123

vi

LIST OF TABLES

Page

1. Virtual Walk Results for mth2-164n9 (AC157646) on Genbank................................14

2. Hybridization Walk Results 164N9 4F+4R Probe ......................................................16

3. PCR Walk Results 164N9 17F+17R ...........................................................................17

4. Ordered PCR Walk Results for 164N9 4F+4R, 164N9 Marker, 164N9 19F+19R, 164N9 18F+18R, 164P8 1F+1R, 10P15 1F+1R, 8I23 1F+1R, 57D22 1F+1R, and 4L4 1F+1R. ........................................................................................................................20

5. Ordered PCR Walk Results for 4L4 1F+1R, 52P8, 489619, AC127429, 9O20 130K, 160C2 12F+12R, 9O20 104K, 489618, 160C2 17F+17R. .........................................21

6. Ordered PCR Walk Results for Area between Physical Markers 164N9 to 159N10 ......................................................................................................................................21

7. Hybridization Walk Results for Probe 78L20 .............................................................28

8. BACs selected from Hybridization Walk with Probe 78L20. .....................................29

9. Ordered PCR Walk Results for the Area between 68B10 1F+1R to 78L20 1F+1R ......................................................................................................................................30

10. Ordered PCR Walk Results for the Area between 182H19 2F+2R to 1G13 2F+3R ......................................................................................................................................30

11. Ordered PCR Walk Results for the Area between 8O7 to 66k4 BES2 1F+1R. ..........32

12. Ordered PCR Walk Results for the Area between 66k4 BES2 1F+1R to 1G13 1F+1R......................................................................................................................................32

13. Ordered PCR Walk Results for mth2-9O20 to mth2-46C14. ......................................34

14. The Chart for Filed Number, Position, and Plate Number ..........................................50

vii

LIST OF FIGURES

Page

1. Zones for Nodule Development.....................................................................................4

2. Phenotype of Wild Type Plant (A17) vs. Phenotype of nip Plant at 15 dpi ..................6

3. Approximate Map for the Location of the NIP Gene on Medicago truncatula Chromosome 1 .............................................................................................................10

4. PCR Walk Results for BAC mth2-164P8....................................................................13

5. Genetic Marker 164N9 between Genetic Marker 146O17 and 23C16D.....................15

6. BAC Filter Probed with 164N9 4F+4R .......................................................................16

7. PCR Results of Primer 164N9 17F+17R.....................................................................17

8. The Physical Map of 164N9 4F+4R Area ...................................................................22

9. The Physical Map between 8I23 1F+1R and 160C2 17F+17R (Telomere) ................23

10. The Physical Map between 164N9 Marker and 159N10 (Centromere) ......................24

11. BAC Filter Probed with 71F24 ....................................................................................25

12. BAC filter Mt ABb A Probed with 78L20...................................................................26

13. BAC filter Mt ABb B Probed with 78L20...................................................................27

14. The Physical Map of the Area between mth2-49O22 and mth2-1G13 .......................31

15. The Physical Map of the Area between mtel-46C14 and mth2-1G13.........................33

16. PCR Results for Connection between mth2-9O20 to mth2-46C14.............................34

17. The Minimize Tiling Path between mth2-9O20 and mth2-46C14 ..............................35

18. The NCBI Website.......................................................................................................43

19. Nucleotide-Nucleotide BLAST (blastn) Tool on NCBI ..............................................43

20. Oligo Perfect ................................................................................................................44

21. The Menu of Oligo Perfect ..........................................................................................44

22. The Grid of BAC Filters and the Duplication Pattern .................................................49

viii

LIST OF ABBREVIATIONS

A17 Wild-type ecotype of Medicago truncatula

A20 Wild-type ecotype of Medicago truncatula

BAC Bacterial artificial chromosome

BES BAC end sequences

C90 original sample name for the nip mutant

CCGB Computational Genomics and Bioinformatics

CUGI Clemson University Genomics Institute

DNA Deoxyribonucleic acid

dpi Days post-inoculation

EST Expressed sequence tag

GSS Genome survey sequences

HTGS High-throughput genome sequence

latd Lateral root organ-defective

LG1 Linkage Group 1

NCBI National Center for Biotechnology Information

nip Numerous infections with polyphenolics

NR Non-redundant

PCR Polymerase chain reaction

STC Sequence tagged connector

Taq Thermus aquaticus DNA polymerase enzyme

TBE Tris-borate-EDTA

1

CHAPTER 1

INTRODUCTION

1.1 Symbiotic Nitrogen- fixing and Legume-Rhizobium Symbiosis

Nitrogen is an essential part of protein and DNA in all living organisms. Although 78%

of the earth’s atmosphere is composed of nitrogen, plants and animals cannot use N2 directly.

In order to use nitrogen, organisms need a reduced form of it. One way that N2 is reduced is by

a process called nitrogen fixation. This is the process when nitrogen is taken in the form of N2

from the atmosphere and converted into a reduced form of nitrogen: ammonia.

N2 + 8H+ + 8e− + 16Mg-ATP → 2NH3 + H2 + 16Mg -ADP + 16 Pi

(Mylona, Pawlowski et al. 1995)

The nitrogenase enzymes are very susceptible to inactivation by oxygen and these

bacteria cease production of the enzyme in the presence of oxygen. Low oxygen concentration

is achieved by different bacteria by several mechanisms, including living in anaerobic

conditions or respiring to produce lower oxygen levels. In symbiotic nitrogen fixation, the

nodules of the legume plants offer a low oxygen concentration environment for the bacteria.

The nitrogen fixing symbiosis provides legume plants with nitrogen, and thus legume plants

have the ability to grow in barren and infertile soil. By the nodule’s nitrogen fixing symbiosis,

legume plants also add reduced nitrogen to the surrounding soil, enriching it and serving as a

natural fertilizer (Graham and Vance 2003).

1.2 Nodule Development

1.2.1 Initiation of Nodulation

Legume plants will enter into the symbiosis and produce nodules with bacteria only

when the environment lacks reduced nitrogen. The initiation of nodulation involves a complex

of various chemical compound signals’ interaction between plants and bacteria. In the first step

2

of nodule development, legumes release flavonoids to attract rhizobia, and flavonoids activate

nod (nodulation) genes in rhizobia to produce the Nod factors (Szczyglowski and Amyot

2003). The structure of Sinorhizobium meliloti, Nod factors, consists of a backbone of three to

five β-1, 4-linked N-acetylglucosamines carrying a fatty acid on a nonreducing sugar residue

(Ardourel, Demont et al. 1994). Nod factors were hypothesized to bind the receptor Nod factor

perception protein (NFP). NFP is a putative Nod factor receptor gene encoding a lysine motif

(LysM) receptor like kinase (RLK). In L. japonicys two trans-membrane LysM-RLK, NRF1

and NRF5 are required in root hairs to initiate the calcium influx causing membrane

depolarization and swelling of the root hair tip for initiation of nodulation (Cullimore and

Dénarié 2003; Oldroyd and Downie 2004). This ion influx as a signal was hypothesized to be

transduced by the DMI1 and DMI2 gene products. Next, Ca2+ spiking active is proposed to the

calcium-calmodulin dependent protein kinase (CCaMK) DMI3 (Mitra, Gleason et al. 2004;

Oldroyd and Downie 2004). The putative cation channel DMI1 and the receptor like kinase

DMI2 were predicted to be up stream of the Ca2+ spiking and DMI3. DMI3 kinase, which is

located in the nucleus of epidermal cells, may interact with transcription factors to control gene

expression in host plant cells. NSP1 and NSP2 gene are located downstream of DMI3 and are

putative transcription factors. They are activated by phosphorylation of DMI3, and NSP2 is

believed to initiate gene expression. NSP2 is also believed to increase the amount of cytokinin

in the root epidermal cells. Cytokinin activates the LHK1 receptor in cortical cells, and the

LHK1 receptor is an activator for NSP2 for the formation of nodule primordium (Oldroyd

2007).

1.2.2 Bacterial Infection

After rhizobia reach the outer layers of the root hairs, the further curling of the root

hairs trap rhizobia in the “shepherd’s crook” and form an infection thread for rhizobia to enter

3

the host plant (Brewin 1991). Shepherd’s crook contains a root hair forming a 360 degree curl.

Inside of the “shepherd’s crook” the bacteria are thought to hydrolyze the cell wall;

subsequently, the plasma membrane invaginates, and new cell walls are formed around it.

Concomitant with infection thread formation, cortical cell division occurs to form a nodule

primordium. After the thread has grown through the outer cortical cell layer and reached the

newly divided cortical cells of the nodule’s primordium, rhizobia are endocytosed into the

plant host cells and form the symbiosome. The infection threads terminate at the primordium

where they release the rhizobia into the plant host cell’s cytoplasm in a process resembling

endocytosis (Hirsch 1992) (Gage and Margolin 2000). In the symbiosome, rhizobia are

surrounded in a plant membrane, so they cannot enter the intracellular space in the plant host

cell. Also, rhizobia divide along with the symbiosome membrane and differentiate into

bacteroids for nitrogen-fixing (Brewin 1991; Brewin 2004).

1.2.3 Nodule Formation

When nodule is developing, several zones are formed. The top part is the nodule

meristem, also called zone I (Vasse, de Billy et al. 1990). Next is zone II, and it is the infection

zone containing rhizobia inside infection threads. Between zone II and zone III is the interzone

II/III where rhizobia differate into the bacteroid for nitrogen-fixation. Zone III is the

nitrogen-fixing zone. The last zone, zone IV, only can be found in old nodules. It contains

aging rhizobia and host cells.

4

Figure 1: The position of each zone. Zone I is nodule meristem. Zone II is infection zone. Zone II/III is developmental zone. Zone III is Nitrogen fixing zone. Zone IV is senescence.

1.3 The Model Legume Medicago truncatula

In our research, we are studying the legume-rhizobium symbiosis using the model

legume Medicago truncatula. There are advantages which make M. truncatula a good model

among legume species. It is a member of the Papilionoideae sub-family of the legumes and is

also closely related to the majority of crop and pasture legumes; moreover it is a cousin of

alfalfa an important crop plant. For other aspects, M. truncatula also has a relatively small,

diploid genome with size of ~454 to 526 Mbp, which makes it useful for both genetics and

genomics (Young, Cannon et al. 2005). Further, it is self-fertile and produces a large number of

seed on a plant with a relatively small stature. Finally, it is relatively easy to transform, which

makes it suitable for reverse genetics experiments. The M. truncatula genome sequence is

expected to be finished in 2008 (http://www.medicago.org/genome/). Also, many mutant lines

are available for genetic research. Additionally, different ecotypes can be used for genetic

studies.

5

1.4 Medicago truncatula Symbiotic Mutants

The mutants dmi (doesn’t make infection), nsp (nodulation signaling pathway), nfp

(Nod factor perception), and hcl (hair curling) are defective in early responses of the plant to

Nod factors(Catoira, Galera et al. 2000) (Wais, Galera et al. 2000). The mutant, sunn, has auxin

defects (Penmetsa, Frugoli et al. 2003), and skl has ethylene defects (Penmetsa and Cook

1997). Researchers also isolated mutants from ethyl methanesulfonate mutagenesis at the early

stage of nodule infection; such as, lin (lumpy infection) (Kuppusamy, Endre et al. 2004), rit

(root hairs, infection thread, trichomes, identified by Oldroyd), and bit (branched infection

threads recently cloned by Oldroyd). All of them have a similar phenotype of reduction in the

number of infections.

1.5 The Symbiotic Mutant nip

In order to investigate the legume-Rhizobium symbiosis, scientists in the Dickstein lab

isolated the symbiotic mutant nip from Medicago truncatula. The nip mutant, C90, was

isolated from a Medicago truncatula population mutagenized with ethyl methane sulfonate.

The nip mutant showed nitrogen deficiency symptoms when grown in the presence of S.

meliloti and without nitrogen, and it has a defective root system and shorter lateral roots than

the wild type. The nip mutant produces small brown bump-like nodules instead of pink

nitrogen fixing nodules found in wild type (Veereshlingam, Haynes et al. 2004). It has

abnormal proliferative infection threads that only rarely release rhizobia into nodule primordia

cells. Previous research indicated that nip has the ability to initiate a symbiotic interaction with

Sinorhizobium meliloti and to generate normal nodule primordia and infection threads, but fails

in the step of releasing the bacteria from the infection threads into the host plant cells, and the

bacteria consequently cannot differentiate further to produce reduced nitrogen. When the nip

mutant grows with S. meliloti and without nitrogen in media, it shows nitrogen starvation

6

symptoms. nip primary shoots were found to be approximately the same size as wild type at 5

and 10 days post-inoculation (dpi) and 75% of wild type at 15 dpi, and this is considered to

reflect a nitrogen deficiency. Also, nip was found to have semi-penetrant lateral root defects

and showed shorter primary roots. After 10 dpi, nip generated small brown bump-like nodules;

however, they were different from the pink nitrogen fixing nodules found in wild type. This

leads to a smaller overall size and higher death rate than wild type (Veereshlingam, Haynes et

al. 2004). The allelism tests by Dr. H. Veereshlingam indicated that the nip mutant is allelic to

the latd (lateral root organ defective) mutant, which was isolated in Dr. J. Harris’s lab which

has similar phenotype to nip (Bright, Liang et al. 2005).

Figure 2: Phenotype of wild type plant (A17) vs. phenotype of nip plant at 15 dpi. A.Wild type plant (A17); B. nip plant; C. Wild type primary root with emergent lateral roots; D. nip later root; E. Wild type nodule; F. nip nodules (bumps) (Veershlingam, Haynes et al. 2004).

7

1.6 The NIP Gene

The nip mutant was shown to be recessive and behaved as a single gene defective

mutant. The nip mutant defines a new locus, NIP, required for appropriate infection thread

development during invasion of nascent nodules by rhizobia. A20 and A17 are ecotypes and

are the basis for making a genetic map (Penmetsa and Cook, 2000). For genetic and phenotypic

analysis of the NIP gene, nip was back-crossed twice (BC2) into A17 M. truncatula, and nip in

A17 Medicago truncatula background was also crossed into another ecotype M. truncatula

A20. Based on linkage analysis of F2 progeny from the nip x A20 cross, we have an outline of

the position of the NIP gene on the M. truncatula genome.

1.7 The M. truncatula Genome Sequence Project

The M. truncatula genome sequence project started in 2003 with funding from the

Samuel Roberts Noble Foundation. Subsequent funding is being provided by the National

Science foundation and the European Union's Sixth Framework Programme. M. truncatula has

8 haploid chromosomes, approximately 500 Mb of sequence, and approximatlely 150 Mb of

euchromatin. The complete sequence expected to be finished in 2008. The Website of M.

truncatula genome sequence project provides coordination for sequencing of the M. truncatula

genome, including access to physical and genetic maps, molecular markers, BAC sequences,

genome browsers, and annotation (http://www.medicago.org/genome/). The center database

Website for the M. truncatula genome sequence project is maintained by the U Minnesota and

the center for Computational Genomics and Bioinformatics (CCGB) (Young, Cannon et al.

2005). Moreover, sequence data is deposited to Genbank (http://www.ncbi.nlm.nih.gov/) and

updates are made daily.

To investigate the nip mutant, it is necessary to clone the NIP gene. We are using gene

prediction from a subset of the model legume Medicago truncatula bacterial artificial

8

chromosome (BAC) clones and the technique of chromosome walking, to discover the location

of the NIP gene. A BAC is a DNA construct, based on fertility plasmids, used for transforming

and cloning in E. coli. BACs are often used to sequence DNA of organisms in genome projects.

A short piece of the organism's DNA is amplified as an insert in BACs, and then sequenced.

There are currently five Mt BAC libraries. These BAC libraries were constructed for genome

analysis and map-based cloning of symbiotic genes. BAC libraries represent a resource for the

map-based cloning and physical mapping in Medicago truncatula and other legumes.

The first M. truncatula BAC library, mth1, was constructed by Dr. Cook (UC Davis)

using the pBeloBAC11 (Shizuya 1992). M. truncatula A17 DNA was the template and it was

partially digested by the HindIII restriction enzyme. This library contained 30000 clones of

100 kb average size representing 5 haploid genome equivalents (Nam, Penmetsa et al. 1999).

The second library, mth2, was used to complement the mth1 library, and it contained 100000

clones of 120 kb average size (Choi, Kim et al. 2004). To avoid gaps that will be encountered

when chromosome walking in only HindIII based libraries, more libraries were developed. The

third library, mtel, was constructed in France using partial digests of M. truncatula DNA by

EcoRI (Chalhoub, Belcram et al. 2004). The fourth library, mtb1, was constructed in Korea

using partial digests of M. truncatula DNA by BamHI (U Sogang, Korea). The fifth library,

mth4, was a library with larger inserts (over 200 kb) and constructed using HindIII partial

digestion.

In order to organize these BACs, 44000 clones of the mth2 library have been

fingerprinted by HindIII digestion and organized into 1370 contigs (average size around 340

kb). A contig in genome sequencing projects is a set of overlapping DNA pieces derived from a

genetic source. A contig map shows the relative order of linked BACs or other DNA pieces

determined by overlapping DNA restriction fragments contigs. When searching BACs within

the contig, the rate for finding BACs around in the same contig is high (Mun, Kim et al. 2006).

9

At the same time, many seed BACs which contain expressed sequence tag (EST) were fully

sequenced by sequence tagged connector (STC) at the U Oklahoma

(http://www.genome.ou.edu/medicago.html). STC is based on the BAC-end sequence (BES).

More than 55000 clones’ BES of mth2, 30000 clones’ BES of mte1, and 10000 clones’ BES of

mth4 were sequenced (Medicago truncatula Handbook, 2006). BES are useful for

chromosome walking both on virtual walk and actual walk to build up physical map. The

National Center for Biotechnology Information (NCBI) provides BES information and the tool

to BLAST BES to different databases (http://www.ncbi.nlm.nih.gov/), such nr, htgs, and gss.

By blasting BES to different databases, one can obtain some hints for overlapping BACs.

1.8 Goal

The goal for the project is to build the physical map between marker 8O7 and 146O17 on

the M. truncatula linkage group 1 or LG1 that contains the NIP gene.

1.9 Genetic Map for the Location of the NIP Gene on Medicago truncatula Linkage Group 1

We used the A17/A20 genetic map for mapping NIP in A17 background. The mutant

nip was crossed to the ecotype A20 that contains wild-type NIP genes. F2 progeny from this

cross were evaluated for nodulation phenotype. Leaves, DNA, and seeds from the F2 progeny

were collected. We now have approximately 1500 nip/A20 mapping population plants. We

established the location of the NIP gene on Medicago truncatula linkage group 1.

10

Figure 3: The approximate map for the location of the NIP gene on Medicago truncatula linkage Group 1.

We identified the genotype of each F2 plant at various genetic loci, and by doing so we

can identify recombinant plants in the genetic interval that contains NIP. These are identified in

PCR reactions with primers for markers 146017 and 23c16d (Morris, Thesis 2007). These two

genetic markers define the interval containing NIP and they have a significant difference in

product size. Many markers also flank the putative location of the NIP gene, allowing for quick

screening of informative recombinant plants that have genetic crossovers in that region. After

analyzing the PCR data, more and more informative recombinants within the mutant

population were found. Each loci can be identified as either A17 (indicating the mutant’s

parental lineage) homozygote, A20 (wt) homozygote or heterozygote. By comparing the

genetic composition of locus to the plant’s phenotype, each locus can be linked to the nip or

wild type phenotype. By this process, we can narrow down the genetic area in which the NIP

gene could be located (Figure 1). Combined with the development of the physical map, more

markers are predicted and used in genetic analysis. We selected BACs around the NIP region

11

and used either their end or internal sequences to be genetic markers to identify polymorphisms

in different A17 and A20 ecotypes.

1.10 Chromosome Walking

Chromosome walking, the BAC-by-BAC strategy, contains 4 parts: virtual walk,

hybridization walk, PCR walk, and sequencing BACs determined to be part of minimal tiling

path(Altschul, 1990). For the virtual walk, we used existing sequence and the BLAST

algorithm to BES database (Genbank GSS) and BAC sequence databases (Genbank HTGS and

NR) for overlapping BACs. By BLAST, the overlapping BES and non-overlapping BES could

be obtained, and non-overlapping BES would be used on virtual walk for obtaining more BACs.

At the same time, one needs to pay attention to the contig information of the relevant BACs.

For the hybridization walk, 32P-labeled DNA from one BES is used as a hybridization probe

against BACs arrayed on filters. After decoding the resulting hybridization pattern, BACs that

were found from BAC filters were checked for their contig information and used in virtual

walks for obtaining more overlapping BACs. For the PCR walk, sequence information from

BES would be used to predict primers, and primers would be used in PCR reaction against

BACs found by both virtual walks and hybridization walks to confirm overlap. Based on those

results, the physical map was built. Finally, we selected several BAC clones and sent them to

Dr. Bruce Roe at University of Oklahoma for DNA sequence. Dr. Bruce Roe is part of the M.

truncatula genomic sequencing team. The sequence can be used to predict more genetic

markers useful for narrowing down the position of the NIP gene.

12

CHAPTER 2

RESULTS

2.1 Marker 164N9, BAC mth2-164n9 and mth2-164P8

In the spring 2006, the M. truncatula genome project reported marker 164N9 as being

on linkage group 1 at 0.7 cM (http://www.medicago.org/genome/). That map position is close

to the position of NIP (H. Wessler unpublished data). Marker 164N9 came from partial

sequence of mth2-164N9, as reported by the M. truncatula genome project. Subsequently,

Heath Wessler and Viktoria Morris showed that marker 164N9 co-segregates with the NIP

gene. As a first step to correlate the genetic Medicago map with the physical Medicago map in

this region, we tried to PCR BAC mth2-164n9 with primers corresponding to marker 164N9.

The results showed that DNA corresponding to BAC mth2-164N9 could only be obtained in

PCR reaction containing genomic DNA and not from BAC mth2-164N9. This result strongly

suggested that marker 164N9 was contained within a different BAC. We then used the PCR

fragment obtained from a PCR reaction of genomic DNA using 164N9 primers to probe the

BAC filter sets. We found that the BAC mth2-164P8 and not BAC mth2-164N9 hybridized to

the 164N9 marker fragment (Figure 2). In further PCR experiments with primers derived from

the partial sequence of mth2-164N9, DNA was amplified from mth2-164P8 and not

mth2-164N9 confirming our identification. We reported this information to the genome

project, which later confirmed our data (Dr. Bruce Roe, personal communication). In order to

determine the position of mth2-164P8 relative to other BACs, mth2-164P8 sequences were

used to predict primers, which were used as PCR primers in reaction that contained BAC DNA

of BACs predicted to overlap mth2-164P8. Mth2-164P8 is in DNA fingerprint contig 1356 and

BACs predicted as overlapping mth2-164P8 frequently came from this contig.

13

Figure 4: PCR results for BAC mth2-164P8.

Locations of PCR primer set used to identify overlapping BACs with mth2-164P8. The

positions were deduced from the experiments described here and were later confirmed when

the full sequence of mth2-164P8 was completed. None of the primers successfully amplified

DNA when mth2-164N9 DNA was used as template. Orange bar is BAC mth2-164P8. RED

star marker is present positive PCR results.

The location of genetic marker 164N9 is between genetic markers 146O17 and

23C16D (Figure 3). In the first phases of my work, the orientation of mth2-164P8 was

unknown. In order to figure out the orientation, a physical bridge between markers 164N9,

and/or 146O17 and/or 23C16D needed to be found. To build up the physical map, a

BAC-by-BAC strategy was used. The BAC-by-BAC strategy, also called chromosome

walking, is a technique that orders BACs in the genome around a sequenced piece of DNA. The

DNA sequence is used as a probe, such as probe 164N9 4F+4R. First, we screened the gene

library for BACs hybridizing with the probe 164N9 4F+4R. These are then subjected to further

rounds of PCR testing, using primers predicted to BES as probe to piece out the order of BACs.

The most distal BES of the most distal BAC was used as another probe to obtain other BACs.

14

This is repeated until the gap is sealed between BACs that contain in genetic markers. The

telomere is beyond genetic marker 146O17. The centromere is beyond genetic marker

23C16D.

2.2 Using mth2-164P8 as a Center Point to walk out toward Centromere and Telomere

By taking marker 164N9 as a center point, we walked from marker 164N9 toward

146O17 (telomere) and toward 23C16D (centromere). At this time, mth2-164P8 was in

sequencing phase 2, so its sequence was unordered. In order to get more information to walk

out from marker 164N9, a virtual walk using sequence at Genbank was done (Table 1).

Table 1: Virtual walk results for mth2-164n9 (AC157646).

BAC name BES #1 hits on mth2-164n9 BES #2 hits on mth2-164n9 mth2-164n9 AC157646 mth2- 71E14 CG936344.1 out end CG936332.1 116364-117218 mth2-44J7 CG970358.1 out end CG970345.1 out end mth2-164P8 CR491524.1 110442-110663,110100-110209 CR491525.1 1-632 mth2-69F3 CG935728.1 538-782 CG935392.1 110442 -110663,110100-110209 mth2-68B10 CG922494 out end CG922484 4034-4843 mth2-154G18 CR485394.1 4082-4843 CR485393 out end mth2-10P15 CG919384.1 out end CG919371.1 43757-44649 mth2-32A7 CG951951.1 43816-44535 CG951567.1 out end mth2-38K19 CG976225.1 69535-70313 CG975869.1 out end mth2-159N10 CR489384.1 out end CR489385.1 69748-70319 mth2-187J11 CR478106.1 out end CR478105.1 104529-105053 mth2-8I23 CG957056.1 72759-73567 CG957042 out end mth2-7m17 CG928667.1 out end CG928654.1 out end mth2-78L20 CG935356.1 out end CG935342 11,823-12,717 mth2-71F24 CG959635 1-432 CG959625 out end mth2-57D22 CG928388 out end CG928377.1 70316-70785 mth2-4L4 CG927769 86714-87613 CG927756 out end mth2-49o22 CG960491 58910-59462 CG960480 out end mth2-161F23 CR490549.1 59060-59468 CR490548 out end mth2-157H22 CR488599.1 12714-13372 CR488600.1 110442-110663,110100-110209 mth2-144F11 CR501681 out end CR501682 43414-43762 mth2-143J16 CR494277.1 43054-43760 CR494276.1 out end

At the same time, a hybridization experiment was carried out by Dr. Catalina Pisariu on

BAC filters of mth1, mth2 libraries (Figure 4). Using 164N9 4F+4R fragment as a probe, the

15

Figure 5: Genetic marker 164N9 between genetic marker 146O17 and 23C16D.

16

location of primer 164N9 4F+4R was found to be very close to marker 164N9. After the

hybridization of primer 164N9 4F+4R to the BAC filters, the results were reconciled with

BACs from virtual walk. The results confirmed several BACs from the virtual walk. Those

BACs were obtained from Clemson University Genomics Institute (CUGI) for further

research.

Table 2: Hybridization walks results from BAC filters with 164N9 4F+4R probe. BACs, which were marked red, were the same as the results from the virtual walk.

BACs of actual walk mth2-32A7 mth2-157K7 mth2-178E3 mth2-18J21 mth2-194G23 mth2-57J13 mth2-38K19 mth2-145P9 mth2-180D10 mth2-21P24 mth2-213N4 mth2-64O16 mth2-10P15 mth2-191E19 mth2-184F16 mth2-27E18 mth2-231D5 mth2-81O13 mth2-164P8 mth2-92B19 mth2-145P6 mth2-17J11 mth2-232F2 mth2-93J6 mth2-159N10 mth2-76M10 mth2-152P22 mth2-23G16 mth2-208F7 mth2-94K9 mth2-187J11 mth2-52D14 mth2-148I19 mth2-182L2 mth2-235E6 mth2-3C11 mth2-157H22 mth2-91I1 mth2-149F20 mth2-158D13 mth2-221K7 mth2-6E18 mth2-69F3 mth2-91O24 mth2-146A18 mth2-146L24 mth2-215P10 mth2-22F16 mth1-42L1 mth2-250F1 mth2-155C17 mth2-168D10 mth2-189A1 mth2-31G1 mth1-42L22 mth2-122M2 mth2-159E7 mth2-189M6 mth2-191H24 mth2-31K18 mth1-56F6 mth2-117A5 mth2-155E3 mth2-181D11 mth2-188K17 mth2-32J24 mth2-44A20 mth2-111C15 mth2-157J14 mth2-40F22 mth2-134I23 mth2-104E14 mth2-6A17 mth2-131D7 mth2-174C5 mth2-132F6 mth2-98E3 mth2-101Y21 mth2-6M20 mth2-101A16 mth2-39L4 mth2-135K8 mth2-130F4 mth2-128H2 mth2-126O7 mth2-124E11

Figure 6: BAC filter Mt ABb A, probed with 164N9 4F+4R from Dr. Catalina Pisariu. The BAC filter Mt ABb A has been divided to 6 regions. By decoding the patterns on the filter with the spot location, the overlapping BACs’ name could be found.

17

Primers were predicted from the sequence of mth2-164P8 (mth2-164N9), and they

were used to PCR DNA using mth2-164P8 as template. They were also used on BACs that

were found from Genbank and probing of BAC filters with 164N9 4F+4R. For example,

primer 164N9 17F+17R was tested on A20 DNA and 22 BACs including mth2-164P8. The

results showed that 164N9 17F+17R anchored mth2-164P8 and other 11 BACs in this area

(Figure 5 and table 2). BES of BACs from the virtual walk and the actual walk were used to

predict more primers for mapping.

Figure 7: This is a picture of primer 164N9 17F+17R PCR results with 22 BACs and A20 DNA in 2% agarose gel. Table 3: PCR results of primer 164N9 17F+17R with BACs’ name.

Lane 1 Lane 2 Lane 3 Lane 4 BAC primer mth2- 164N9 mth2-71E14 mth2- 68B10 mth2- 154G14 164N9 17F+17R - - - -

Lane 5 Lane 6 Lane 7 Lane 8 BAC primer mth2- 10P15 mth2- 32A7 mth2- 38K19 mth2- 159N10 164N9 17F+17R + + + +

Lane 9 Lane 10 Lane 11 Lane 12 BAC primer mth2- 187J11 mth2-164P8 mth2- 69F3 mth2- 4L4 164N9 17F+17R + + + -

Lane 13 Lane 14 Lane 15 Lane 16 BAC primer mth2- 7M17 mth2-8I23 mth2- 49O22 mth2- 57D22 164N9 17F+17R - - + -

Lane 17 Lane 18 Lane 19 Lane 20 BAC primer mth2- 71F24 mth2-78L20 mth2- 143J16 mth2- 144F11 164N9 17F+17R - - - -

Lane 21 Lane 22 Lane 23 BAC primer mth2- 157H22 mth2-161F23 A20 164N9 17F+17R + + +

18

Based on the 3 known unordered sequences of mth2-164P8 (mth2-164N9) and PCR

results of primers 164P8 1F+1R and 164P8 3F+3R from two BES of mth2-164P8, the basic

physical map framework was revealed, and 3 unordered sequence pieces of mth2-164P8

(mth2-164N9) were ordered. The ordered primer locations of mth2-164N9 and mth2-164P8

helped to lock in other primers and BAC’s locations. Comparing PCR results of primer 164P8

1F+1R, 164P8 3F+3R, 10P15 1F+1R, and 164N9 4F+4R, the locations of each BAC could be

approximately revealed. For example, mth2-10P15 had two BES, and 10P15 1F+1R was

represented for one of them (the BES CG919384). The PCR results showed that 10P15 1F+1R

was not anchored to mth2-164P8. Mth2-10P15 was anchored to 164N9 4F+4R, 164P8 1F+1R,

and 164P8 3F+3R. These information indicated that the location of 10P15 1F+1R (the BES

CG919384) is out of mth2-164P8, and most of mth2-10P15 overlapped with mth2-164P8.

After analyzing and ordering all PCR results, the physical map was expanded from

mth2-164P8, but the orientation was still unknown (Table 3 and Figure 6). In order to walk

closer to the NIP gene on the genetic map, more markers need to be predicted and discovered.

All primers in this area were tested in PCR reactions with A17 and A20 DNA to look

for polymorphisms. The PCR results of 4L4 1F+1R with A17 and A20 DNA showed that the

A17 and A20 products had different sizes. This showed that A17 and A20 were polymorphic

for 4L4 1F+1R, so 4L4 1F+1R could be used as a genetic marker that was useful in our quest

for mapping NIP.

2.3 Physical Map between Marker 164N9 to 146O17 (Telomere)

From the genetic map, markers ENBP, 3C01, and 2D12 were located between markers

164N9 and 146O17. The BES of mth2-9O20 also was used to identify overlapping BACs from

Genbank, such as mth1-12P21, mth2-160C2, mth1-52P8, mth1-57P5, mth1-80G21, mth2-

160C2, mth2-175E1, and mth4-157H12. Two BES of mth2-9O20 were also used to predict

19

primers, such as 9O20 130K and 9O20 104K. Both of them were used to PCR BACs that were

identified by BES of mth2-9O20 to determine the direction. The PCR results showed that 9O20

130K went further toward marker 164N9; moreover, mth2-160C2 and mth1-52P8 were

predicted to be near marker 164N9. Next, the sequence of mth2-160C2 was released on the

NCBI Website, but it contained unordered pieces. In order to get more information, primers

were predicted form different pieces of mth2-160C2 sequence, but many of them did not have

positive PCR results. Therefore, mth1-52P8 was used to replace mth2-160C2 and determined

other BACs from Genbank. Based on the information Genbank, the available BACs for

crossing the area between mth2-9O20 and mth2-57D22 were few, and mth1-52P8 was seen to

be the distal one toward marker 164N9.

The BES of mth2-164P8 were used to do a virtual walk on Genbank and pulled out

many BACs. The mth2-160M23 and mth2-71F24 were seen to be distal BACs from

mth2-164P8, but the position was unknown. Therefore, both of mth2-160M23 and

mth2-71F24 were tested with the primers 9O20 130K and 52P8 1F+1R to figure out which one

was located between marker 164N9 and 146O17. After analyzing the PCR results,

mth2-160M23 was determined to overlap with mth1-52P8, thus closing the gap and showing

that this side of mth2-164P8 is telomeric. Then, the direction of mth2-164P8 was revealed and

the physical map between marker 146O17 and 164N9 was finished (Table 4 and Figure 7).

20

Table 4: Ordered PCR results of primers 164N9 4F+4R, 164N9 Marker, 164N9 19F+19R, 164N9 18F+18R, 164P8 1F+1R, 10P15 1F+1R, 8I23 1F+1R, 57D22 1F+1R, and 4L4 1F+1R. The pink color shows that the positive results are connected. BAC mth2-164P8 (blue) is the base for order.

Primers DNA

164n9 4F+4R

164n9 marker

164n9 19F+19R

164n9 18F+18R

164P8 1F+1R

10P15 1F+1R

8I23 1F+1R

57D22 1F+1R

4L4 1F+1R

A20 + + - - + + + - + A17 + + + + + + - - - mth2-10P15 + + + + + + - - - mth2-32A7 + + + + + - - - - mth2-38K19 + + - - - - - - - mth2-159N10 + + - - - - - - - mth2-187J11 + + + - - - - - - mth2-69F3 + + + + + - - - - mth2-164P8 + + + + + - - - - mth2-4L4 - - - + + + + + + mth2-8I23 - - + + + + + - - mth2-49O22 + - - - - - - - - mth2-57D22 - - + + + + + + - mth2-160M23 - - + + + + + + + mth2-157H22 + + + + + - - - mth2-161F23 + - - - - - - -

2.4 Physical Map between Marker 164N9 to 8O7 (Centromere)

From previous PCR results of 164N9 primers, BACs between markers 164N9 and 8O7

were recognized. Using the sequence of mth2-164N9 as a template to match with the new

BACs BES, the distal BES toward marker 164N9 of each BAC was then known to be found,

and the other BES was the distal one toward marker 8O7. Although the direction of each BAC

was known, the path and order of these BACs was unclear. In order to walk toward marker

8O7, the distal BES toward marker 8O7 of each BAC was used to predict primers. All primers

were used to test all BACs in this area. From PCR results, mth2-71F24 and mth2-78L20 were

found to be the most distal BACs toward marker 8O7 from marker 164N9 (Table 5 and Figure

8).

21

Table 5: Ordered PCR results of primers 4L4 1F+1R, 52P8, 489619, AC127429, 9O20 130K, 160C2 12F+12R, 9O20 104K, 489618, 160C2 17F+17R. PCR results showed that mth2-175E1, mth2-160M23, and mth1-52P8 make a minimal tiling path to connect the area between markers 164N9 and 146O17.

Primer DNA

4L4 1F+1R 52P8 489619 AC127429

9O20 130K

160C2 12F+12R

9O20 104K 489618

160C2 17F+17R

A20 + + + + + + + + - A17 - + + + + + + + - mth2-160M23 + + - - - mth2-175E1 + + + - - - - - - mth2-160C2 - - + + + + + + + mth2-9O20 - - + + + + + + mth1-52P8 - + + + + - - - - mth1-57P5 - - - + + + + - mth1-80G21 - - + + + + + + mth4-157H12 - - + + + + + + mth1-67G4 - - - - - - + + mth4-190K14 - - - - - - + + mth2-233L8 - - - - - - + - mth1-12P21 - - + + + - - -

Table 6: Ordered PCR results for the area between marker 164N9 to 159N10 1F+1R.

Primers DNA

159N10 1F+1R

38K19 1F+1R

187J11 1F+1R

164P8 3F+3R

164n9 15F+15R

157H221F,+1R

164n9 16F+16R

164n9 17F+17R

164n9 4F, 4R

164n9 marker

A20 + + + + + + + + + + A17 + + + + + + + + + + mth2-68B10 + + + + - - - - - mth2-154G18 + + + + - - - - - mth2-10P15 - - - - - - - + + + mth2-32A7 - - - - - - - + + + mth2-38K19 - + + + + + + + + + mth2-159N10 + + + + + + + + + + mth2-187J11 - - + + + + + + + + mth2-69F3 - - - + + + + + + + mth2-164P8 - - - + + + + + + + mth2-49o22 + + + + + + + + + - mth2-144f11 - + + + + + + - - - mth2-157h22 - - - - - + + + + + mth2-161f23 + + + + + + + + + - mth2-71f24 + + + - - - - - - - mth2-78L20 + + + + + - - - - -

22

Figure 8: The physical map of 164N9 4F+4R area. The orange colored bars are present BACs, and the blue colored bars are the BACs that were sent out for sequencing. Red star markers are positive PCR results. The green cap means that the precise end of BAC.

23

Figure 9: The physical map between 8I23 1F+1R and 160C2 17F+17R (telomere). The orange colored bars are present BACs, and the blue colored bars are the BAC that was sent to Dr. Bruce Roe for sequence. Red star markers are positive PCR results.

24

Figure 10: The physical map between marker 164N9 and 159N10 (centromere). The orange colored bars are present BACs, and the blue colored bars are the BACs that were sent out for sequencing. Red star markers are positive PCR results. The green cap means that the precise end of BAC.

25

From the results, mth2-71F24 was the BAC that pointed out furthest toward marker 8O7

(centromere), so the BES (Genbank accession CG959625) of mth2-71F24 was used as a probe

to identify overlapping BACs. This was done first computationally by BLAST Genbank

accession CG959625 against different databases (gss, nr, htgs), we determined that the

sequence was highly repetitive. The blast result of Genbank accession CG959625 of

mth2-71F24 was messy and confused.

Figure 11: BAC filter Mt ABb A, probed with 71F24 from Dr. Catalina Pisariu.

We tried to make primer set 71F24 1F+1R to use as a probe to identify overlapping

BACs on BAC filters of mth1 and mth2. However, its highly repetitive sequence caused much

difficulty in reading the BAC filters, thus this was not useful in the chromosome walk (Figure

11).

After probing and comparing the information with Genbank, 3 BACs were selected to

go further. They were mth2-1G13, mth2-143F7, and mth2-31M3. In order to confirm their

26

authenticity, primers were predicted from mth2-1G13, mth2-31M3, and mth2-143F7. The

PCR results indicated that mth2-1G13 did not overlap with mth2-143F7 and mth2-31M3. The

BES of mth2-31M3 and mth2-143F7 overlapped with many BACs around this area. Therefore,

mth2-31M3 and mth2-143F7 were not reliable for elongation of the map. From Genbank,

mth2-1G13 only had one BES in database at this time, and the sequence was also highly

repetitive. Because the unfinished database could not give us more information for BACs

around this area, we decided to send 7 BACs to Dr. Bruce Roe for DNA sequence analysis. At

the same time, CUGI told us that on some BAC membranes positions 3 and 4 were transposed,

so the adjustments for BAC identity were made.

Figure 12: BAC filter Mt ABb A, probed with 78L20.

27

Figure 13: BAC filter Mt ABb B, probed with 78L20. In this BAC filter, mth2-71F24 and mth2-78L20 were identified.

In order to avoid nonspecific results, the second distal BES toward marker 8O7, the BES

(Genbank accession CG935356) of mth2-78L20, was used to identify BACs in Genbank files.

In fact, Genbank accession CG935356 did not identify many BACs in Genbank files, so it was

used to predict primers and was made into a probe to test on BAC filters of mth1 and mth2

(Figure 12 and Figure 13). The results of BAC filters were remarkable, and many specific

BACs were pulled out (Table 7).

Because marker 164N9 was in contig 1365, BACs, which were in contig 1365, were the

first selected to go further. After comparing the information from Genbank and BAC filters,

many BACs were selected for next step (Table 8).

28

Table 7: Results of BAC filter Mt ABb A~E with probe 78L20. Because of incomplete database, many BES were not found from Genbank.

MT_ABb A Contig BES#1 BES#2 mth2-48B18 none available CG940830 CG940819 mth2-24I2 1002 none available none available mth2-8L14 none available CG963043 CG963031 mth2-35O15 108 CG932439 CG932074 mth2-37B5 941 CG954636 CG954622 mth2-1G13 1365 AC203565 AC203565 mth2-1M23 1120 CG941941 CG941927 mth2-40D14 1202 none available none available mth2-10E2 1060 CG944194 CG944181 mth2-22I6 1099 CG944784 CG932094

MT_ABb B Contig BES#1 BES#2 mth2-72E10 1357 CG941151 CG940796 mth2-78L20 1365 CG935356 CG935342 mth2-74A8 1365 CG950034 none available mth2-80O22 1365 CG945844 none available mth2-89F10 954 none available none available mth2-95k8 1365 none available none available mth2-76D16 1365 CG931406 none available

MT_ABb C Contig BES#1 BES#2 mth2-141D2 none available none available none available mth2-114D7 992 none available none available mth2-140I12 none available none available none available mth2-101B20 1365 none available none available mth2-109D20 none available none available none available mth2-133F3 1365 CL315200 CL315050 mth2-124D8 none available CL311987 CL311936 mth2-130K15 1365 CL313773 CL313772

MT_ABb D Contig BES#1 BES#2 mth2-147F5 none available none available none available mth2-152P2 1365 CR485104 CR485105 mth2-182H19 1365 CR504294 CR504295 mth2-145B13 1365 CR481887 CR481888 mth2-151C16 none available CR483873 none available mth2-154G18 none available CR485394 CR485393 mth2-184N23 none available none available none available

MT_ABb E Contig BES#1 BES#2 mth2-231M24 none available none available none available mth2-240O8 none available none available none available mth2-230O8 none available none available none available mth2-235I8 none available none available none available

29

Table 8: BACs were selected from the results of probe 78L20 with BAC filters

BACs BES1 BES2 mth2-72E10 CG941151 CG940796 mth2-133F3 CL315200 CL315050 mth2-130K15 CL313773 CL313772 mth2-152P2 CR485104 CR485105 mth2-182H19 CR504294 CR504295 mth2-145B13 CR481887 CR481888 mth2-151C16 CR483873 none available mth2-45B19 CG933092 CG933081 mth2-35O16 CG964367 CG964359 mth2-1M24 CG922458 CG922445 mth2-66E10 CG956145 CG956134 mth2-56E11 CG921733 CG921743 mte1-61P13 CR332273 CR332274 mte1-3H1 CR308868 CR308869 mth4-27J14 CR968534 CR968535

From the genetic map, NIP co-segregates with 164N9. Marker 4L4 segregates from

NIP, showing that the NIP is located between markers 4L4 and 8O7. To further investigate the

location of NIP, new markers need to be developed between marker 4L4 and 8O7. The

sequence of mth2-78L20 was sequenced by Dr. Bruce Roe at the U Oklahoma. The sequence

of mth2-78L20 was used to predict primers for searching for new markers in the area between

marker 4L4 and 8O7. So far, A17 and A20 were polymorphic for 78L20 M3F+M1R. To walk

further, mth2-1G13 and mth4- 27J14 were seen to be distal BACs toward marker 8O7. Table 6

and 7 include several PCR results in which sequence was used to predict at genetic markers in

this area. Up to now the physical area between markers 164N9 to 8O7 is not yet finished

(Figure 14).

30

Table 9: Ordered PCR results for the area between 68B10 1F+1R to 78L20 1F+1R.

BAC 68B10 1F+1R

78L20 M3F+M1R

161F23 1F+1R

78L20 G4F+C5R

78L20 C6F+C5R

143J16 1F+1R

78L20 SR 1F+1R

A20 + + + - - + - A17 + + + + + + + mth2-35O16 + + + + + + + mth2-130K15 + + + + + + + mth2-182H19 - - - - - - - mth2-133F3 + + - - - - - mth2-152P2 + + + - - - - mth2-45B19 - - + + + + - mth2-145B13 + + + + + + - mth2-151C16 + + + + + + - mth2-66E 10 + + + + + + + mth4-27J14 + + + + + + - mth2-1G13 - - - - - - mth2-71F24 + + + + + + + mth2-78L20 + + + + + + + mth2-154G18 + + + + + + mth2-161f23 - - + + + + mth2-164P8 - - - - - - -

Table 10: Ordered PCR results for the area between 182H19 2F+2R to 1G13 2F+3R.

BAC 1G13

2F+3R 130K15 1F+1R

1G13 35442 1G13 37436

145B13 1F+1R

78L20 1F+1R

182H19 2F+2R

A20 - + + + + + A17 + + + - + + mth2-35O16 - - - + + + mth2-130K15 - + + + + + mth2-182H19 + + + + + + mth2-133F3 + + + + + + mth2-152P2 + + + + + + mth2-45B19 + + + + + + mth2-145B13 - + + + + + mth2-151C16 - + + + + (+?) mth2-66E 10 - - + + + + mth4-27J14 + + + + + + mth2-1G13 + + + + + - mth2-71F24 - + + + + mth2-78L20 - - - + + mth2-154G18 - - - + + mth2-161f23 - - - - - mth2-164P8 - - - - -

31

Figure 14: The physical map of the area between mth2-49O22 and mth2-1G13. The orange colored bars are present BACs, and the blue colored bars are the BACs that were sent out for sequencing. Red and yellow star markers are positive PCR results.

32

2.5 Physical Map from 1G13 1F+1R to Marker 8O7 (Centromere)

Based on Roe’s mth2-1G13 sequence, many BACs were discovered from Genbank for

markers 164N9 and 8O7 connections. PCR results indicated that BAC mth4-27J14 was reliable for

bridging this repetitive area (Table 11 and Table 12), and mtel-46C14 was the distal BAC toward

marker 8O7 (Figure 15).

Table 11: The ordered PCR results for the area between 8O7 to 66k4 BES2 1F+1R.

BAC 8O7 166I10 #1

166I10 #2

46C14 BES2 1F+1R

67O10 BES2 1F+1R

167L23 BES2 1F+1R

76P21 BES2 1F+1R

66k4 BES2 1F+1R

A20 control + + + + + - + + A17 control + + + + + + + + mth2-78L20 - - - - - - - - mth2-1G13 - - - - - - - - mth4-27J14 - - - - - - - - mth2-8o7 + + + - - - - - mth2-166I10 - + + - - - - - mth2-156I20 - + + - - - - - mth2-167L23 - - - - - + + + mth2-170M17 - - - - - + + + mth2-67O10 - - - - + + + + mth2-76P21 - - - - - - + + mth2-164G6 - - - - - - + + mte1-46C14 - - - + + + + + mte1-58F2 - - - - - - - - mte1-66K4 - - - - - - - + mte1-70G4 - - - - - - - - mte1-40D24 - - - - - - - - mte1-12J18 - - - - - - - -

Table 12: Ordered PCR results for the area between 66k4 BES2 1F+1R to 1G13 1F+1R.

BAC 66K4 BES2 1F+1R

40D24 BES2 1F+1R

58F2 BES2 1F+1R

70G4 BES2 1F+1R

164G6 BES2 1F+1R

12J18 BES2 1F+1R

170M17 BES2 1F+1R

1G13 1F+1R

A20 control + + + + + + + + A17 control + + + + + + + + mth2-78L20 - - - - - - - - mth2-1G13 - - - - - - - + mth4-27J14 - - - - + + + + mth2-8o7 - - - - - - - - mth2-166I10 - - - - - - - - mth2-156I20 - - - - - - - - mth2-167L23 + + + + + - - - mth2-170M17 + + + + + + + - mth2-67O10 + + + + + - - - mth2-76P21 + + + + + + - - mth2-164G6 + + + + + - - - mte1-46C14 + + + + + + + - mte1-58F2 - - + + + + + + mte1-66K4 + + + + + + + - mte1-70G4 - - - + + + + + mte1-40D24 - + + + + + + + mte1-12J18 - - - - + + + +

33

Figure 15: The physical map of the area between mtel-46C14 and mth2-1G13.

2.6 PCR Results for Connection between mth2-9O20 to mth2-46C14

Based on my previous PCR results, PCR reactions between 8 BACs and 7 primers

(Figure 16 and Table 11) were selected from the area between mth2-9O20 to mte1-46C14 to

represent that minimal tiling comprising the physical map between mth2-9O20 to mtel-46C14

34

(Figure 17). For instance, the PCR products size of primer 9O20 130K F+R with BAC

mth2-9O20 and mth2-52P8 were the same, and this means these two BACs were overlapped.

Figure 16: PCR results for connection between mth2-9O20 to mte1-46C14.

Table 13: PCR results between mth2-9O20 to mte1-46C14.

Lane 1 Lane 2 BAC primer mth2- 9O20 mth2-52P8 9O20 130K F+R + +

Lane 3 Lane 4 BAC primer mth2-52P8 mth2-160M23 52P8 F+R + +

Lane 5 Lane 6 BAC primer mth2-160M23 mth2-164P8 168P8 1F+1R + +

Lane 7 Lane 8 BAC primer mth2-164P8 mth2-78L20 164P8 3F+3R + +

Lane 9 Lane 10 BAC primer mth2-78L20 mth4-27J14 78L20 1F+1R + +

Lane 11 Lane 12 BAC primer mth4-27J14 mth2-170M17 170M17 BES2 1F+1R

+ +

Lane 13 Lane 14 BAC Primer mth2-170M17 mtel-46C14 76P21 BES2 1F+1R

+ +

35

Figure 17: This simple physical map is between mth2-9O20 and mtel-46C14.

36

2.7 Physical Map between Markers 146O17 to 8O7

38

CHAPTER 3

DISCUSSION

In order to discover the location of the NIP gene, both physical mapping and genetic

mapping are required. In the beginning, genetic mapping placed the NIP gene on linkage group

one. Markers 003C01 and DK140L were used previously in the Dickstein lab, and the results

indicated that nip homozygous plants co-segregated with them; therefore, the NIP gene was

placed on the upper arm of linkage group 1. To positionally clone the NIP gene, a mapping

population was established. It was created by crossing male sterile C90 into the different

background ecotype wild type A20 (Penmetsa and Cook 2000). The F2 generation of mapping

population showed a ratio of 1: 2.9 nip: wild type, and this result was consistent with nip being

as a single recessive allele. Next, markers 146O17, ENBP, and 23C16D were used by

Viktoriya Morris, and more recombinant plants from the mapping population were identified.

By genotyping and phenotyping more plants from the of mapping population, the result placed

the NIP gene between markers 23C16D and 146O17. In order to go close to the NIP gene,

markers 164N9, 8O7, and 4L4 were used on all recombinant plants. The results narrowed down

the location of the NIP gene between markers 8O7 and 4L4.

At the same time, a physical map starting from marker 164N9 and expanding outward

toward markers 8O7 and 146O17 was initiated by using information from the Medicago

genome project, contained in Genbank and BAC filters. Because the genome sequencing

project of M. truncatula is still in process, many BACs that are in the sequence pipeline contain

incomplete sequence. In addition, and some of the BACs have incorrect sequence information

or they are unordered. Sequencing of DNA on Chromosome is being carried out by different

labs, but mostly by Dr. B. Roe’s lab at U. of Oklahoma. The BAC naming system has had some

discrepancies. Therefore, at this time, it is impossible to get all the information for the virtual

walk online for physical mapping; therefore, the actual walk on BAC filters is necessary.

39

Moreover, BAC clones sometime have problems, such as deletion of DNA fragment in the

BAC, and DNA fragment in the BAC that does not correspond to the sequence for that BAC. A

further concern is chimeric BACs. Therefore, we need to be careful about the authenticity of

BACs.

In the beginning, many BACs around mth2-164P8 were identified by BAC filters with

probe 164N9 4F+4R and the virtual walk online. After these BACs were placed on the

physical map in order, we determined that mth2-4L4 was the distal BAC toward marker

146O17 on the telomeric side. The BES of mth2-4L4 were used to discover more BACs from

Genbank, and BAC mth2-160M23 was found to go further toward marker 146O17.

Starting from mth2-146O17 at the telomeric side of NIP, BAC mth2-160C2 and

mth2-9O20 were found to be the furthest toward mth2-164P8. BES of mth2-160C2 and

mth2-9O20 were used to discover more BACs from Genbank, and mth2-175E11 was the one

found to extend furthest toward marker 164N9 (mth2-164P8). After testing the BAC’s

authenticity with PCR, both mth2-160M23 and mth2-175E1 were used in PCR reaction with

other primers predicted from BACs thought to overlap this area. The PCR of mth2-160M23

and mth2-175E1 with primers from mth2-4L4, mth1-52P8, and mth2-9O20 indicated that the

gap between mth2-4L4 and mth2-160C2 was connected by mth2-160M23 and mth2-175E1.

For the physical map between markers 164N9 on BAC mth2-164P8 and 8O7 on BAC

mth2-8O7, less information was found for BACs in this area. To get more BAC information,

BAC filters were probed with primer 71F24 from mth2-71F24, but results were not

informative. Then, probe 78L20 from mth2-78L20 was used to probe BAC filters, and results

were very useful. Because marker 164N9 (in contig 1365) co-segregates with the NIP gene,

BACs which were discovered from BAC filters and BACs discovered from their sequence

which are in contig 1365 are seen to be more likely candidates for physical mapping to close

the gap between mth2-164P8 and mth2-8O7. Unfortunately, contig 1365 has 1765 BACs, and

40

the sequence is highly repetitive in this area. In order to overcome this problem, BACs coming

from the mth4 library which has larger genomic insert, are likely to make walking through this

area easier.

Another way to solve the problem is to sequence all the BACs in this area, so 7 BACs

were sent to Dr. Bruce Roe for further sequencing. In the future more BACs will be sent to Dr.

Bruce Roe for sequencing. By knowing more sequence, the chance is higher for finding more

markers for genetic mapping. To narrow down the location of the NIP gene, developing more

markers is necessary and imperative. From Dr. Bruce Roe we got some BAC sequence

information back from the 7 BACs. Unfortunately, sequence of these BACs is still not

completed; for instance, the sequence mth2-78L20 was still in 14 unordered pieces on Sep 20

2007. Based on the sequence from Genbank, we predicted some primers to examine BAC

mth2-78L20 itself, and we found that some primers which predicted form the sequence do not

yield positive results with the BAC itself. This means that some of the DNA fragment for this

BAC is in error. For mth2-1G13, its sequence has been completed, but some conflicts between

the physical mapping and genetic mapping have happened on mth2-1G13. Therefore, we need

to have other reliable BACs in this area to walk across the gap. Now mth4-27J14 and

mtel-46C16 are seen to be possible to go further toward marker 8O7.

41

CHAPTER 4

METHODS AND MATERIALS

4.1 Medicago truncatula Artificial Chromosome (BAC) Culture

A BAC is a DNA construct, based on a fertility plasmid, used for transforming and

cloning in E. coli. BACs from the Clemson University Genomics Institute (CUGI) and France

were grown on 2% agar LB plates with the antibiotic chloramphenicol at final concentration of

34µg/ml at 37℃ over night. A single colony was transferred to 5ml LB media with

chloramphenicol and incubated at 37℃ in a shaker over night.

Luria-Bertani (LB) medium pH 7.4 contains 10g tryptone, 5g yeast extract, 10g NaCl,

and add ddH2O to 1L. 2% Agar Luria-Bertani (LB) medium pH 7.4 contains 10g tryptone, 5g

yeast extract, 10g NaCl, 20g agarose, and add ddH2O to 1L

All BAC-containing E. coli strains were frozen at -80℃ after adding sterile glycerol to a final

concentration of 20%.

4.2 BAC DNA Extraction

Solution I contains final concentration of 50mM glucose, 25mM Tris pH8, and 10mM

EDTA and it can be made before and kept for awhile, but solution II needs to be made fresh

before using. Solution II contains 2 ml 10% SDS, 0.8 ml 5 M NaOH, and add ddH2O to 20 ml.

Each centrifuge tube has 1.5ml cell culture and is centrifuged for 30 second. After the

supernatant is removed, the pellet needs to be mixed well with 0.2ml solution I contained

lysozyme (8mg/ml) and stays in room temperature for 5 minute. Next, 0.4ml solution II is

added to the mixture and stays on ice for 5 minute. Then, 0.3ml 8M ammonium acetate

(NH4OAC) is added and the mixture stays on ice for 10 minute. It needs to be centrifuged at

13,000 rpm for 5 minutes, and the supernatant needs to be moved to new centrifuge tube. The

supernatant mixes well with 0.6Vol isopropanol, and is centrifuged at 13,000 rpm for 10

42

minutes. After that, the precipitated DNA pellet was slightly opalescent or white. The pellet

was rinsed with 200µl 70% cold ethanol and centrifuged for 30 seconds. The liquid was

removed and the DNA pellet dried for 30 minutes at room temperature. The DNA pellet was

dissolved in 30µl TE buffer and stored at -20 °C.

4.3 DNA Extraction from Plant Leaves

The CTAB procedure was used. For this, one trifoliate was frozen in liquid N2 and

ground to a power. Then, 700µl of CTAB regent (2X Hexadecyl Trimethyl Ammonium

Bromide (CTAB): 2% CTAB, 100mM Tris, 20mM EDTA, 1.4M NaCl, 2% polyrinyl

pyrrolidone, 0.2% BME) was added to each tube and the tissue power re-suspended. After

incubation at 65℃, the mixture was extracted with chloroform regent (chloroform: IAA: 24:1).

After the agarose phase is moved to a fresh tube, isopropanol was added to a final

concentration 40%. The DNA was collected by centrifugation, rinsed with 70% icy ethanol and

air dried. Subsequently, the DNA was re-suspending in 30µl sterile water and stored at -80℃.

4.4 BAC Sequence on NCBI Website and Primer Prediction

M. truncatula BAC sequences were obtained from NCBI and used to query the NCBI

databases using BLAST, and sequences on Gene bank. Each BAC has two BES. To determine

which one overlaps a particular sequenced BAC program was used. “Blast” and “aligns two

sequences (bl2seq)” (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi)

Next, the tool “Blast”,” Nucleotide-nucleotide BLAST (blastn)” on NCBI was used to

aginst three different databases: nr, gss, and htgs to look for overlap with other BACs for

further mapping.

http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi

43

Figure 18: The NCBI Website used to identify BACs.

Figure 19: Nucleotide-nuclotide BLAST (blastn) tool on NCBI Website.

Together with BACs discovered using hybridization walks minimal tilting path BACs

were found. PCR was used to confirm results from BAC filters and virtual walks on Genbank.

Based on BES, oligonucleotide primers were designed by using the “Oligoperfect designer”

from Invitrogen.com (http://www.invitrogen.com/content.cfm?pageid=1). This program

http://www.invitrogen.com/content.cfm?pageid=1

44

allows us to control primer size, product size, GC%, and primer melting temperature (Tm) for

our primers.

Figure 20: Oligo Perfect Designer computer interface

Figure 21: Another Oligo Perfect Designer program interface.

45

4.5 Polymerase Chain Reaction (PCR)

PCR was used to confirm if the primer sets localized to the BAC and to help build up

the physical map. Each sample was 20µl and mixed with the following reagents: 13.52µl

Sterile ddH2O, 10X New England Biolabs Thermopol buffer (20mM Tris-HCl (pH 8.8, @25

℃), 10mM KCI, 10 mM (NH4)2SO2, 2mM MgSO4, 0.1% Triton X-100), 1.6µl 2.5mM dNTPs,

0.8µl 5mM Forward and Reverse primers, 2µl 100X diluted BAC or plant DNA extract, and

0.1µTaq DNA Polymerase (New England Biolabs).

The reaction cycle condition:

Step 1 94℃ 4 minutes Step 2 94℃ 30 seconds Step 3 50~60℃ (depend on primers) 30 seconds Step 4 72℃ 30~60 seconds (depend on primers) Step 5 Repeat Step 2-4 for 35 cycles Step 6 72℃ 4 minutes Step 7 25℃ Hold indefinitely PCR products were assessed by gel electrophoresis in 2% agarose gel made with 1X

TBE (1X Tris-Boric Acid-EDTA buffer, pH 8.2). Gels were visualized under UV light by

means of ethidium bromide staining.

4.6 BAC Filters Hybridization

BAC filters were used for chromosome walking. In the area of the physical map

between 78L20 and marker 807, the sequences are highly repetitive. Thus, it was difficult to

assign overlapping BACs using the virtual walks approach. BAC filters are useful tools for

discovering potential BACs around this repeat sequence area. BAC filters used in this project

represented the mth1 and mth2 libraries. BAC filter hybridization started with making probes.

Probes, were PCR products predicted from BES.

46

A. Solutions Vol pH Chemical Amount NaCl 175.3 g 1. 20X SSC 1L pH 7.0 Na Citrate 88.2 g

2. 5M NaCl 1L NaCl 58.44 g 3. 0.5M EDTA 1L pH 8.0 EDTA 186.12 g

Na2HPO4· 7H2O 134 g in 850 ml H2O 4. 0.5M Sodium Phosphate

1L pH 7.2 85% H3PO4 4 ml

5. 20% SDS 1L pH 8.0 SDS 200 g 6. 5M NaOH 1L NaOH 200 g

B. Fresh solutions Vol Chemical (Stock) Vol from Stock Final Con. 1. 5X SSC 2L 20% SDS 500 ml 5% SDS

20% SDS 5 ml 0.1% SDS 5M NaOH 20 ml 100 mM NaOH

2. Stripping buffer

1L

0.5M EDTA 20 ml 10 mM EDTA 0.5M Sodium Phosphate

200 ml 0.25 M Sodium Phosphate

SDS 28 g 7% SDS 0.5M EDTA 800µl 1 mM EDTA

Hybridization solution

0.4L

BSA 4 g 1% BSA

3.

First, mix Sodium Phosphate, SDS, and heat it After them dissolve and cool down to 50℃-60℃, add BSA, then EDTA

20% SDS 20 ml 0.1% SDS 4. Wash buffer 4L 20X SSC 200 ml 1X SSC

The samples were diluted to 10X, 100X, 1000X, 5000X, 10000X, 50000X. One micro

liter was used from each dilution to determine the best dilution for making probe.

4.6.1 Making the Probe

Each PCR reaction contain the following reagents and was split into 5 tubes of 100µl

each.

Sterile ddH2O 327µl10X Thermopol buffer (New England Biolabs) 20mM Tris-HCl (pH 8.8, @25℃), 10mM KCI, 10 mM (NH4)2SO2, 2mM MgSO4, 0.1% Triton X-100

50µl

x2.5mM dGTCTP 40µl 1mM dATP 0.5µl P32- dATP 25µl 5mM Forward and Reverse primers 45µl Diluted DNA template 10µl Taq DNA Polymerase (New England Biolabs) 2.5µl Total 500µl

47

PCR reaction were performed with a 4 minute initial denaturation step at 94°, followed

by 35 cycles at 94° for 30 seconds. The annealing temperature depends on the primer and the

annealing time needs to be multiplicative 2.

The reaction cycle condition:

Step 1 94℃ 4 minutes Step 2 94℃ 30 seconds Step 3 50~56℃ (depend on primers) 30 seconds Step 4 72℃ 1~2 minutes (the annealing time needs to

be X2) Step 5 Repeat Step 2-4 for 35 cycles Step 6 72℃ 10 minutes Step 7 25℃ Hold indefinitely PCR products need to go through purification columns with Sephadex G-50 for

removing primer dimmers. 100~140µl PCR products were applied to each purification column

and centrifuged at 3000-3600 rpm for 3 minutes. After all samples were collected in one tube,

we took 1µl sample out and put in a new tube to test its activity in scintillation counter. For one

BAC filter, it needs 5,000,000 cpm.

4.6.2 Stripping BAC Filters

The hybridization solution was pre heated to 65℃ in an oven. During this time, film

cassettes (BAC filters) from the -20℃ freezer were taken out and kept them at room

temperature for 1 hr. After that, BAC filters were taken out from the film cassettes and put in a

bucket with 1L Stripping buffer to shake for 10 minutes. Next, we replaced Stripping buffer

with ddH2O and shook for another 10 minutes. We replaced ddH2O with 1L 5X SSC and

shook for 10 minutes.

4.6.3 Prehybridization

Three BAC membranes were put in a tube and prehybridization in 65℃ oven for 3

48

hours with 40-50 ml pre heat hybridization solution.

4.6.4 Hybridization

Probes need to be heated up to 100℃ for 7 minutes and quickly moved to icy water for

15 minutes. Then, 100-140µl probes is added to each tube without dropping the probes on BAC

filters, mixed them well, and then stays in the 65℃ oven for16 -18 hours or more.

4.6.5 Wash

For rinsing out redundant probes on membranes, membranes are soaked and shaken in

warm wash buffer for several times. First, tubes were carefully taken out from the oven behind

the shield and the radiation waste was dumped in the radiation waste bottle. Second, all

membranes were taken out from tubes and put in the bucket with 0.8L wash buffer to shake for

15 minutes. Third, the radiation wash buffer was dumped in the radiation waste bottle and was

replaced by 0.8L wash buffer to shake for 15 minutes, and repeated it again. Fourth, 0.8L wash

buffer was warmed up to 65℃ by microwave. The wash buffer in the bucket was dumped and

was replaced by the warm wash buffer to shake for 15 minutes. Then, all membranes were put

in the surplus wash buffer in another bucket.

4.6.6 Exposure

After washing, membranes were wrapped with plastic wraps and placed in film

cassettes with films. Films cassettes stay in a -20℃ freezer for 3~21 days for exposure.

Afterwards, film cassettes were taken out from a freezer and stayed at room temperature for 1

hour before developing anvvv d printing films. In order to read membranes, we overlapped

films with a grid to look for exposure spots. After the spots were marked, the pattern and

49

location of spots were recorded. There is a special pattern for decoding membranes. By spots

locations and pattern, we can translate the data to useful BAC names.

4.6.7 Decoding

In order to translate the spot pattern and location to real BAC name, we used the grid of

BAC filters, duplication pattern position, and the table of display the actual arraying pattern

and plate numbers for BAC membranes.

First, the location and pattern of spots were identified by reading with the grid of BAC

filters and duplication pattern. Second, the location and pattern position of spots were

compared with the table of display the actual arraying pattern and plate numbers for BAC

membranes. For MT ABb A~F BAC filters, they are form mth2 library.

The BAC naming system is:

Library name- Plate number and Coordinate

For example: mth2- 164 P8

Figure 22: The grid of BAC filters and the duplication pattern.

50

Table 14: The chart for filed number, position, and plate number.

Plate number Field Position A B C D E F G H I J K

1 1 1 49 97 145 193 241 241 337 385 433 481 1 2 7 55 103 151 199 247 295 343 391 439 387 1 3 19 67 115 163 211 259 307 355 403 451 499 1 4 13 61 109 157 205 253 301 349 397 445 493 1 5 25 73 121 169 217 265 313 361 409 457 505 1 6 31 79 127 175 223 271 319 367 415 463 511 1 7 37 85 133 181 229 277 325 373 421 469 517 1 8 43 91 139 187 235 283 331 379 427 475 523 2 1 2 50 98 146 194 242 290 338 386 434 482 2 2 8 56 104 152 200 248 296 344 392 440 488 2 3 20 68 116 164 212 260 308 356 404 452 500 2 4 14 62 110 158 206 254 302 350 398 446 494 2 5 26 74 122 170 218 266 314 362 410 458 506 2 6 32 80 128 176 224 272 320 368 416 464 512 2 7 38 86 134 182 230 278 326 374 422 470 518 2 8 44 92 140 188 236 284 332 380 428 476 524 3 1 3 51 99 147 195 243 291 339 387 435 483 3 2 9 57 105 153 201 249 297 345 393 441 489 3 3 21 69 117 165 213 261 309 357 405 453 501 3 4 15 63 111 159 207 255 303 351 399 447 495 3 5 27 75 123 171 219 267 315 363 411 459 507 3 6 33 81 129 177 225 273 321 369 417 465 513 3 7 39 87 135 183 231 279 327 375 423 471 519 3 8 45 93 141 189 237 285 333 381 429 477 525 4 1 4 52 100 148 196 244 292 340 388 436 484 4 2 10 58 106 154 202 250 298 346 394 442 490 4 3 22 70 118 166 214 262 310 358 406 454 502 4 4 16 64 112 160 208 256 304 352 400 448 496 4 5 28 76 124 172 220 268 316 364 412 460 508 4 6 34 82 130 178 226 274 322 340 418 466 514 4 7 40 88 136 184 232 280 328 346 424 472 520 4 8 46 94 142 190 238 286 334 352 430 478 526 5 1 5 53 101 149 197 245 293 341 389 437 485 5 2 11 59 107 155 203 251 229 347 395 443 491 5 3 23 71 119 167 215 263 311 359 407 455 503 5 4 17 65 113 161 209 157 305 353 401 449 497 5 5 29 77 125 173 21 269 317 365 413 461 509 5 6 35 83 131 179 227 275 323 371 419 467 515 5 7 41 89 137 185 233 281 329 377 425 473 521 5 8 47 95 143 191 239 287 335 383 431 479 527 6 1 6 54 102 150 198 246 294 342 390 438 486 6 2 12 60 108 156 204 252 300 348 396 444 492 6 3 24 72 120 168 216 264 312 360 408 456 504 6 4 18 66 114 162 210 258 306 354 402 450 498 6 5 30 78 126 174 222 270 318 366 414 462 510 6 6 36 84 132 180 228 276 324 372 420 468 516 6 7 42 90 138 186 234 282 330 378 426 474 522 6 8 48 96 144 192 240 288 336 384 432 480 528

51

APPENDIX

PCR REACTION CONDITIONS INCLUDING PRIMER SEQUENCE

52

164P8 3F+3R

Primer name 164P8 3F Primer sequence 5’-GTC CAG AGC CTA AGA GAA CGA A

TM(℃) 60.02 GC% 50.00 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name 164N9_3R Primer sequence 5’-GAA GAC GAT GAG GAG

GAT TTT G TM(℃) 60.07 GC% 45.46 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Master mix for one PCR reaction

2μl of 10X thermoPol Buffer, 1.6μl of 2.5mM dNTPs, 0.1μl of Taq, 0.8μl of primer mix(F+R), 13.5μl of ddH2O

PCR reaction Protocol 94℃ for 3min, 94℃ for 30sec, 55℃ for 30sec, 72℃ for 30sec, repeat 34 times, 72℃ for 5min, 25℃ forever

Product Length 433bp

164N9 15F+15R

Primer name 164N9 15F Primer sequence 5’-TAA AAG TGG CAC GAA AGA GTG T

TM(℃) 58.95 GC% 40.91 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name 164N9 15R Primer sequence 5’-TCT TCT TCT GCA TCA

AAT GTG G TM(℃) 60.25 GC% 40.91 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Master mix for one PCR reaction




164N9 17F+17R

Primer name 164N9 17F Primer sequence 5’-TTA GAG AAA TTT CCC AGC CTT G

TM(℃) 59.73 GC% 40.91 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name 164N9 17R Primer sequence 5’-GTT GAA ATC TGC AAA

AAG G TM(℃) 60.11 GC% 40.91 Size 22bp

53

The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Master mix for one PCR reaction




164N9 18F+18R

Primer name 164N9 18F Primer sequence 5’-TTT AGA CCC AAT AAC ATG TGT C

TM(℃) 59.87 GC% 40.91 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name 164N9 18R Primer sequence 5’-CAG AAA TAT CCC TTT

CGT TTC G TM(℃) 59.96 GC% 40.91 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Master mix for one PCR reaction




164N9 19F+19R

Primer name 164N9 19F Primer sequence 5’-TCA CTG AAA CCT GCT TCC AAA T

TM(℃) 61.02 GC% 40.91 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name 164N9 19R Primer sequence 5’-GAA AAT GCA GTC CCT

GTT GTT T TM(℃) 61.39 GC% 40.91 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Master mix for one PCR reaction




54

159N10 1F+1R

Primer name 159N10 1F Primer sequence 5’- AGG TTT CTT CAC CTG CGG TA

TM(℃) 59.73 GC% 50.00 Size 20bp The sequence for making primer mth2- 159N10 CR489384 Primer name 159N10 1R

Primer sequence 5’- TGC TGC AAT CCT TCA

AAC TG TM(℃) 59.99 GC% 45.00 Size 20bp The sequence for making primer mth2- 159N10 CR489384 Master mix for one PCR reaction




38K19 1F+1R

Primer name 38K19 1F Primer sequence 5’- AGG AGA CTG TCC GCT CTT CA

TM(℃) 60.14 GC% 55.00 Size 20bp The sequence for making primer mth2-38K19 CG975869 Primer name 38K19 1R Primer sequence 5’- TCT GAC AAG GCA TCA

CCA AC TM(℃) 59.68 GC% 50.00 Size 20bp The sequence for making primer mth2-38K19 CG975869 Master mix for one PCR reaction



187J11 1F+1R

Primer name 187J11 1F Primer sequence 5’- CCC CAC TTG ATC TCT GCA AT

TM(℃) 60.07 GC% 50.00 Size 20bp The sequence for making primer mth2-187J11 CR478106 Primer name 187J11 1R Primer sequence 5’- AAC AAT GAC CGC CTA

GCT CA TM(℃) 60.80 GC% 50.00 Size 20bp The sequence for making primer mth2-187J11 CR478106

55

Master mix for one PCR reaction




10P15 1F+1R

Primer name 10P15 1F Primer sequence 5’- CCC CTC ACA ATC TTT GCA GT

TM(℃) 60.11 GC% 50.00 Size 20bp The sequence for making primer mth2-10P15 CG919384 Primer name 10P15 1R Primer sequence 5’- CCT GCA TCG CCT TCT

CTT AC TM(℃) 59.98 GC% 55.00 Size 20bp The sequence for making primer mth2-10P15 CG919384 Master mix for one PCR reaction




157H22 1F+1R

Primer name 157H22 1F Primer sequence 5’- GCC TTC CTC CTG AGC TTA CA

TM(℃) 59.57 GC% 55.00 Size 20bp The sequence for making primer mth2-157H22 CR488599 Primer name 157H22 1R Primer sequence 5’- GGG CAA ACA CGT AGA

TCA CA TM(℃) 59.57 GC% 50.00 Size 20bp The sequence for making primer mth2-157H22 CR488599 Master mix for one PCR reaction




56

164N9 16F+16R

Primer name 164N9 16F Primer sequence 5’- ATC TTC CAC ATG AGG GAA CCT A

TM(℃) 59.83 GC% 45.46 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name 164N9 16R Primer sequence 5’- AGA GGT GCA ACT GAG

GAT GAA T TM(℃) 60.14 GC% 45.46 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Master mix for one PCR reaction




164N9 Marker

Primer name 164N9 Marker F

Primer sequence 5’-

TM(℃) GC% Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name 164N9

Marker R Primer sequence 5’-

TM(℃) GC% Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Master mix for one PCR reaction



Product Length bp

164N9 4F+4R

Primer name 164N9 4 F Primer sequence 5’-GTT CCA CAC CAA TGA ACC ATA G

TM(℃) 59.22 GC% 45.46 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name 164N9 4R Primer sequence 5’-ATA ACA TAT GAT CGG

AGG AAG C TM(℃) 60.35 GC% 45.46 Size 22bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646

57





489618

Primer name 489618 F Primer sequence 5’-TCT CAT CAA AGG CAC ACA CC

TM(℃) 52 GC% 50 Size 20bp The sequence for making primer mth2- 160C2 AC166706 Primer name 489618 R Primer sequence 5’ TTG GAA CCC AAA CAA

CAT GA TM(℃) 48 GC% 40 Size 20bp The sequence for making primer mth2- 160C2 AC166706 Master mix for one PCR reaction




489619

Primer name 489619 F Primer sequence 5’ TGG AAT CGT GAT ACG ATG GA

TM(℃) 50 GC% 45 Size 20bp The sequence for making primer mth2- 160C2 AC166706 Primer name 489619 R Primer sequence 5’ TGG AAT CGT GAT ACG

ATG GA TM(℃) 50 GC% 45 Size 20bp The sequence for making primer mth2- 160C2 AC166706 Master mix for one PCR reaction




58

160C2 11F+11R

Primer name 160C2 11F Primer sequence 5’-CCC CAA TCT TTT TCA CTA CGA G

TM(℃) 53.00 GC% 45.45 Size 22bp The sequence for making primer mth2- 160C2 AC166706 Primer name 160C2 11R Primer sequence 5’-TCG ATA TGT ATG GTT

GCT GAG G TM(℃) 53.00 GC% 45.45 Size 22bp The sequence for making primer mth2- 160C2 AC166706 Master mix for one PCR reaction



160C2 12F+12R

Primer name 160C2 12F Primer sequence 5’-TTT TTA GGT TGA CTG CCT TCG T

TM(℃) 51.00 GC% 40.91 Size 22bp The sequence for making primer mth2- 160C2 AC166706 Primer name 160C2 12R

Primer sequence 5’-CCT TCC GAC ACA TTA

AAA TCT C TM(℃) 51.00 GC% 40.91 Size 22bp The sequence for making primer mth2- 160C2 AC166706 Master mix for one PCR reaction




160C2 13F+13R

Primer name 160C2 13F Primer sequence 5’-TAT CAG TGG GCT TGG ACC TAG T

TM(℃) 55 GC% 50 Size 22bp The sequence for making primer mth2- 160C2 AC166706 Primer name 160C2 13R

Primer sequence 5’-AAG TGG ATG TGG AGA

GAG GTG T

59

TM(℃) 55 GC% 50 Size 22bp The sequence for making primer mth2- 160C2 AC166706 Master mix for one PCR reaction



Product Length bp

160C2 14F+14R

Primer name 160C2 14F Primer sequence 5’-CCT TCA CTG GTA TCC TTC CTT C

TM(℃) 55 GC% 50 Size 22bp The sequence for making primer mth2- 160C2 AC166706 Primer name 160C2 14R

Primer sequence 5’-GTG CTC CGA TGG TTC

TGG TM(℃) 63 GC% 61 Size 18bp The sequence for making primer mth2- 160C2 AC166706 Master mix for one PCR reaction



Product Length bp

52p8-SP6-BES F1+R1

Primer name 52p8-SP6-BES F1

Primer sequence 5'-TGC ACA AGA AAG CAC ACC TTA TC

TM(℃) 53 GC% 43.48 Size 23bp The sequence for making primer mth2-52p8 CG945766 Primer name 52p8-SP6-BE

S R1 Primer sequence 5'-CAT GTA AAA CAT CTC

ACA TAT ATG TAC TM(℃) 52 GC% 29.63 Size 27bp The sequence for making primer mth2- 52p8 CG945766. Master mix for one PCR reaction



Product Length bp

60

AC127429 F+R

Primer name AC127429A 1 F

Primer sequence 5’ GGG AGA GGA CAC CAG AAT CA

TM(℃) 54 GC% 55 Size 20bp The sequence for making primer mth2-9O20 AC127429 Primer name AC127429A 1

R Primer sequence 5’ AGG GAA TGT TGA TGC

CAT GT TM(℃) 50 GC% 45 Size 20bp The sequence for making primer mth2-9O20 AC127429 Master mix for one PCR reaction




143J16 1F+1R

Primer name 143J16 1F Primer sequence 5’-ATT TCT CAT CCA CAA ACC TCG T

TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-143J16 CR494276 Primer name 143J16 1R Primer sequence 5’-GAT TTG TCA ACC GCG

TAA TAC A TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-143J16 CR494276 Master mix for one PCR reaction



71F24 1F+1R

Primer name 71F24 1F

Primer sequence 5’-CAC TTG TGT GAC ATA ATG CCC TA

TM(℃) 59.93 GC% 43.48 Size 23bp The sequence for making primer mth2-71F24 CG959625 Primer name 71F24 1R Primer sequence 5’-GGT TTG AAT GGG GTA

61

TGT TGA T TM(℃) 59.82 GC% 40.91 Size 22bp The sequence for making primer mth2-71F24 CG959625 Master mix for one PCR reaction




71F24 2F+2R


Primer sequence 5’-TGT GGA ATT CCT CTT AGA CCT GA

TM(℃) 53 GC% 43.48 Size 23bp The sequence for making primer mth2-71F24 CG959625 Primer name 71F24 2R

Primer sequence 5’-TTG GTT TGA ATG GGG

TAT GTT GA TM(℃) 52 GC% 39.13 Size 23bp The sequence for making primer mth2-71F24 CG959625 Master mix for one PCR reaction



Product Length bp

71F24 3R

Primer name 71F24 3R

Primer sequence 5’-TCA GGT CTA AGA GGA ATT CCA CA

TM(℃) 53 GC% 43.48 Size 23bp The sequence for making primer mth2-71F24 CG959625

78L20 1F+1R

Primer name 78L20 1F

Primer sequence 5’-AAT GAT CAG GAC TTG GGT CAG T

TM(℃) 59.86 GC% 45.46 Size 22bp The sequence for making primer mth2-78L20 CG935356 Primer name 78L20 1R

Primer sequence 5’-GCC GGT ATA CTT GCA

TTT CTT C

62

TM(℃) 60.00 GC% 45.46 Size 22bp The sequence for making primer mth2-78L20 CG935356 Master mix for one PCR reaction




8I23 1F+1R

Primer name 8I23 1F Primer sequence 5’-GGA GAT GTT GTG GTT TTG GAG T

TM(℃) 53 GC% 45.45 Size 22bp The sequence for making primer mth2-8I23 CG957042 Primer name 8I23 1R

Primer sequence 5’-ACG AGA ATC GAT CTC

ATG TCC T TM(℃) 53 GC% 45.45 Size 22bp The sequence for making primer mth2-8I23 CG957042 Master mix for one PCR reaction



Product Length bp

68B10 1F+1R

Primer name 68B10 1F

Primer sequence 5’-ATG AGC CGT AGC TGC ACA CTA T

TM(℃) 61.21 GC% 50.00 Size 22bp The sequence for making primer mth2-68B10 CG922494 Primer name 68B10 1R

Primer sequence 5’-AGA GAG GAG GGG GAT

GTA ATT C TM(℃) 59.80 GC% 50.00 Size 22bp The sequence for making primer mth2-68B10 CG922494 Master mix for one PCR reaction




63

161F23 1F+1R

Primer name 161F23 1F Primer sequence 5’-AAC TTT TCC CTC CTT CAA AAC C

TM(℃) 59.86 GC% 40.91 Size 22bp The sequence for making primer mth2-161F23 CR490548 Primer name 161F23 1R Primer sequence 5’-ACA GCG AGG AAT AAG

AGC AAA A TM(℃) 60.38 GC% 40.91 Size 22bp The sequence for making primer mth2-161F23 CR490548 Master mix for one PCR reaction




49O22 1F+1R

Primer name 49O22 1F

Primer sequence 5’-GAA TCA GAG AGC TTC TGG GAA A

TM(℃) 59.96 GC% 45.46 Size 22bp The sequence for making primer mth2-161F23 CG960480 Primer name 49O22 1R

Primer sequence 5’-TGA CGA TAT TGT TGG

AGC TGA C TM(℃) 60.14 GC% 45.46 Size 22bp The sequence for making primer mth2-161F23 CG960480 Master mix for one PCR reaction




49O22 3F+3R


Primer sequence 5’-TGC CGA AGT CTG AAT CTT GTA G

TM(℃) 53 GC% 45.45 Size 22bp The sequence for making primer mth2-161F23 CG960480 Primer name 49O22 3R Primer sequence 5’-CTA CAA GAT TCA GAC

64

TTC GGC A TM(℃) 53 GC% 45.45 Size 22bp The sequence for making primer mth2-161F23 CG960480 Master mix for one PCR reaction



Product Length bp

4L4 1F+1R

Primer name 4L4 1F

Primer sequence 5’-GCC GCT TTT GAT CTC TAC AAC T

TM(℃) 59.92 GC% 45.46 Size 22bp The sequence for making primer mth2-161F23 CG927756 Primer name 4L4 1R

Primer sequence 5’-TAT CTG CCT CAC TTG

CTG CTA A TM(℃) 60.17 GC% 45.46 Size 22bp The sequence for making primer mth2-161F23 CG927756 Master mix for one PCR reaction




57D22 1F+1R

Primer name 57D22 1F

Primer sequence 5’-GCC GCT TTT GAT CTC TAC AAC T

TM(℃) 59.89 GC% 45.46 Size 22bp The sequence for making primer mth2-57D22 CG928388 Primer name 57D22 1R

Primer sequence 5’-TAT CTG CCT CAC TTG

CTG CTA A TM(℃) 59.56 GC% 45.46 Size 22bp The sequence for making primer mth2-57D22 CG928388 Master mix for one PCR reaction



65


175E1 1F+1R

Primer name 175E1 1F

Primer sequence 5’- CTG AGC TAG TGT GTT TGG GAT G

TM(℃) 59.80 GC% 50.00 Size 22bp The sequence for making primer mth2-175E1 CR498592 Primer name 175E1 1R

Primer sequence 5’-GCA CTG CTC ATC TTG

GTC ATA G TM(℃) 59.90 GC% 50.00 Size 22bp The sequence for making primer mth2-175E1 CR498592 Master mix for one PCR reaction




175E1 2F+2R


Primer sequence 5'- T G G C G T A T G A G C T C T T T C A A T A

TM(℃) 59.88 GC% 40.91 Size 22bp The sequence for making primer mth2-57D22 CR498592 Primer name 175E1 2R

Primer sequence 5'- A A G T T C T C C C A A C

C T G T C T C A G TM(℃) 59.78 GC% 50.00 Size 22bp The sequence for making primer mth2-57D22 CR498592 Master mix for one PCR reaction



Product Length bp

160C2 15F+15R

Primer name 160C2 15F Primer sequence 5’-CCC CAA TAT TCT CCC CTA CC

TM(℃) 54 GC% 55 Size 20bp The sequence for making primer mth2-160C2 AC166706

66

Primer name 160C2 15R Primer sequence 5’-GGG TCT TTG AGT GCA

TGG TT TM(℃) 52 GC% 50 Size 20bp The sequence for making primer mth2-160C2 AC166706 Master mix for one PCR reaction



Product Length bp

160C2 16F+16R

Primer name 160C2 16F Primer sequence 5’-AGA CCT TGG CCA GTA AAA AA

TM(℃) 50 GC% 45 Size 20bp The sequence for making primer mth2-160C2 AC166706 Primer name 160C2 16R Primer sequence 5’-TGG CCC TTT TTA TGC

TCA TC TM(℃) 50 GC% 45 Size 20bp The sequence for making primer mth2-160C2 AC166706 Master mix for one PCR reaction



Product Length bp

160C2 17F+17R

Primer name 160C2 17F Primer sequence 5’-ATC CCA CCG CCT GCT ACT

TM(℃) 53 GC% 61.11 Size 20bp The sequence for making primer mth2-160C2 AC166706 Primer name 160C2 17R Primer sequence 5’-GGT GCT CCG ATG GTT

CTG TM(℃) 53 GC% 61.11 Size 20bp The sequence for making primer mth2-160C2 AC166706 Master mix for one PCR reaction


67



175E1 3F+3R


Primer sequence 5’-CCA AGT CAG TGC ATC TGG AA

TM(℃) 52 GC% 50.00 Size 20bp The sequence for making primer mth2-175E1 CR498592 Primer name 175E1 3R

Primer sequence 5’-GGT TAT GGG CTT ATG

GCT CA TM(℃) 52 GC% 50.00 Size 20bp The sequence for making primer mth2-175E1 CR498592 Master mix for one PCR reaction



Product Length bp

175E1 4F+4R


Primer sequence 5’-TAA GCG ACC AAT CAC GAC AA

TM(℃) 50 GC% 45 Size 20bp The sequence for making primer mth2-175E1 CR498592 Primer name 175E1 4R

Primer sequence 5’-AAG AGC TCA TAC GCC

AAA GG TM(℃) 52 GC% 50 Size 20bp The sequence for making primer mth2-175E1 CR498592 Master mix for one PCR reaction



Product Length bp

68

40N1 1F+1R

Primer name 40N1 1F

Primer sequence 5’-ACT GTG GAT GTT GAT TTG GTT T

TM(℃) 49 GC% 36.36 Size 20bp The sequence for making primer mth2-40N1 CG948489

CG948482 Primer name 40N1 1R

Primer sequence 5’-ACA CGC CTT CCA TAA

GAA ATG T TM(℃) 51 GC% 40.91 Size 20bp The sequence for making primer mth2-40N1 CG948489

CG948482 Master mix for one PCR reaction



Product Length bp

40N1 2F+2R

Primer name 40N1 2F

Primer sequence 5’-AGG TGG CCA TGA AAG TAT GC

TM(℃) 52 GC% 50 Size 20bp The sequence for making primer mth2-40N1 CG948489

CG948482 Primer name 40N1 2R

Primer sequence 5’-TCC TTC ACA TCC ATT

AGT TCA AGA TM(℃) 52 GC% 37.5 Size 24bp The sequence for making primer mth2-40N1 CG948489




Product Length bp

32O23 1F+1R


Primer sequence 5’-CCC TTT GTA GCA CCG ACA TT

TM(℃) 52 GC% 50 Size 20bp

69

The sequence for making primer mth2-32O23 CG956631 CG956254

Primer name 32O23 1R

Primer sequence 5’-CAA ATG TGC GAC TCT

CAA CC TM(℃) 52 GC% 50 Size 20bp The sequence for making primer mth2-32O23 CG956631




Product Length bp

32O23 2F+2R


Primer sequence 5’-TTG TAG CTT ATC CGT GAT ATG AGC

TM(℃) 54 GC% 41.67 Size 24bp The sequence for making primer mth2-32O23 CG956631

CG956254 Primer name 32O23 2R

Primer sequence 5’-TGC GTG TCT AGC TGT

GTA CCT TM(℃) 54 GC% 52.38 Size 21bp The sequence for making primer mth2-32O23 CG956631




Product Length bp

154I23 1F+1R

Primer name 154I23 1F

Primer sequence 5’-GCA AAT AAA TCA TAG GAT CGA AG

TM(℃) 50 GC% 34.78 Size 24bp The sequence for making primer mth2-154I23 CT485796 Primer name 154I23 1R

Primer sequence 5’-CCT GAT TTT CTC TTG

GCA CA TM(℃) 50 GC% 45 Size 21bp

70

The sequence for making primer mth2-154I23 CT485796 Master mix for one PCR reaction



Product Length bp

154I23 2F+2R

Primer name 154I23 2F Primer sequence 5’-TAT GTC GCG TCC GAT GAC TA

TM(℃) 52 GC% 50 Size 24bp The sequence for making primer mth2-154I23 CT485796 Primer name 154I23 2R

Primer sequence 5’-TCT GTT GAA CTG CCG

ACT TG TM(℃) 52 GC% 50 Size 21bp The sequence for making primer mth2-154I23 CT485796 Master mix for one PCR reaction



Product Length bp

154I23 2F+2R

Primer name 154I23 2F Primer sequence 5’-CTT CCA ACT GAC CCC AAA GA

TM(℃) 52 GC% 50 Size 24bp The sequence for making primer mth2-154I23 CT485796 Primer name 154I23 2R

Primer sequence 5’-ATC TAA CGG GGT GGA

CAC AA TM(℃) 52 GC% 50 Size 21bp The sequence for making primer mth2-154I23 CT485796 Master mix for one PCR reaction



Product Length bp

71

1G13 1F+1R

Primer name 1G13 1F

Primer sequence 5’-TAG TGC CCC CTT TAG TTT TGA A

TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-1G13 CG925908 Primer name 1G13 1R

Primer sequence 5’-TGA AGA TGA ATA CCG

GTT GTT G TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-1G13 CG925908 Master mix for one PCR reaction



Product Length bp

1G13 S 2F+2R

Primer name 1G13 S 2F

Primer sequence 5’-TTA GTG CCC CCT TTA GTT TTG A

TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-1G13 CG925908 Primer name 1G13 S 2R

Primer sequence 5’-CAA GGA CCA ATG TGA

TTG AAT TT TM(℃) 50 GC% 34.78 Size 23bp The sequence for making primer mth2-1G13 CG925908 Master mix for one PCR reaction



Product Length bp

1G13 S 3R

Primer name 1G13 S 3R Primer sequence 5’-TGA AGA TGA ATA CCG GTT GTT G

TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-1G13 CG925908

72

1G13 S 4F

Primer name 1G13 4F

Primer sequence 5’-CTT GAT TTA GTG CCC CCT TTA G

TM(℃) 53 GC% 45.45 Size 22bp The sequence for making primer mth2-1G13 CG925908 Primer name 1G13 4R

Primer sequence 5’-AAC ACT AAA TTA CTA

CTT TTA CTT CTA AAA CA TM(℃) 53 GC% 21.88 Size 32bp The sequence for making primer mth2-1G13 CG925908 Master mix for one PCR reaction



Product Length bp

164P8 1F+1R

Primer name 164P8 1F

Primer sequence 5’-CCA TTT TGT TGC AGT GAG GA

TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-164P8 AC157646 Primer name 164P8 1R

Primer sequence 5’-TTG AGC ATA TGG CAG

CAG TC TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-164P8 AC157646 Master mix for one PCR reaction



Product Length bp

160C2M 1F+1R

Primer name 160C2M 1F Primer sequence 5’-ttt ttg cgg tgc atg agt aa TM(℃) 60.25 GC% 40.00 Size 22bp The sequence for making primer mth2-160c2 AC166706 Primer name 160C2M 1R Primer sequence 5’-caa agg tcc cgt ttg gat aa TM(℃) 59.80 GC% 45.00 Size 22bp

73

The sequence for making primer mth2-160c2 AC166706 Master mix for one PCR reaction




160C2M 2F+2R

Primer name 160C2M 2F Primer sequence 5’-ttt tga agg gag ggg ttt tt TM(℃) 59.79 GC% 40.00 Size 22bp The sequence for making primer mth2-160c2 AC166706 Primer name 160C2M 2R Primer sequence 5’-tat ggg gtg ttt ggt tgt ga TM(℃) 59.67 GC% 45.00 Size 22bp The sequence for making primer mth2-160c2 AC166706 Master mix for one PCR reaction




160C2M 3F+3R

Primer name 160C2M 3F Primer sequence 5’-gaa acg gag gga gtg tgt gt tt

TM(℃) 60.0 GC% 55.00 Size 22bp The sequence for making primer mth2-160c2 AC166706 Primer name 160C2M 3R Primer sequence 5’-gtg gtg tta tcc ctc cat gc TM(℃) 60.20 GC% 55.00 Size 22bp The sequence for making primer mth2-160c2 AC166706 Master mix for one PCR reaction




160C2M 4F+4R

Primer name 160C2M 4F Primer sequence 5’-ttt tgt tgc atg ggt gaa tgt a TM(℃) 60.36 GC% 40 Size 22bp

74

The sequence for making primer mth2-160c2 AC166706 Primer name 160C2M 4R Primer sequence 5’-atg gct ggt cca atc tca tc TM(℃) 59.89 GC% 50 Size 20bp The sequence for making primer mth2-160c2 AC166706 Master mix for one PCR reaction




60C2M 5F+5R

Primer name 160C2M 5F Primer sequence 5’-gcc cag caa tga atc ctc ta TM(℃) 60.18 GC% 50.00 Size 20bp The sequence for making primer mth2-160c2 AC166706 Primer name 160C2M 5R Primer sequence 5’-tca gat cga ctg caa ctc ca TM(℃) 60.56 GC% 50.00 Size 20bp The sequence for making primer mth2-160c2 AC166706 Master mix for one PCR reaction




154I23M 1F+1R

Primer name 154I23M 1F

Primer sequence 5’-ggg tca tga ttg aag cct ct

TM(℃) 59.09 GC% 50.00 Size 20bp The sequence for making primer mth2-154I23M CT485796 Primer name 154I23M 1R Primer sequence 5’-cgg aaa att ttg cag gga ct

TM(℃) 61.33 GC% 45.00 Size 20bp The sequence for making primer mth2-154I23M CT485796 Master mix for one PCR reaction



Product Length 392 bp

75

154I23M 2F+2R


Primer sequence ’-agc taa gct cac ggg aac aa

TM(℃) 60.02 GC% 50.00 Size 20bp The sequence for making primer mth2-154I23M CT485796 Primer name 154I23M 2R Primer sequence 5’-ggc tca tac cac cac aaa ca

TM(℃) 59.42 GC% 50.00 Size 20bp The sequence for making primer mth2-154I23M CT485796 Master mix for one PCR reaction




154I23M 3F+3R


Primer sequence 5’-gcc ttt gga tta aat gaa atg aa

TM(℃) 59.37 GC% 30.44 Size 23bp The sequence for making primer mth2-154I23M CT485796 Primer name 154I23M 3R Primer sequence 5’-agg tgg aaa caa aat gtg agc TM(℃) 59.09 GC% 42.86 Size 21bp The sequence for making primer mth2-154I23M CT485796 Master mix for one PCR reaction




154I23M 4F+4R


Primer sequence 5’-aaa taa atc cgg gtc cca tt

TM(℃) 33.33 GC% 40.00 Size 20bp The sequence for making primer mth2-154I23M CT485796 Primer name 154I23M 4R Primer sequence 5’-tgg atg att tct tta tca agc tca TM(℃) 60.10 GC% 33.33 Size 24bp The sequence for making primer mth2-154I23M CT485796

76





154I23M 5F+5R


Primer sequence 5’-aaa aag ttt ccc atc ctc aat ta

TM(℃) 58.14 GC% 30.44 Size 23bp The sequence for making primer mth2-154I23M CT485796 Primer name 154I23M 5R Primer sequence 5’-agt ctc aag gga aga aaa ttc a TM(℃) 57.09 GC% 36.36 Size 22bp The sequence for making primer mth2-154I23M CT485796 Master mix for one PCR reaction




154I23M 6F+6R


Primer sequence 5’-tca aat cgc ttg aca tgg aa

TM(℃) 60.20 GC% 40.00 Size 23bp The sequence for making primer mth2-154I23M CT485796 Primer name 154I23M 6R Primer sequence 5’-tgg tgt ctg tga gca gtt ttg TM(℃) 59.93 GC% 47.62 Size 22bp The sequence for making primer mth2-154I23M CT485796 Master mix for one PCR reaction




154I23M 7F+7R


Primer sequence 5’-caa ggg gga cat gac tga ct

TM(℃) 59.96 GC% 55.00 Size 20bp

77

The sequence for making primer mth2-154I23M CT485796 Primer name 154I23M 7R Primer sequence 5’-aattg cag cgg ata aaa cag ag TM(℃) 59.06 GC% 45.00 Size 22bp The sequence for making primer mth2-154I23M CT485796 Master mix for one PCR reaction




154I23M 8F+8R


Primer sequence 5’-cac acc aca aac cat cca gt

TM(℃) 59.28 GC% 50.00 Size 20bp The sequence for making primer mth2-154I23M CT485796 Primer name 154I23M 8R Primer sequence 5’-ggc acg gac acc tca ctt at TM(℃) 60.00 GC% 55.00 Size 22bp The sequence for making primer mth2-154I23M CT485796 Master mix for one PCR reaction




164P8 S 1F+1R

Primer name 164P8 S 1F Primer sequence 5’- CAA ACC ATT TTG TTG CAG TGA G

TM(℃) 60.57 GC% 40.91 Size 22bp The sequence for making primer mth2-164P8 CR491524 Primer name 164P8 S 1R

Primer sequence 5’- CAA AAC TTA ACT GAT

TTC ATT CTC AAA TM(℃) 59.24 GC% 25.93 Size 27bp The sequence for making primer mth2-164P8 CR491524 Master mix for one PCR reaction



78


10P15 S 1F +1R

Primer name 10P15 S 1F Primer sequence 5’-GAG TCC ATT GCA CCA TTT CTT T

TM(℃) 60.36 GC% 40.91 Size 22bp The sequence for making primer mth2-10P15 CG919384 Primer name 10P15 S 1R Primer sequence 5’-CAC CTT TAC ATT TCT

GTT CTC AAA TM(℃) 57.57 GC% 33.33 Size 24 bp The sequence for making primer mth2-10P15 CG919384 Master mix for one PCR reaction




8I23 S 1F +1R

Primer name 8I23 S 1F Primer sequence 5’ TTC AAA CAT ACA ATT AAG GTT TAA CAA

TM(℃) 57.54 GC% 22.22 Size 27bp The sequence for making primer mth2-154I23M CG957042 Primer name 8I23 S 1R Primer sequence 5’ CGC TAC GTT GGT TCT

TTT GAC TM(℃) 59.80 GC% 47.62 Size 21 bp The sequence for making primer mth2-154I23M CG957042 Master mix for one PCR reaction




57D22 S 1F +1R

Primer name 57D22 S 1F Primer sequence 5’ GAA ATT TAA CAT TTT AAT GAG CCA AA

TM(℃) 59.01 GC% 23.08 Size 26bp The sequence for making primer mth2-57D22 CG928388

79

Primer name 57D22 S 1R Primer sequence 5’ GCA GTG TTT AAG AAT AAC TCT CGT C

TM(℃) 57.84 GC% 40.00 Size 25 bp The sequence for making primer mth2-57D22 CG928388 Master mix for one PCR reaction




4L4 S 1F +1R

Primer name 4L4 S 1F Primer sequence 5’ CCC GAG AAC GAA CAA AAG AA

TM(℃) 60.22 GC% 45.00 Size 26bp The sequence for making primer mth2-4L4 CG927756 Primer name 4L4 S 1R Primer sequence 5’TAA GGT ACC GTT TGG

CCT GA TM(℃) 60.49 GC% 50.00 Size 25 bp The sequence for making primer mth2-4L4 CG927756 Master mix for one PCR reaction




10P15 S 1F

Primer name 10P15 S 1F Primer sequence 5’-GAG TCC ATT GCA CCA TTT CTT T

TM(℃) 60.36 GC% 40.91 Size 22bp The sequence for making primer mth2-10P15 CG919384 Primer name 10P15 S 1R Primer sequence 5’-CAC CTT TAC ATT TCT

GTT CTC AAA TM(℃) 57.57 GC% 33.33 Size 24bp The sequence for making primer mth2-10P15 CG919384 Master mix for one PCR reaction


PCR reaction Protocol 94℃ for 3min, 94℃ for 30sec, 55℃ for 30sec, 72℃ for

80

30sec, repeat 34 times, 72℃ for 5min, 25℃ forever Product Length 844bp

8I23 S 1F+1R

Primer name 8I23 S 1F Primer sequence 5’ TTC AAA CAT ACA ATT AAG GTT TAA CAA

TM(℃) 57.54 GC% 22.22 Size 27bp The sequence for making primer mth2-8I23 CG919384 Primer name 8I23 S 1R Primer sequence 5’ CGC TAC GTT GGT TCT

TTT GAC

TM(℃) 59.80 GC% 47.62 Size 21bp The sequence for making primer mth2-8I23 CG919384 Master mix for one PCR reaction




57D22 S 1F +1R

Primer name 57D22 S 1F Primer sequence 5’ GAA ATT TAA CAT TTT AAT GAG CCA AA

TM(℃) 59.01 GC% 23.08 Size 26bp The sequence for making primer mth2-57D22 CG928388 Primer name 57D22 S 1R Primer sequence 5’ GCA GTG TTT AAG AAT

AAC TCT CGT C TM(℃) 57.84 GC% 40.00 Size 25bp The sequence for making primer mth2-57D22 CG928388 Master mix for one PCR reaction




81

4L4 S 1F +1R

Primer name 4L4 S 1F Primer sequence 5’ CCC GAG AAC GAA CAA AAG AA

TM(℃) 60.22 GC% 45.00 Size 20bp The sequence for making primer mth2-4L4 CG927756 Primer name 4L4 S 1R Primer sequence 5’TAA GGT ACC GTT TGG

CCT GA TM(℃) 60.49 GC% 50.00 Size 20bp The sequence for making primer mth2-4L4 CG927756 Master mix for one PCR reaction




4L4 S 2F

Primer name 4L4 S 2F Primer sequence 5’ GCT TGA AGA AGA AAT TAA AAC CTC A

TM(℃) 59.39 GC% 32.00 Size 25bp The sequence for making primer mth2-4L4 CG927756

187J11 S 1F+1R

Primer name 187J11 S 1F Primer sequence 5’ TGC CCA TTT TCA GTT AAT TTT TG

TM(℃) 60.22 GC% 30.44 Size 23bp The sequence for making primer mth2-187J11 CR478106 Primer name 187J11 S 1R Primer sequence 5’ TTA ACA ATG ACC GCC

TAG CTC TM(℃) 59.38 GC% 47.62 Size 21bp The sequence for making primer mth2-187J11 CR478106 Master mix for one PCR reaction




82

38K19 S 1F+1R

Primer name 38K19 S 1F Primer sequence 5’ GTG GGT TGC TAA ATG CTG ATC T

TM(℃) 60.51 GC% 45.46 Size 22bp The sequence for making primer mth2-38K19 CG975869 Primer name 38K19 S 1F Primer sequence 5’ CTC CTC TTT CAA CTG

CTC CAA T TM(℃) 59.89 GC% 45.46 Size 22bp The sequence for making primer mth2-38K19 CG975869 Master mix for one PCR reaction




159N10 S 1F+1R

Primer name 159N10 S 1F Primer sequence 5’ GGC AAT TAA TGA GTT GCG TTC

TM(℃) 59.61 GC% 42.86 Size 21bp The sequence for making primer mth2-159N10 CR489384 Primer name 159N10 S 1R Primer sequence 5’ TCT CAT TCA CTT CCT

TCT GCA A TM(℃) 59.99 GC% 40.91 Size 22bp The sequence for making primer mth2-159N10 CR489384 Master mix for one PCR reaction




49O22 S 1F+1R

Primer name 49O22 S 1F Primer sequence 5’ TGG ATA AGT CGA ATC AGA GAG C

TM(℃) 58.56 GC% 45.46 Size 22bp The sequence for making primer mth2-49O22 CG960480 Primer name 49O22 S 1R Primer sequence 5’ CGA GCT TGT CAA ATA

83

CAC ATC G TM(℃) 60.69 GC% 45.46 Size 22bp The sequence for making primer mth2-49O22 CG960480 Master mix for one PCR reaction




143J16 S 1F +1R

Primer name 143J16 S 1F Primer sequence 5’ GCT TTG ATT TGA TAA TGA ATT GG

TM(℃) 57.72 GC% 30.44 Size 22bp The sequence for making primer mth2-143J16 CR494276 Primer name 143J16 S 1R Primer sequence 5’ ATT TTT AGA CAA ACC

AAA ATG GAA TM(℃) 58.13 GC% 25.00 Size 22bp The sequence for making primer mth2-143J16 CR494276 Master mix for one PCR reaction




161F24 S 1F+1R

Primer name 161F24 S 1F Primer sequence 5’ GCT TGG TTG CCC TAA TTT TAA C

TM(℃) 59.09 GC% 40.91 Size 22bp The sequence for making primer mth2-161F24 CR490548 Primer name 161F24 S 1R Primer sequence 5’ AAC GGA CCC TAC AAA

AGA TTG A TM(℃) 59.87 GC% 40.91 Size 22bp The sequence for making primer mth2-161F24 CR490548 Master mix for one PCR reaction



84


68B10 S 1F+1R

Primer name 68B10 S 1F Primer sequence 5’ AGT ATT AGG GTG AAA ATT GCC AAG

TM(℃) 59.81 GC% 37.50 Size 24bp The sequence for making primer mth2-161F24 CG922494 Primer name 68B10 S 1R Primer sequence 5’ AGT AAA TTA CAC TTC

GTC CCC TCA TM(℃) 60.28 GC% 41.67 Size 24bp The sequence for making primer mth2-161F24 CG922494 Master mix for one PCR reaction




78L20 S 1F+1R

Primer name 78L20 S 1F Primer sequence 5’ ACT TCG GTG AAT GAT CAG GAC T

TM(℃) 60.00 GC% 45.46 Size 22bp The sequence for making primer mth2-78L20 CG935356 Primer name 78L20 S 1R Primer sequence 5’ GGA GAT AAT TGT GGG

TTG GCT A TM(℃) 60.20 GC% 45.46 Size 22bp The sequence for making primer mth2-78L20 CG935356 Master mix for one PCR reaction




71F24 S 1F+1R

Primer name 71F24 S 1F Primer sequence 5’ GCT TCC TTT GCA AAT TCC ATT

TM(℃) 60.43 GC% 38.10 Size 21bp

85

The sequence for making primer mth2-71F24 CG959625 Primer name 71F24 S 1R Primer sequence 5’ AAC AAT GAA ATA ACT

CGA ACT ACA ACG TM(℃) 60.95 GC% 33.33 Size 27bp The sequence for making primer mth2-71F24 CG959625 Master mix for one PCR reaction




78L20 SR F1+R1

Primer name 78L20 SR F1 Primer sequence 5’ cactctaagcattcgcaaacc

TM(℃) 55.7 GC% 47.6 Size 21bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 SR R1 Primer sequence 5’ catccacaccatcaaaaggcac TM(℃) 58.2 GC% 50 Size 22bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction




78L20 SR F2+R2

Primer name 78L20 SR F2 Primer sequence 5’ gtggattgagctttgtcgtgtctg

TM(℃) 59.2 GC% 50 Size 24bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 SR R2 Primer sequence 5’ acaccccaaagcagtgcaaatcct TM(℃) 62.2 GC% 50 Size 24bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction



86


78L20 SR F3+R3

Primer name 78L20 SR F3 Primer sequence 5’ aacgtcagtttcaaacacggt

TM(℃) 56.1 GC% 42.9 Size 21bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 SR R3 Primer sequence 5’ tactctcaagtcagagatgagca TM(℃) 55.4 GC% 43.5 Size 23bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction




78L20 SR F4+R4

Primer name 78L20 SR F4 Primer sequence 5’ aatgctcttgtggcttgtgat

TM(℃) 56.1 GC% 42.9 Size 21bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 SR R4 Primer sequence 5’ tgttccttgaaaaaacagggctg TM(℃) 57.3 GC% 43.5 Size 23bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction




78L20 SR F5+R5

Primer name 78L20 SR F5 Primer sequence 5’ gctgctatcttttggcgaagac

TM(℃) 57.7 GC% 50 Size 22bp The sequence for making primer mth2-78L20 AC203562

87

Primer name 78L20 SR R5 Primer sequence 5’ ctggtgacgtacatagcgagct TM(℃) 59.3 GC% 54.5 Size 22bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction




78L20 PL 1F+1R

Primer name 78L20 PL 1F Primer sequence 5’ atcatttggggcttgcttaacgga

TM(℃) 59.9 GC% 45.8 Size 24bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 PL 1R Primer sequence 5’ agctgaatcaccatgtctcttgca TM(℃) 59.3 GC% 45.8 Size 24bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction




78L20 PL 2F+2R

Primer name 78L20 PL 2F Primer sequence 5’ ccagtgactccaaaaacccggt

TM(℃) 60.7 GC% 54.5 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 PL 2R Primer sequence 5’ ccagaatctctaggacactggt TM(℃) 56.5 GC% 50 Size 22bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction




88

78L20 PL 3F+3R

Primer name 78L20 PL 3F Primer sequence 5’ aacagatttgtagcccccgatgac

TM(℃) 60 GC% 50 Size 24bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 PL 3R Primer sequence 5’ accggtcttagtcaaactctgca TM(℃) 58.7 GC% 47.8 Size 23bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction




1G13 35442 1F+1R

Primer name 1G13 35442 1F

Primer sequence 5’ ccaccaaaccaactcaaatg

TM(℃) 58.87 GC% 45 Size 20bp The sequence for making primer mth2-1G13 Primer name 1G13 35442

1R Primer sequence 5’aaaacgatgaattagatccttacga

TM(℃) 59.47 GC% 32 Size 25bp The sequence for making primer mth2--1G13 Master mix for one PCR reaction




1G13 37436 1F+1R


Primer sequence 5’CGGTAAGATATGAAAGGAGAAAAGA

TM(℃) 59.26 GC% 36 Size 25bp The sequence for making primer mth2-1G13 Primer name 1G13 37436

1R Primer sequence 5’CCGACTAATTTTTGTGAA

GGTG

89

TM(℃) 58.67 GC% 40.91 Size 22bp The sequence for making primer mth2--1G13 Master mix for one PCR reaction




1G13 35442 2F+2R


Primer sequence 5’GGAGTAAGTCAATACCACCAAAACCAA

TM(℃) 57.7 GC% 42.3 Size 26bp The sequence for making primer mth2-1G13 Primer name 1G13 35442

2R Primer sequence 5’AGTTTCCTTAACCAATGC

ACCAGG TM(℃) 58.6 GC% 45.8 Size 24bp The sequence for making primer mth2--1G13 Master mix for one PCR reaction




1G13 37436 2F+2R


Primer sequence 5’CCGATGTTGTAATGCATAATCCAGGCAA

TM(℃) 58.5 GC% 40.7 Size 27bp The sequence for making primer mth2-1G13 Primer name 1G13 37436

2R Primer sequence 5’ATTTCCTGATACTTAGAG

GGCCAA TM(℃) 56.3 GC% 41.7 Size 24bp The sequence for making primer mth2--1G13 Master mix for one PCR reaction




90

78L20 C 1F+1R

Primer name 78L20 C 1F Primer sequence 5’-ctc ctt ctc ttc gca atc tca t

TM(℃) 59.98 GC% 45.46 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 C 1R Primer sequence 5’-cct tat cct tac cac gaa ctg c TM(℃) 60.02 GC% 50.00 Size 22bp The sequence for making primer mth2-78L20 AC203562 Master mix for one PCR reaction




78L20 C 2F+2R

Primer name 78L20 C 2F Primer sequence 5’-ctt gca att atc gcc tta aac c

TM(℃) 59.99 GC% 40.91 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 C 2R Primer sequence 5’-atg aga ttg cga aga gaa gga g TM(℃) 59.98 GC% 45.46 Size 22bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




78L20 C 3F+3R

Primer name 78L20 C 3F Primer sequence 5’-acc acc atg aga aaa gga aga a

TM(℃) 59.98 GC% 40.91 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 C 3R Primer sequence 5’-aaa gag att ggt ttg gcg taa a TM(℃) 60.00 GC% 36.36 Size 22bp The sequence for making primer mth2--78L20 AC203562

91





78L20 C 4F+4R

Primer name 78L20 C 4F Primer sequence 5’-tca aag aag agt gtg cgt gac t

TM(℃) 60.10 GC% 45.46 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 C 4R Primer sequence 5’-aaa aga gat tgg ttt ggc gta a TM(℃) 60.00 GC% 36.36 Size 22bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




78L20 C 5F+5R

Primer name 78L20 C 5F Primer sequence 5’-tac aat tga ttc tgg cga aca c

TM(℃) 60.00 GC% 40.91 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 C 5R Primer sequence 5’-aac tcc atg gtt gag ctt gaa t TM(℃) 60.00 GC% 40.91 Size 22bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




92

78L20 C 6F+6R

Primer name 78L20 C 6F Primer sequence 5’-tat cgg cgg tct ttg aac tta t

TM(℃) 59.99 GC% 40.91 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 C 6R Primer sequence 5’-ccg gat tag atg ctt taa cgt c TM(℃) 59.99 GC% 45.46 Size 22bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




78L20 C 7F+7R

Primer name 78L20 C 7F Primer sequence 5’-cga aga ccc caa gtt tct tat g

TM(℃) 59.99 GC% 45.46 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 C 7R Primer sequence 5’-ttc tgt gca cca ata aat gac c TM(℃) 59.87 GC% 40.91 Size 22bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




78L20 C 8F+8R

Primer name 78L20 C 8F Primer sequence 5’-caa ttg tac tgg cac caa tgt t

TM(℃) 59.79 GC% 40.91 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 C 8R Primer sequence 5’-agg act gta act cct ggt gca t TM(℃) 60.06 GC% 50.00 Size 22bp The sequence for making primer mth2--78L20 AC203562

93





78L20 M 1F+1R

Primer name 78L20 M 1F Primer sequence 5’-tac gca ccc gta ttg ggt at

TM(℃) 60.10 GC% 50.00 Size 20bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 M 1R Primer sequence 5’-gtt ggt taa cgg cgg aat aa TM(℃) 59.83 GC% 45.00 Size 20bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




78L20 M 2F+2R

Primer name 78L20 M 2F Primer sequence 5’-ccc gta ttg ggt atg cgt aa

TM(℃) 60.58 GC% 50.00 Size 20bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 M 2R Primer sequence 5’-tag ttg gtt aac ggc gga at TM(℃) 59.47 GC% 45.00 Size 20bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




94

78L20 M 3F

Primer name 78L20 M 3F Primer sequence 5’cgg taa agt gcc tct acc aag

TM(℃) 58.91 GC% 52.38 Size 21bp The sequence for making primer mth2-78L20 AC203562

78L20 G 1F+1R

Primer name 78L20 M 1F Primer sequence 5’-CCC TAC TCT CCT ACC ACT ACT CTC TC

TM(℃) 59.44 GC% 53.85 Size 26bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 M 1R Primer sequence 5’-TTT GTC AAC CAA ACT

CAG ACA TCT TM(℃) 60.07 GC% 37.50 Size 24bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




78L20 G 2F+2R

Primer name 78L20 M 2F Primer sequence 5’-CCT ACT CTC CTA CCA CTA CTC TCT CTC

TM(℃) 58.82 GC% 51.85 Size 27bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 M 2R Primer sequence 5’-TAA CCC TCC CTC GGA

TAC CA TM(℃) 61.58 GC% 55.00 Size 20bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




95

78L20 G 3F+3R

Primer name 78L20 M 3F Primer sequence 5’-CCT ACT CTC CTA CCA CTA CTC TCT C

TM(℃) 58.82 GC% 52 Size 25bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 M 3R Primer sequence 5’-TCT AAC CCT CCC TCG

GAT ACC A TM(℃) 61.58 GC% 54.55 Size 22bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




78L20 G 4F+4R

Primer name 78L20 M 4F Primer sequence 5’-CTT CCT CTT CTC ATG CCA TTC T

TM(℃) 59.85 GC% 45.46 Size 22bp The sequence for making primer mth2-78L20 AC203562 Primer name 78L20 M 4R Primer sequence 5’-TGT GTG ATT GTG GTT

GAA CAA A TM(℃) 59.90 GC% 36.36 Size 22bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction




78L20 G 5F

Primer name 78L20 M 5F Primer sequence 5’-TTT ACT TAA CCG AAC CGG TCA T

TM(℃) 59.77 GC% 40.91 Size 22bp The sequence for making primer mth2-78L20 AC203562

96

78L20 G 5R

Primer name 78L20 M 5R Primer sequence 5’-ATG ACC GGT TCG GTT AAG TAA A

TM(℃) 59.77 GC% 40.91 Size 22bp The sequence for making primer mth2--78L20 AC203562

78L20 G 6R

Primer name 78L20 M 5R Primer sequence 5’-AGA ATG GCA TGA GAA GAG GAA G

TM(℃) 59.77 GC% 40.91 Size 22bp The sequence for making primer mth2--78L20 AC203562

78L20 G 7F

Primer name 78L20 M 5F Primer sequence 5’-GAG GCT GCA TCA GAA GGA CTC A

TM(℃) 57 GC% 54.55 Size 22bp The sequence for making primer mth2-78L20 AC203562

78L20 G 7R

Primer name 78L20 M 5R Primer sequence 5’-TGA GTC CTT CTG ATG CAG CCT C

TM(℃) 57 GC% 54.55 Size 22bp The sequence for making primer mth2--78L20 AC203562 Master mix for one PCR reaction



72E10 1F+1R

Primer name 72E10 1F Primer sequence 5’- TCC ACC ATA GTT TCC GGT ACT T

TM(℃) 59.76 GC% 45.46 Size 22bp The sequence for making primer mth2-72E10 CG941151 Primer name 72E10 1R Primer sequence 5’- GGG GAG GTT CCT ATT

TTC TTT C TM(℃) 59.35 GC% 45.46 Size 22bp The sequence for making primer mth2--72E10 CG941151

97





72E10 2F+2R

Primer name 72E10 2F Primer sequence 5’-CAC AAT GGT TTC CTT CCC TTA G

TM(℃) 59.87 GC% 45.46 Size 22bp The sequence for making primer mth2-72E10 CG940796 Primer name 72E10 2R Primer sequence 5’-TTC CCA ACT CTC TCT

TTG CTT C TM(℃) 60.00 GC% 45.46 Size 22bp The sequence for making primer mth2--72E10 CG940796 Master mix for one PCR reaction




133F3 1F+1R


Primer sequence 5’- AGA AAT CCA ACC TCG TTA TCC A

TM(℃) 59.84 GC% 40.91 Size 22bp The sequence for making primer mth2-72E10 CL315200 Primer name 133F3 1R Primer sequence 5’- GGC ATG CAT GGT ATT

TCA AAC TM(℃) 60.21 GC% 42.86 Size 21bp The sequence for making primer mth2--72E10 CL315200 Master mix for one PCR reaction




98

133F3 2F


Primer sequence 5’-CGT GGC TGA ACA GAA AGA GAT A

TM(℃) 59.52 GC% 45.46 Size 22bp The sequence for making primer mth2-72E10 CL315200

133F3 2R

Primer name 133F3 2R Primer sequence 5’-CAT ACA TAA AAG GAG GCC CAA G

TM(℃) 59.86 GC% 45.46 Size 21bp The sequence for making primer mth2--72E10 CL315200

133F3 3R

Primer name 133F3 3R Primer sequence 5’-AAT TGT GCG TGT TAC ACA AAG C

TM(℃) 60.10 GC% 40.91 Size 21bp The sequence for making primer mth2--72E10 CL315200 Master mix for one PCR reaction



Product Length bp

130K15 1F+1R

Primer name 130K15 1F Primer sequence 5’-TGA CAG AAA TCA TGC AAC CAG T

TM(℃) 60.56 GC% 40.91 Size 22bp The sequence for making primer mth2-130K15 CL313773 Primer name 130K15 1R Primer sequence 5’-GCT TGT TGA AAA TGC

GCT TAA A TM(℃) 61.54 GC% 36.36 Size 22bp The sequence for making primer mth2-130K15 CL313773 Master mix for one PCR reaction



99


130K15 2F+2R

Primer name 130K15 2F Primer sequence 5’-GCA AAT TCA CCA TGT TTT CTG A

TM(℃) 59.98 GC% 36.36 Size 22bp The sequence for making primer mth2-130K15 CL313772 Primer name 130K15 2R Primer sequence 5’-GCT GGG AAA GTT TTA

AAT CCA A TM(℃) 59.50 GC% 36.36 Size 22bp The sequence for making primer mth2-130K15 CL313772 Master mix for one PCR reaction




130K15 3F+3R

Primer name 130K15 2F Primer sequence 5’-ATC TTA TGG GCG GAA GAG ATT T

TM(℃) 60.29 GC% 40.91 Size 22bp The sequence for making primer mth2-130K15 CL313772 Primer name 130K15 2R Primer sequence 5’-TCC TTG GAA TTC TGT

TGA TAA ATG TM(℃) 59.40 GC% 33.33 Size 24bp The sequence for making primer mth2-130K15 CL313772 Master mix for one PCR reaction




152P2 1F+1R


Primer sequence 5’- TGT GGT GCA TAT ACC CCT ATT G

100

TM(℃) 59.61 GC% 45.46 Size 22bp The sequence for making primer mth2-152P2 CR485104 Primer name 152P2 1R

Primer sequence 5’- CAT GAT TTT GGT GGT

TAT GGT G TM(℃) 59.98 GC% 40.91 Size 22bp The sequence for making primer mth2-152P2 CR485104 Master mix for one PCR reaction




152P2 2F+2R


Primer sequence 5’-ATA CAG CCA GCA AGA CAC GAT A

TM(℃) 59.80 GC% 45.46 Size 22bp The sequence for making primer mth2-152P2 CR485104 Primer name 152P2 2R

Primer sequence 5’-TAC CCC TAT AGG ATT

TGC AAG G TM(℃) 59.37 GC% 45.46 Size 22bp The sequence for making primer mth2-152P2 CR485104 Master mix for one PCR reaction




182H19 1F+1R

Primer name 182H19 1F

Primer sequence 5’-GCT CTT TCA AAG GCT GTG TTG T

TM(℃) 60.83 GC% 45.46 Size 22bp The sequence for making primer mth2-182H19 CR504295 Primer name 182H19 1R Primer sequence 5’-CTG AAA TGA ATG ACT

GCA GGA G TM(℃) 59.88 GC% 45.46 Size 22bp The sequence for making primer mth2-182H19 CR504295

101





182H19 2F+2R

Primer name 182H19 2F

Primer sequence 5’-CAT GTA CCT TTC TAG TAT CCT TTG GA

TM(℃) 59.09 GC% 38.46 Size 26bp The sequence for making primer mth2-182H19 CR504295 Primer name 182H19 2R Primer sequence 5’-GCC CAC GTT TTT CAC

TTC TGT A TM(℃) 61.41 GC% 45.46 Size 22bp The sequence for making primer mth2-182H19 CR504295 Master mix for one PCR reaction



Product Length 372 bp Primer name 182H19 3R Primer sequence 5’-TTG CTT GTA GAA GGT

TTC ATG C TM(℃) 59.41 GC% 40.91 Size 22bp The sequence for making primer mth2-182H19 CR504295

145B13 1F+1R

Primer name 145B13 1F Primer sequence 5’-AGC TCG TGA ATA AAT GGT GGT T

TM(℃) 59.90 GC% 40.91 Size 22bp The sequence for making primer mth2-145B13 CR481887 Primer name 145B13 1R Primer sequence 5’-CAA TTG AAT GAT TAA

TGG GGT ATG TM(℃) 59.38 GC% 33.33 Size 24bp The sequence for making primer mth2-145B13 CR481887 Master mix for one PCR reaction


102



145B13 2F+2R

Primer name 145B13 2F Primer sequence 5’-CAA ACC ACC TTC ATG GCT ACA T

TM(℃) 61.14 GC% 45.46 Size 22bp The sequence for making primer mth2-145B13 CR481887 Primer name 145B13 2R Primer sequence 5’-GAT ACA CTC ACC ACG

TTT CTG C TM(℃) 59.67 GC% 50.00 Size 22bp The sequence for making primer mth2-145B13 CR481887 Master mix for one PCR reaction




151C16 1F+1R

Primer name 151C16 1F Primer sequence 5’-GAA TAT CAG GGC TCC TTC CTT T

TM(℃) 59.94 GC% 45.46 Size 22bp The sequence for making primer mth2-151C16 CR483873 Primer name 151C16 1F Primer sequence 5’-GTG CAT CAT GAT TGA

AAT TGG T TM(℃) 59.70 GC% 36.36 Size 22bp The sequence for making primer mth2-151C16 CR483873 Master mix for one PCR reaction




103

151C16 2F+2R

Primer name 151C16 2F Primer sequence 5’- TTT GAG AAC CGT GTA TGT TTG C

TM(℃) 60.04 GC% 40.91 Size 22bp The sequence for making primer mth2-151C16 CR483873 Primer name 151C16 2F Primer sequence 5’- TTT CAA CAG AGG GCC

TAG ATT C TM(℃) 59.73 GC% 45.46 Size 22bp The sequence for making primer mth2-151C16 CR483873 Master mix for one PCR reaction




45B19 1F+1R

Primer name 45B19 1F Primer sequence 5’-TTC AGC TTC ACT ACC GAC TCA A

TM(℃) 60.04 GC% 40.91 Size 22bp The sequence for making primer mth2-45B19 CG933092 Primer name 45B19 1R Primer sequence 5’-CAA GCC TTT GTG CAA

CTG TAA G TM(℃) 59.73 GC% 45.46 Size 22bp The sequence for making primer mth2-45B19 CG933092 Master mix for one PCR reaction




45B19 2F+2R

Primer name 45B19 2F Primer sequence 5’-CTC CTC TTT CAA CTG CTC CAA T

TM(℃) 59.89 GC% 45.46 Size 22bp The sequence for making primer mth2-45B19 CG933092

104

Primer name 45B19 2R Primer sequence 5’-GAA TAT CGG GTT TCT GAT GGT G

TM(℃) 60.56 GC% 45.46 Size 22bp The sequence for making primer mth2-45B19 CG933092 Master mix for one PCR reaction




35O16 1F+1R


Primer sequence 5’-GTG ACA ATA CAT CAT GGG ATG C

TM(℃) 60.09 GC% 45.46 Size 22bp The sequence for making primer mth2-35O16 CG964367 Primer name 35O16 1R

Primer sequence 5’-GGG TTC ATT GCG TTT

TAT ACC T TM(℃) 60.09 GC% 40.91 Size 22bp The sequence for making primer mth2-35O16 CG964367 Master mix for one PCR reaction




35O16 2F+2R


Primer sequence 5’-TAC GAT TTT CAA GCG GTC TGT A

TM(℃) 59.78 GC% 40.91 Size 22bp The sequence for making primer mth2-35O16 CG964367 Primer name 35O16 2R

Primer sequence 5’-CAT CAA GTT GTT GCC

TCT TCA A TM(℃) 60.28 GC% 40.91 Size 22bp The sequence for making primer mth2-35O16 CG964367 Master mix for one PCR reaction


105



1M24 1F+1R

Primer name 1M24 1F

Primer sequence 5’-TTT CGA CGT TAC ATC CGT TAA A

TM(℃) 59.53 GC% 36.36 Size 22bp The sequence for making primer mth2-1M24 CG922458 Primer name 1M24 1R

Primer sequence 5’-CCA AAA TCT GAT GAA

AGT GCA A TM(℃) 60.11 GC% 36.36 Size 22bp The sequence for making primer mth2-1M24 CG922458 Master mix for one PCR reaction




1M24 2F

Primer name 1M24 2F

Primer sequence 5’-TGG TGT CTT TGT CGT TGT TTG T

TM(℃) 60.49 GC% 40.91 Size 22bp The sequence for making primer mth2-1M24 CG922458

1M24 3F+3R

Primer name 1M24 3F

Primer sequence 5’-TTG GAG AAG ATG AAG AAC ACG A

TM(℃) 59.85 GC% 40.91 Size 22bp The sequence for making primer mth2-1M24 CG922458 Primer name 1M24 3R

Primer sequence 5’-AAT CAA ACA TGA TCC

CCA GTT C TM(℃) 60.06 GC% 40.91 Size 22bp The sequence for making primer mth2-1M24 CG922458 Master mix for one 2μl of 10X thermoPol Buffer, 1.6μl of 2.5mM dNTPs, 0.1μl

106

PCR reaction of Taq, 0.8μl of primer mix(F+R), 13.5μl of ddH2O PCR reaction Protocol 94℃ for 3min, 94℃ for 30sec, 55℃ for 30sec, 72℃ for

30sec, repeat 34 times, 72℃ for 5min, 25℃ forever Product Length 655 bp

66E10 1F+1R

Primer name 66E10 1F Primer sequence 5’-GGA AGA ATC GTC TTT TGA TTG G

TM(℃) 59.95 GC% 40.91 Size 22bp The sequence for making primer mth2-66E10 CG956134 Primer name 66E10 1R Primer sequence 5’-ATC CAG GGG AAG TTG

AGT TGT A TM(℃) 59.86 GC% 45.46 Size 22bp The sequence for making primer mth2-66E10 CG956134 Master mix for one PCR reaction




56E11 1F 1F+1R

Primer name 56E11 1F Primer sequence 5’-AGC TCA AAA ATA AGC CAA TCC A

TM(℃) 60.10 GC% 36.36 Size 22bp The sequence for making primer mth2-56E11 CG921743 Primer name 56E11 1R Primer sequence 5’-ATC CCC TTT CAA TCA

ACA AGA A TM(℃) 59.81 GC% 36.36 Size 22bp The sequence for making primer mth2-56E11 CG921743 Master mix for one PCR reaction




107

27J14FM1 1F+1R

Primer name 27J14FM1 1F Primer sequence 5’-GCT CGT AAC CTC CAA ATC CA

TM(℃) 60.07 GC% 50 Size 20bp The sequence for making primer mth2-27J14 CR968535 Primer name 27J14FM1 1R Primer sequence 5’-AAT TGG TGT GGG ACA

TGG TT TM(℃) 59.95 GC% 45.00 Size 20bp The sequence for making primer mth2-27J14 CR968535 Master mix for one PCR reaction




27J14FM1 2F+2R

Primer name 27J14FM1 2F Primer sequence 5’-AAC GGA AGT GGG TTG AGT TG

TM(℃) 60.01 GC% 50.00 Size 20bp The sequence for making primer mth2-27J14 CR968535 Primer name 27J14FM1 2R Primer sequence 5’-TCG TGG CCC TAT TGG

TAA TC TM(℃) 59.78 GC% 50.00 Size 20bp The sequence for making primer mth2-27J14 CR968535 Master mix for one PCR reaction




164n9 S21F+21R

Primer name 164n9 S21F Primer sequence 5’- tgg acg gtt cct ctt cta atg t

TM(℃) 60.00 GC% 45.46 Size 22bp The sequence for making primer mth2-164n9 AC157646

108

Primer name 164n9 S21R Primer sequence 5’- ttg ttg ctg tcc aag tct gag t TM(℃) 59.95 GC% 45.46 Size 22bp The sequence for making primer mth2-164n9 AC157646 Master mix for one PCR reaction




164n9 S22F+22R

Primer name 164n9 S22F Primer sequence 5’- TCAG AAA TAT CCC TTT CGT TTC G

TM(℃) 59.96 GC% 40.91 Size 23bp The sequence for making primer mth2-164n9 AC157646 Primer name 164n9 S22R Primer sequence 5’- TCAG AAA TAT CCC TTT

CGT TTC G TM(℃) 60.00 GC% 45.46 Size 22bp The sequence for making primer mth2-164n9 AC157646 Master mix for one PCR reaction




164n9 S23F+23R

Primer name 164n9 S23F Primer sequence 5’-gtc cca acc aac tga gtt aag c

TM(℃) 60.04 GC% 50.00 Size 22bp The sequence for making primer mth2-164n9 AC157646 Primer name 164n9 S23R Primer sequence 5’-cta ccc atg ctt cga agt ctc t TM(℃) 59.91 GC% 50.00 Size 22bp The sequence for making primer mth2-164n9 AC157646 Master mix for one PCR reaction



109


164n9 S24F+24R

Primer name 164n9 S24F Primer sequence 5’-gca gag tgt tta cgc agc ata c

TM(℃) 59.98 GC% 50.00 Size 22bp The sequence for making primer mth2-164n9 AC157646 Primer name 164n9 S24R Primer sequence 5’-tgc agt aac caa gga caa gct a TM(℃) 59.94 GC% 45.46 Size 22bp The sequence for making primer mth2-164n9 AC157646 Master mix for one PCR reaction




164n9 S24F+24R

Primer name 164n9 S24F Primer sequence 5’-gca gag tgt tta cgc agc ata c

TM(℃) 59.98 GC% 50.00 Size 22bp The sequence for making primer mth2-164n9 AC157646 Primer name 164n9 S24R Primer sequence 5’-tgc agt aac caa gga caa gct a TM(℃) 59.94 GC% 45.46 Size 22bp The sequence for making primer mth2-164n9 AC157646 Master mix for one PCR reaction




164n9 S25F

Primer name 164n9 S25F Primer sequence 5’-gacacatgttattgggctcaaa

TM(℃) 51 GC% 40.91 Size 22bp The sequence for making primer mth2-164n9 AC157646

110

164n9 S26F

Primer name 164n9 S26F Primer sequence 5’-actcccctatgcagttaactgc TM(℃) 55 GC% 50 Size 22bp The sequence for making primer mth2-164n9 AC157646

164n9 S26R

Primer name 164n9 S26R Primer sequence 5’-gcagttaactgcataggggagt


164n9 S27F

Primer name 164n9 S27F Primer sequence 5’-gcagtcggttttacttttcctcg TM(℃) 55 GC% 47.83 Size 22bp The sequence for making primer mth2-164n9 AC157646

164n9 S27R

Primer name 164n9 S27R Primer sequence 5’-cgaggaaaagtaaaaccgactgc


164n9 S28R

Primer name 164n9 S28R Primer sequence 5’-gcttaactcagttggttgggac TM(℃) 55 GC% 50 Size 22bp The sequence for making primer mth2-164n9 AC157646 Master mix for one PCR reaction



143F7 1F+1R

Primer name 143F7 1F Primer sequence 5’-AAC CTG AGC AAC AGG GTA CAT T

111

TM(℃) 53 GC% 45.45 Size 22bp The sequence for making primer mth2-143F7 AC202379 Primer name 143F7 1R Primer sequence 5’-GGT TTT CAA CTT AGC

GAG CCT A TM(℃) 53 GC% 45.45 Size 22bp The sequence for making primer mth2-143F7 AC202379 Master mix for one PCR reaction



Product Length bp

143F7 2F+2R

Primer name 143F7 2F Primer sequence 5’-CTG TTG CTG GAT TTG GTT AAT G

TM(℃) 56.5 GC% 40.91 Size 22bp The sequence for making primer mth2-143F7 AC202379 Primer name 143F7 2R Primer sequence 5’-AAG CAA CGG ATA TTT

CTG AGG A TM(℃) 56.5 GC% 40.91 Size 22bp The sequence for making primer mth2-143F7 AC202379 Master mix for one PCR reaction



Product Length bp

31M3 1F+1R

Primer name 31M3 1F Primer sequence 5'-CAG CCT ACA ACC TAG CTT TTC AT

TM(℃) 53 GC% 43.48 Size 23bp The sequence for making primer mth2-31M3 CG971885

CG971539 Primer name 31M3 1R Primer sequence 5'-TGC TAC TTG TGA ATA

GGG GTG TT TM(℃) 53 GC% 43.48 Size 23bp

112

The sequence for making primer mth2-31M3 CG971885 CG971539




Product Length bp

31M3 2F+2R

Primer name 31M3 2F Primer sequence 5’-AAC CTG AGC AAC AGG GTA CAT T


CG971539 Primer name 31M3 2R Primer sequence 5’-GGT TTT CAA CTT AGC

GAG CCT A TM(℃) 58.4 GC% 45.45 Size 22bp The sequence for making primer mth2-31M3 CG971885




Product Length bp

31M3 3F+3R

Primer name 31M3 3F Primer sequence 5’-TAG GCT CGC TAA GTT GAA AAC C


CG971539 Primer name 31M3 3R Primer sequence 5’-GAA ATC CTC TTT GGA

GAT GAC G TM(℃) 58.4 GC% 45.45 Size 22bp The sequence for making primer mth2-31M3 CG971885



113


Product Length bp

31M3 4F+4R

Primer name 31M3 4F Primer sequence 5’-CCC CAA AAC ATT AAC AGC CTA C


CG971539 Primer name 31M3 4R Primer sequence 5’-AGC TGA TCT CGT TTG

ACC TTT C TM(℃) 58.4 GC% 45.45 Size 22bp The sequence for making primer mth2-31M3 CG971885




Product Length bp

166I10 1F+1R


Primer sequence 5’-GTG GGT TGC ATG GTC TTT ATT T

TM(℃) 56.5 GC% 40.91 Size 22bp The sequence for making primer mth2-166I10 AC202326 Primer name 166I10 1R Primer sequence 5’-AAT CCT AAC GAG GCA

GTT TCA A 22bp 56.5 GC% 40.91 Size 22bp The sequence for making primer mth2-166I10 AC202326 Master mix for one PCR reaction



Product Length bp

114

166I10 2F+2R


Primer sequence 5’-AGC AAA AGG GGT AAG ACC TCT C

TM(℃) 56.5 GC% 50 Size 22bp The sequence for making primer mth2-166I10 AC202326 Primer name 166I10 2R Primer sequence 5’-AGA AAG GAG CAC CCT

CCT AGA T 22bp 56.5 GC% 50 Size 22bp The sequence for making primer mth2-166I10 AC202326 Master mix for one PCR reaction



Product Length bp

8o7 11F

Primer name 8o7 11F

Primer sequence

5’aat ttg caa tga ccc ggt act cc TM(℃) 55 GC% 47.83 Size 23bp The sequence for making primer mth2-8o7 AC145331

8o7 12F

Primer name 8o7 12F Primer sequence 5’ ctt gtg tgt tcc ttt cca act ag 22bp 53 GC% 43.83 Size 23bp The sequence for making primer mth2-8o7 AC145331

8o7 18F

Primer name 8o7 18F

Primer sequence 5’-GAC TTT GGC AGC ACA TGC TCT AC

TM(℃) 57 GC% 52.17 Size 23bp The sequence for making primer mth2-8o7 AC145331

8o7m 1F

Primer name 8o7m 1F Primer sequence 5’- CCG TCA GAA CAA AGC ACA GAG

115

22bp 54 GC% 52.38 Size 21bp The sequence for making primer mth2-8o7 AC145331

8o7 13R

Primer name 8o7 13R Primer sequence

5’-ttt gct tga gtg act taa ccc tc TM(℃) 53 GC% 43.48 Size 23bp The sequence for making primer mth2-8o7 AC145331

8o7 14R

Primer name 8o7 14R Primer sequence 5’-ccc tga tgt caa gag act taa ag 22bp 53 GC% 43.48 Size 23bp The sequence for making primer mth2-8o7 AC145331

8o7 15R

Primer name 8o7 15R

Primer sequence 5’-aaa caa att ttt ata agg ggt aaa agc tag

TM(℃) 53 GC% 26.67 Size 30bp The sequence for making primer mth2-8o7 AC145331

8o7m 16R

Primer name 8o7 16R Primer sequence 5’-ggc tga ccc ctg atg tca aga gac tta aag

22bp 63 GC% 50 Size 30bp The sequence for making primer mth2-8o7 AC145331

8o7m-1R

Primer name 8o7m-1R Primer sequence 5’ GGC CCC GAG TAT GAT AAT TTC

22bp 52 GC% 47.62 Size 21bp The sequence for making primer mth2-8o7 AC145331

116

8o7 20F

Primer name 8o7 15R

Primer sequence 5’- aac ttg tgt gtt cct ttc caa cta g

TM(℃) 54 GC% 40 Size 25bp The sequence for making primer mth2-8o7 AC145331

8o7 20R

Primer name 8o7 16R Primer sequence 5’ agg gct gac ccc tga tgt caa gag act taa ag

22bp 64 GC% 50 Size 32bp The sequence for making primer mth2-8o7 AC145331

8o7m 21R

Primer name 8o7m-1R Primer sequence 5’-CCGGCCCCGAGTATGATAATTTC

22bp 57 GC% 52.17 Size 23bp The sequence for making primer mth2-8o7 AC145331 Master mix for one PCR reaction



1G13 BES1 1F+1R

Primer name 1G13 BES1 1F

Primer sequence 5’-aca cgt ggc tga cac atc at

TM(℃) 60.04 GC% 50 Size 20bp The sequence for making primer mth2-1G13 AC203565 Primer name 1G13 BES1

1R Primer sequence 5’-gcc ctt tgg acc ttt ttc tc

22bp 60.05 GC% 50 Size 20bp The sequence for making primer mth2-1G13 AC203565 Master mix for one PCR reaction




117

40D24 BES2 1F+1R

Primer name 40D24 BES2 1F

Primer sequence 5’-cac cac att ttc cct tct cc

TM(℃) 59.38 GC% 50 Size 20bp The sequence for making primer mte1-40D24 CR316646 Primer name 40D24 BES2

1R Primer sequence 5’-cac cac att ttc cct tct cc

22bp 60.11 GC% 50 Size 20bp The sequence for making primer mte1-40D24 CR316646 Master mix for one PCR reaction




70G4 BES2 1F+1R


Primer sequence 5’-cta att tgg tcc ctg gca aa

TM(℃) 59.93 GC% 45.00 Size 20bp The sequence for making primer mte1-70G4 CR339277 Primer name 70G4 BES2

1F Primer sequence 5’-ttc cat cca tca cga ctt ca

22bp 60.05 GC% 45.00 Size 20bp The sequence for making primer mte1-70G4 CR339277 Master mix for one PCR reaction




58F2 BES2 1F+1R

Primer name 58F2 BES2 1F Primer sequence 5’-tca acc ctt aat tgc cac ct

TM(℃) 59.43 GC% 45.00 Size 20bp The sequence for making primer mte1-58F2 CR329392

118

Primer name 58F2 BES2 1R

Primer sequence 5’-tgc gtt ttt ggt ccc tta ac

22bp 59.98 GC% 45.00 Size 20bp The sequence for making primer mte1-58F2 CR329392 Master mix for one PCR reaction




12J18 BES2 1F+1R

Primer name 12J18 BES2 1F

Primer sequence 5’-aac acg atg gat cca agt cc

TM(℃) 59.79 GC% 50.00 Size 20bp The sequence for making primer mte1-12J18 CR296244 Primer name 12J18 BES2

1R Primer sequence 5’-gcg ttg tga ata agc ctc ct

22bp 59.34 GC% 50.00 Size 20bp The sequence for making primer mte1-12J18 CR296244 Master mix for one PCR reaction




66K4 BES2 1F+1R

Primer name 66K4 BES2 1F

Primer sequence 5’-tct tct ctc cct ccc cat ct

TM(℃) 60.15 GC% 55.00 Size 20bp The sequence for making primer mte1-66K4 CR335629 Primer name 66K4 BES2

1R Primer sequence 5’-gga cga aga aga agg cta acg

22bp 60.38 GC% 52.38 Size 21bp The sequence for making primer mte1-66K4 CR335629 Master mix for one PCR reaction



119

30sec, repeat 34 times, 72℃ for 5min, 25℃ forever Product Length 120 bp

66K4 BES2 2F+2R


Primer sequence 5’-ttc act agg cta ctt gac caa aaa


2R Primer sequence 5’-tcc ttc atc ttg tgc cct aa





46C14 BES2 1F+1R

Primer name 46C14 BES2 1F

Primer sequence 5’-ctc tcc ccc act tga aat ttt g

TM(℃) 62.01 GC% 45.46 Size 22bp The sequence for making primer mte1-46C14 CR320233 Primer name 46C14 BES2

1R Primer sequence 5’-cct agt gtt gga tgt ttt ggt c

22bp 58.49 GC% 45.46 Size 22bp The sequence for making primer mte1-46C14 CR320233 Master mix for one PCR reaction




120

31K2 BES2 1F+1R


Primer sequence 5’-ctc cta ata ggg cgg att ca


1R Primer sequence 5’-tga ttg cat ggg taa aat tga g





76P21 BES2 1F+1R

Primer name 76P21 BES2 1F

Primer sequence 5’-atc cga caa aat gcc aga ag

TM(℃) 60.07 GC% 45.00 Size 20bp The sequence for making primer mth2-76P21 CG953331 Primer name 31K2 BES2

1R Primer sequence 5’-gat agg ttt cgc gac ttg ga

22bp 60.21 GC% 50.00 Size 22bp The sequence for making primer mth2-76P21 CG953331 Master mix for one PCR reaction




167L23 BES2 1F+1R

Primer name 167L23 BES2 1F

Primer sequence 5’-ggc ttt tcc ctc caa aga tt

TM(℃) 59.53 GC% 45.00 Size 20bp The sequence for making primer mth2-167L23 CR493380

121

Primer name 167L23 BES2 1R

Primer sequence 5’-tgc cag caa aac atg cat ac

22bp 60.68 GC% 45.00 Size 20bp The sequence for making primer mth2-167L23 CR493380 Master mix for one PCR reaction




170M17 BES2 1F+1R

Primer name 170M17 BES2 1F

Primer sequence 5’-cag ctt acc cgt gat tag ca

TM(℃) 58.94 GC% 50.00 Size 20bp The sequence for making primer mth2-170M17 CR495227 Primer name 170M17

BES2 1R Primer sequence 5’-cga act tca cca ccc cta aa

22bp 59.96 GC% 50.00 Size 20bp The sequence for making primer mth2-170M17 CR495227 Master mix for one PCR reaction




164G6 BES2 1F+1R


Primer sequence 5’-atc aac aga atc ggg atg ga

TM(℃) 60.28 GC% 45.00 Size 20bp The sequence for making primer mth2-164G6 CR491095 Primer name 164G6 BES2

1R Primer sequence 5’-cca cag ttg cat caa cca aa

22bp 60.55 GC% 45.00 Size 20bp The sequence for making primer mth2-164G6 CR491095 Master mix for one PCR reaction



122


67O10 BES2 1F+1R

Primer name 67O10 BES2 1F

Primer sequence 5’-cgc agg gta aca gtt tgg at

TM(℃) 59.99 GC% 50.00 Size 20bp The sequence for making primer mth2-67O10 CG958329 Primer name 67O10 BES2

1R Primer sequence 5’-tgg taa tgg ggc ttg aga ag

22bp 60.07 GC% 50.00 Size 20bp The sequence for making primer mth2-67O10 CG958329 Master mix for one PCR reaction




164N9 Marker (h2_164n9a-F)

Primer name h2_164n9a-F Primer sequence 5'-cca ctt ccc aca acc tct gt

TM(℃) 54 GC% 55.00 Size 20bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Primer name h2_164n9a-R Primer sequence 5'-cac cct ttc tgg gtt gag aa 22bp 52 GC% 50.00 Size 20bp The sequence for making primer mth2- 164N9 (mth2- 164P8) AC157646 Master mix for one PCR reaction




123

REFERENCES

Altschul, S. F., Warren Gish, Webb Miller, Eugene W. Myers, and David J. Lipman (1990). "Basic local alignment search tool." J. Mol. Biol. 215: 403-410.

Ardourel, M., N. Demont, et al. (1994). "Rhizobium meliloti lipooligosaccharide nodulation factors: different structural requirements for bacterial entry into target root hair cells and induction of plant symbiotic developmental responses." Plant Cell 6(10): 1357-74.

Brewin, N. J. (1991). "Development of the Legume Root Nodule." Annual Reviews in Cell Biology 7: 191-226.

Brewin, N. J. (2004). "Plant Cell Wall Remodelling in the Rhizobium–Legume Symbiosis." Critical Reviews in Plant Sciences 23(4): 293-316.

Bright, L., Y. Liang, et al. (2005). "The LATD Gene of Medicago truncatula Is Required for Both Nodule and Root Development." Molecular Plant Microbe Interactions 18(6): 521-532.

Catoira, R., C. Galera, et al. (2000). "Four genes of Medicago truncatula controlling components of a Nod factor transduction pathway." Plant Cell 12(9): 1647-66.

Chalhoub, B., H. Belcram, et al. (2004). "Efficient cloning of plant genomes into bacterial artificial chromosome (BAC) libraries with larger and more uniform insert size." Plant Biotechnology 2 (3): 181-188.

Choi, H.-K., D. Kim, et al. (2004). "A sequence-based genetic map of Medicago truncatula and comparison of marker co-linearity with Medicago sativa." Genetics 166: 1463-1502.

Cullimore, J. and J. Dénarié (2003). "How Legumes Select Their Sweet Talking Symbionts." Science 302: 575-578.

Gage, D. J. and W. Margolin (2000). "Hanging by a thread: invasion of legume plants by rhizobia." Current Opinion in Microbiology 3(6): 613-7.

Graham, P. H. and C. P. Vance (2003). "Legumes: importance and constraints to greater use." Plant Physiol. 131(3): 872-877.

Hirsch, A. M. (1992). "Developmental biology of legume nodulation." New Phytologist 122: 211-237.

Kuppusamy, K. T., G. Endre, et al. (2004). "LIN, a Medicago truncatula gene required for nodule differentiation and persistence of rhizobial infections." Plant Physiol. 136: 3682-3691.

Mitra, R., C. Gleason, et al. (2004). " A Ca2+/calmodulin dependent protein kinase required for symbiotic nodule development: Gene identification by transcript-based cloning." Proceedings of the National Academy of Sciences 101: 4701-4705.

124

Mun, J.-H., D.-J. Kim, et al. (2006). "Distribution of Microsatellites in the Genome of Medicago truncatula: A Resource of Genetic Markers That Integrate Genetic and Physical Maps." Genetics 172: 2541-2555.

Mylona, P., K. Pawlowski, et al. (1995). "Symbiotic nitrogen fixation." Plant Cell 7: 869-885.

Nam, Y. W., R. V. Penmetsa, et al. (1999). "Construction of a bacterial artificial chromosome library of Medicago truncatula and identification of clones containing ethylene-response genes." Theoretical and Applied Genetics 98: 638-646.

Oldroyd, G. (2007). "Nodules and Hormones." Science 315: 52-53.

Oldroyd, G. and J. Downie (2004). "Calcium, Kinases and Nodulation Signalling in Legumes." Nature Reviews Molecular Cell Biology 5: 566-576.

Penmetsa, R. and D. Cook (2000). "Production and Characterization of Diverse Developmental Mutants of Medicago truncatula " Plant Physiology 123: 1386-1397.

Penmetsa, R. V. and D. R. Cook (1997). "A legume ethylene-insensitive mutant hyperinfected by Its rhizobial symbiont." Science 275(5299): 527-30.

Penmetsa, R. V., J. A. Frugoli, et al. (2003). "Dual genetic pathways controlling nodule number in Medicago truncatula." Plant Physiol 131(3): 998-1008.

Shizuya, H. (1992). "Cloning and stable maintenance of 300-kilobase-pair fragment of human DNA in Escherichia coli using an F-factor-based vector." Proc Natl Acad Sci U S A. 89(18): 8794-8797.

Szczyglowski, K. and L. Amyot (2003). "Symbiosis, inventiveness by recruitment?" Plant Physiol. 131(3): 935-940.

Vasse, J., F. de Billy, et al. (1990). "Correlation between Ultrastructural Differentiation of Bacteroids and Nitrogen Fixation in Alfalfa Nodules." Journal of Bacteriology 172(8): 4295-4306.

Veereshlingam, H., J. G. Haynes, et al. (2004). "nip, a symbiotic Medicago truncatula mutant that forms root nodules with aberrant infection threads and plant defense-like response." Plant Physiol. 136: 3692-3702.

Veershlingam, H., J. Haynes, et al. (2004). "nip, a Symbiotic Medicago truncatula Mutant that Forms Noot Nodules with Aberrant Infections Threads and Plant Defense-Like Response." Plant Physiology 136: 3692-3702.

Wais, R. J., C. Galera, et al. (2000). "Genetic analysis of calcium spiking responses in nodulation mutants of Medicago truncatula." Proc Natl Acad Sci U S A 97(24): 13407-12.

Young, N. D., S. B. Cannon, et al. (2005). "Sequencing the Genespaces of Medicago truncatula and Lotus japonicus." Plant Physiology 137: 1174-1181.

the nip gene - unt digital library/67531/metadc5152/m2/... · lee, yi-ching. physical map between...

Documents