The Levels of Brachyspira hyodysenteriae Binding to Porcine ColonicMucins Differ between Individuals, and Binding Is Increased toMucins from Infected Pigs with De Novo MUC5AC Synthesis

Macarena P. Quintana-Hayashi,a Maxime Mahu,b Nele De Pauw,b Filip Boyen,b Frank Pasmans,b An Martel,b Pushpa Premaratne,a

Harvey R. Fernandez,a Omid Teymournejad,a Lien Vande Maele,b,c Freddy Haesebrouck,b Sara K. Lindéna

Department of Medical Biochemistry and Cell Biology, Institute of Biomedicine, Sahlgrenska Academy, University of Gothenburg, Gothenburg, Swedena; Department ofPathology, Bacteriology and Avian Diseases, Faculty of Veterinary Medicine, Ghent University, Merelbeke, Belgiumb; Institute for Agricultural and Fisheries Research (ILVO),Melle, Belgiumc

Brachyspira hyodysenteriae colonizes the pig colon, resulting in mucohemorrhagic diarrhea and growth retardation. Fecal mu-cus is a characteristic feature of swine dysentery; therefore, we investigated how the mucin environment changes in the colonduring infection with B. hyodysenteriae and how these changes affect this bacterium’s interaction with mucins. We isolated andcharacterized mucins, the main component of mucus, from the colon of experimentally inoculated and control pigs and investi-gated B. hyodysenteriae binding to these mucins. Fluorescence microscopy revealed a massive mucus induction and disorga-nized mucus structure in the colon of pigs with swine dysentery. Quantitative PCR (qPCR) and antibody detection demonstratedthat the mucus composition of pigs with swine dysentery was characterized by de novo expression of MUC5AC and increasedexpression of MUC2 in the colon. Mucins from the colon of inoculated and control pigs were isolated by two steps of isopycnicdensity gradient centrifugation. The mucin densities of control and inoculated pigs were similar, whereas the mucin quantitywas 5-fold higher during infection. The level of B. hyodysenteriae binding to mucins differed between pigs, and there was in-creased binding to soluble mucins isolated from pigs with swine dysentery. The ability of B. hyodysenteriae to bind, measured inrelation to the total mucin contents of mucus in sick versus healthy pigs, increased 7-fold during infection. Together, the resultsindicate that B. hyodysenteriae binds to carbohydrate structures on the mucins as these differ between individuals. Furthermore,B. hyodysenteriae infection induces changes to the mucus niche which substantially increase the amount of B. hyodysenteriaebinding sites in the mucus.

The gastrointestinal tract is lubricated by a continuously se-creted mucus layer which can also act as a barrier against patho-

gens (1). The main components of the mucus layer are heavily glyco-sylated gel-forming mucins. Mucin glycans can prevent enzymaticdegradation of the mucin protein core and can also bind water,conferring viscoelasticity (2). Beneath the mucus layer, trans-membrane mucins on the mucosal epithelial cells provide barrierand reporting functions (3, 4). Mucins differ in their glycosylationand tissue distribution (5). Murine colonic mucus has been shownto be rich in the MUC2 mucin, which is secreted by goblet cellsand is organized in a two-layered mucus system (6). The innermucus layer is firmly attached to the epithelium and gives rise tothe loosely adherent outer layer (7).

Mucins are a dynamic component of the mucosal barrier andhave been shown to undergo changes in response to intestinalinfection and inflammation in mice (8, 9). Mucin glycan struc-tures can bind bacteria, e.g., Escherichia coli and Helicobacter py-lori, limiting colonization and access to the epithelial surface (3,10–13). Mucin glycosylation can change during bacterial infectionand differs between individuals (14). To date, it is unknownwhether the large variability in mucin expression and mucin gly-cosylation arose by chance during evolution or whether the mucinspecies confer distinct response properties during infection.

Brachyspira hyodysenteriae is a recognized swine pathogen,commonly associated with swine dysentery (SD). This anaerobicspirochete colonizes the large intestine of pigs, resulting in muco-hemorrhagic diarrhea. Ingestion of feces from inoculated pigs, aswell as from asymptomatic carriers, is among the main sources of

infection (15). SD is responsible for economic losses in the swineindustry, posing a threat in countries where antimicrobials arebanned for growth promotion and a challenge where resistantstrains have emerged (16–19). The presence of mucus in the fecesis a characteristic feature of SD. Recently, colonic specimens frompigs with SD were shown to have increased immunohistochemicalstaining with an antibody against the human MUC5AC mucinand decreased staining with an antibody against the MUC4 mucin(20).

B. hyodysenteriae pathogenesis is still surrounded by many un-certainties. The mechanisms underlying the bacterial interactionswith the colonic mucosal surface and how the mucin response

Received 13 December 2014 Returned for modification 9 January 2015Accepted 30 January 2015

Accepted manuscript posted online 2 February 2015

Citation Quintana-Hayashi MP, Mahu M, De Pauw N, Boyen F, Pasmans F, MartelA, Premaratne P, Fernandez HR, Teymournejad O, Vande Maele L, Haesebrouck F,Lindén SK. 2015. The levels of Brachyspira hyodysenteriae binding to porcinecolonic mucins differ between individuals, and binding is increased to mucinsfrom infected pigs with de novo MUC5AC synthesis. Infect Immun 83:1610 –1619.doi:10.1128/IAI.03073-14.

Editor: B. A. McCormick

Address correspondence to Sara K. Lindén, sara.linden@gu.se.

M.M. and N.D.P. contributed equally to this article.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/IAI.03073-14

1610 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

exerted during infection is regulated remain to be elucidated.Therefore, the overall aims of the present study were to investigatehow the mucin environment changes in the swine colon duringinfection with B. hyodysenteriae, whether this bacterium binds tomucins, and, if so, how these changes affect binding. We foundthat B. hyodysenteriae infection causes changes in mucus organi-zation and in the quantity, identity, and expression profile of mu-cin as well as in the mucin-binding ability of this bacterium.

MATERIALS AND METHODSEthics statement. The animal experiments were approved by the ethicalcommittee of the Faculty of Veterinary Medicine, Ghent University(EC2012/01 and EC2013/147), and complied with all ethical and hus-bandry regulations.

Experimental inoculation and sample collection. Samples from a to-tal of 15 pigs (Danish Large White � Piétrain) from two independentinoculation experiments, conducted 21 months apart, were included inthe study (Table 1). The first experiment included 6 control pigs and 6inoculated pigs and the second 8 control pigs and 8 inoculated pigs. Thepigs from both inoculation experiments were 6 weeks old, came from twodifferent commercial farrowing-to-finishing farms in the Flanders regionwith no history of swine dysentery, belonged to different litters, and werefed the same commercial starter feed (Lambers-Seghers, Belgium) (crudeprotein, 17%; crude fat, 6.09%; crude fiber, 3.87%; crude ash, 5.09%;phosphorus, 0.49%; methionine, 0.43%; lysine, 1.25%; calcium, 0.61%;sodium, 0.23%). At their arrival, the pigs were confirmed negative for B.hyodysenteriae in rectal fecal samples by culture and quantitative PCR(qPCR). The pigs were acclimatized for 2 weeks in order to recover fromtransport stress and adapt to diet and housing changes. The pigs were fedtwice per day and had ad libitum access to water. A total of 14 pigs wereexperimentally inoculated with B. hyodysenteriae strain 8dII, isolatedfrom a Belgian swine farm with a history of recent dysentery problems. Aninoculum of 108 CFU/ml in brain heart infusion (BHI) broth (50 ml/pig)was administered orally during three consecutive days, while 14 controlpigs received 50 ml of sterile BHI broth. From the 14 control pigs, 6samples (pigs A to F) were randomly selected for use in this study. Two ofsix pigs from the first infection trial developed SD, and three of eight pigsfrom the second infection trial developed SD (pigs 1 to 5). Samples fromthe four inoculated pigs that did not develop SD in the first inoculationexperiment (pigs 6 to 9) were included in the study (Table 1).

Infection was confirmed based on clinical signs of mucohemorrhagicdiarrhea, and B. hyodysenteriae excretion in feces was detected by qPCR infecal samples obtained twice a week. The pigs were sacrificed at day 40postinoculation by anesthesia with a combination of xylazine (Xyl-M;VMD, Arendonk, Belgium) (2%; 4.4 mg/kg of body weight) andzolazepam-tiletamine (Zoletil 100; Virbac, Carros, France) (2.2 mg/kg),and the final euthanasia procedure was performed by intracardial injec-tion of a formulation comprising embutramide, mebezonium iodide, andtetracaine (T61; Intervet, Brussels, Belgium) at 0.3 ml/kg.

Midsection samples of the spiral colon with a size of 7 by 8 cm wereobtained from the inoculated and control pigs for mucin isolation. Fecalmaterial was removed, and the tissues were rinsed with phosphate-buff-ered saline (PBS) and a protease inhibitor cocktail (Roche Diagnostics,Mannheim, Germany) before snap-freezing and storage at �80°C.Smaller specimens were carefully collected without disturbing the mucuslayer (no washing), immersed in 10 volumes of fresh Carnoy’s methanolfixative (60% dry methanol, 30% chloroform, 10% glacial acetic acid),and embedded in wax for histology-immunohistochemistry. There werealso samples collected in RNAlater (Life Technologies, Carlsbad, CA,USA) and kept at 4°C overnight and then stored at �80°C for RNA ex-traction.

Detection of B. hyodysenteriae in feces by qPCR. DNA from pig feceswas obtained by using a QIAamp DNA stool minikit (Qiagen, CA, USA),starting from 1 g of feces. For qPCR, Brachyspira-specific primers wereused in combination with a B. hyodysenteriae-specific probe as previouslydescribed (21).

MUC2 and MUC5AC immunofluorescence. Tissue sections weredeparaffinized, and antigen retrieval was performed using 10 mM sodiumcitrate (pH 6.0) at 99°C for 30 min. Slides were cooled to room tempera-ture and washed in PBS. Nonspecific background was blocked with aserum-free protein block (Dako, Carpinteria, CA, USA) for 20 min. Pri-mary antibodies anti-MUC2C3 (kindly provided by G. Hansson, Univer-sity of Gothenburg, Gothenburg, Sweden), anti-MUC5AC (45M1;Sigma-Aldrich, St. Louis, MO, USA), and anti-MUC5CR (kindly pro-vided by G. Hansson, University of Gothenburg, Gothenburg, Sweden)were diluted 1/1,000 and incubated at 4°C overnight. Sections werewashed with PBS and incubated with secondary antibodies conjugatedwith Alexa Fluor 488 (Life Technologies, Eugene, OR, USA) for MUC2and Alexa Fluor 594 for MUC5AC, diluted 1/500 for 1 h. After washes inPBS, specimens were mounted with ProLong antifade containing DAPI(4=,6-diamidino-2-phenylindole) (Life Technologies, Eugene, OR, USA).

TABLE 1 Experimental design and data from B. hyodysenteriae-inoculated and control pigsa

Treatment group and pig ID(s)(expt no.)

Sample(s)analyzedb

Start of clinicalsigns (dpi)

No. of days fromstart of clinicalsigns to necropsy

Clinical signsat day ofnecropsy

B. hyodysenteriaein feces the dayof necropsy

Macroscopicsigns of SDat necropsy

Histologicalsigns of SDat necropsy

Inoculated with B. hyodysenteriae1 (2) Yes 39 1 Yes Yes Yes Yes2 (2) Yes 29 11 Yes Yes Yes Yes3 (1) Yes 12 28 Noc Yes Yes Yes4 (1) Yes 15 25 Yes Yes Yes Yes5 (2) Yes 29 11 Yes Yes Yes Yes6 (1) Yes No SD NA No No No No7 (1) Yes No SD NA No No No No8 (1) Yes No SD NA No No No No9 (1) Yes No SD NA No No No No10–14 (1, 2) No No SD NA No No No No

ControlsA–F (1, 2) Yes NA NA No No No NoG–N (1, 2) No NA NA No No No No

a ID, identifier; expt no., 1st infection trial (1) or 2nd infection trial (2) or both (1, 2); dpi, days postinoculation; SD, swine dysentery, NA, not applicable.b Inoculated pigs without clinical signs of SD and control pigs were randomly selected to match the number of pigs with clinical signs of SD.c Pig 3 presented clinical signs of mucoid hemorrhagic diarrhea before sacrifice and severe necrotic lesions in the colon at necropsy.

B. hyodysenteriae Binding to Porcine Colonic Mucins

April 2015 Volume 83 Number 4 iai.asm.org 1611Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Pig and human gastric specimens were used as positive controls forMUC5AC staining. Similarities in the stomach and colon binding pat-terns indicated that the staining of pig sections was specific, even thoughthe antibodies were raised against human mucins.

qPCR for mucin expression. Pig colon tissue samples were immedi-ately submerged in a 10-fold volume of RNAlater (Life Technologies,Carlsbad, CA, USA) at 4°C overnight and frozen at �80°C until RNAextraction. Isolation of RNA was performed using TRIzol (Life Technol-ogies, Carlsbad, CA, USA) according to the manufacturer’s instructions.RNA yield and purity were assessed through UV spectroscopy (Nano-Drop; Thermo Scientific, MA, USA). Total RNA (5 �g) was DNase treatedat 37°C for 45 min, followed by the addition of 5 mM EDTA and heatinactivation of DNase at 75°C for 10 min prior to cDNA synthesis. MgCl2was added to achieve a 5 mM final concentration, and this RNA was usedfor cDNA synthesis with random hexamers and Superscript III (LifeTechnologies, Carlsbad, CA, USA) at 50°C for 2 h. The cDNA was used ina real-time PCR using SYBR green (Power SYBR green mix; Life Technol-ogies, Carlsbad, CA, USA) and the primers listed in Table 2. The primersfor pig MUC1, MUC2, and MUC5AC mucin genes were designed usingthe Primer3 program (available at http://frodo.wi.mit.edu/primer3/).qPCR data were normalized using the expression levels of ACTB and RPL4reference genes (22). Samples were amplified in triplicate, and a negativecontrol without reverse transcriptase was included to verify the absence ofcontaminating genomic DNA. Data acquisition and analysis were per-formed using CFX manager 3.1 software (Bio-Rad Laboratories Inc., Her-cules, CA, USA).

Mucin isolation and purification. Mucin isolation of colon tissuesamples was performed by isopycnic density gradient centrifugation aspreviously described (23), obtaining guanidinium hydrochloride(GuHCl)-soluble and “insoluble” mucins. Briefly, frozen tissues weredrenched with 10 mM sodium phosphate buffer (pH 6.5) containing 0.1mM phenylmethylsulfonyl fluoride (AppliChem, Darmstadt, Germany).Once thawed, the mucosal surfaces were scraped with a microscope slide,dispersed with a Dounce homogenizer, and stirred slowly overnight at 4°Cin ice-cold extraction buffer consisting of 6 M GuHCl (AppliChem,Darmstadt, Germany), 5 mM EDTA (Sigma-Aldrich, St. Louis, MO,USA), 5 mM N-ethylmaleimide (Alfa Aesar, Karlsruhe, Germany), and 10mM sodium dihydrogen phosphate at pH 6.5. GuHCl-soluble mucinswere obtained after centrifugation at 23,000 � g for 50 min at 4°C, and theremaining material was reextracted twice by stirring overnight at 4°C inextraction buffer. The remaining pellets contained the insoluble mucins,which were solubilized with 10 mM dithiothreitol (DTT) in reductionbuffer (6 M GuHCl, 5 mM EDTA, 0.1 M Tris-HCl, pH 8) for 5 h at 37°C.Finally, residues were alkylated overnight with 25 mM iodoacetamide(IAA; Alfa Aesar, Karlsruhe, Germany).

Both the GuHCl-soluble material and the insoluble material were di-

alyzed in 10 volumes of extraction buffer at 4°C, changing the dialysissolution three times in 24 h. An isopycnic density gradient centrifugationusing cesium chloride (CsCl)– 4 M GuHCl with a starting density of 1.39g/ml was performed at 40,000 rpm for 90 h. The mucin-containing frac-tions were pooled and further purified from DNA by the use of a secondgradient in CsCl– 0.5 M GuHCl. Approximately 25 mucin fractions wererecovered per sample using a fraction collector equipped with a dropcounter. Fractions were stored at 4°C until further analysis.

Analysis of mucin fractions. The first and second CsCl gradient mu-cin fractions were analyzed as follows. The mucin density was determinedby weighing a known volume using a Carlsberg pipette as a pycnometer;results were expressed as g/ml. Levels of DNA contamination of mucinswere determined using a spectrophotometer. A microtiter-based assaydetecting carbohydrates as periodate-oxidizable structures (24) was per-formed in order to determine the glycan content in the GuHCl-solubleand insoluble mucin samples. Briefly, Nunc 96-well plates (Thermo Sci-entific, Waltham, MA, USA) were coated overnight at 4°C with mucinfractions diluted in 4 M and 0.5 M GuHCl. Plates were incubated with a 25mM sodium (meta)periodate solution diluted in sodium acetate (NaAc)for 20 min and blocked with 50 mM Tris-HCl, 0.15 M NaCl, 90 �M CaCl2,4 �M EDTA, 0.01% NaN3, and 2% bovine serum albumin at pH 8 for 1 h.The wells were then incubated for 1 h with a biotin hydrazide solutiondiluted 1/50 in NaAc, followed by europium (Eu)-labeled streptavidindiluted 1/1,000 in Delfia assay buffer (PerkinElmer, Waltham, MA, USA).Finally, plates were incubated with Delfia enhancement solution for 5 minon a shaker. Between steps, the plates were washed three times with asolution containing 5 mM Tris-HCl, 0.15 M NaCl, 0.005% Tween 20, and0.01% NaN3, at pH 7.75, except for the final step, where plates werewashed six times. The signal was measured in a Wallac 1420 Victor2 mi-croplate reader (PerkinElmer, Waltham, MA, USA) by time-resolved flu-orometry.

MUC5AC and MUC2 ELISA. Mucin fractions were diluted in 0.5 MGuHCl and coated overnight at 4°C onto 96-well plates (Nunc, ThermoScientific). For MUC2 detection, samples were reduced with 80 �l of 2mM DTT diluted in buffer (6 M GuHCl, 5 mM EDTA, 0.1 M Tris-HCl,pH 8.0) at 37°C for 1 h. On top of the previous solution, 20 �l of 5 mMIAA was added, and the mixture was incubated for 1 h in the dark. Plateswere washed three times with PBS containing 0.05% Tween 20 (PBS-T)and blocked for 1 h with 1% blocking reagent for an enzyme-linked im-munosorbent assay (ELISA) (Roche Diagnostics, Basel, Switzerland) in amixture containing 0.05% Tween 20, followed by incubation with pri-mary antibodies anti-MUC5CR and anti-MUC2C3 (both kindly pro-vided by G. Hansson, University of Gothenburg, Gothenburg, Sweden)diluted 1/1,000. Three more washes with PBS-T were performed beforeand after wells were incubated with a horseradish peroxidase (HRP)-con-jugated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove,PA, USA) diluted 1/10,000 for 1 h. Subsequently, 100 �l of tetramethyl-benzidine substrate (Sigma-Aldrich, St. Louis, MO, USA) was added perwell, and the reaction was stopped with an equivalent volume of 0.5 MH2SO4. Absorbance at 450 nm was measured in a Wallac 1420 Victor2

plate reader. The 45M1 antibody (Sigma-Aldrich, St. Louis, MO, USA)was used to confirm the specificity of the MUC5AC signal from the iso-lated mucins obtained with the anti-MUC5CR antibody, verifying thesignal obtained with the soluble but not the insoluble mucins. As a result,we performed a range of control analyses with and without reduction andalkylation of the mucin samples, and we concluded that the absence ofMUC5AC signal in the insoluble mucins in the experiments using the45M1 antibody was due to the destruction of the epitope recognized bythis antibody after reduction and alkylation. Thus, we are convinced thatthe MUC5AC signal is specific, although the antibodies were designed todetect human mucins.

Bacterial strain and culture conditions. B. hyodysenteriae strain 8dIIwas cultured on tryptone soy agar (TSA; Thermo Fischer Scientific, Wal-tham, MA, USA) plates supplemented with 5% sheep blood (ThermoFischer Scientific, Waltham, MA, USA), 0.1% yeast extract (Merck,

TABLE 2 List of primers used in qPCR

Target Direction Sequence (5=–3=)Source orreference

MUC1 Forward TCCGACCCGGGATGCCTACCA This studyReverse GGCTGCCCCCACCGTTGCCT This study

MUC2 Forward CCTTGCTCTCGTGTGGAACA This studyReverse ACTTCTCCTCGGGCTTGTTG This study

MUC5AC Forward TGCGCCGTGCCACGCGGAGAT This studyReverse GCGGGGCAGGGGAAGGGGCA This study

ACTB Forward CACGCCATCCTGCGTCTGGA 22Reverse AGCACCGTGTTGGCGTAGAG 22

RPL4 Forward CAAGAGTAACTACAACCTTC 22Reverse GAACTCTACGATGAATCTTC 22

Quintana-Hayashi et al.

1612 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Darmstadt, Germany), 400 �g/ml spectinomycin, 25 �g/ml colistin, and25 �g/ml vancomycin (AppliChem, Darmstadt, Germany) at 40°C underanaerobic conditions.

Mucin sample preparation and concentration estimation. Gradientfractions containing mucins were pooled to obtain one sample for eachgradient (i.e., two [one insoluble and one soluble] from each pig). Mucinconcentrations in pooled samples were determined by serial dilutions aswell as by the use of a standard curve of a fusion protein of the mucinMUC1, consisting of 16TR and IgG2a Fc (25), starting at a concentrationof 20 mg/ml and using seven 1:2 serial dilutions in a carbohydrate detec-tion assay as described above. The mucin concentrations were calculatedfrom the standard curve. Setting the concentration based on the glycancontent appears most appropriate, as bacterium-mucin interactionslargely occur via the mucin glycans (14). Although this is not an absolutemeasure of a concentration, it can be used to ensure that the mucins are atthe same concentration for comparative assays. The concentration of mu-cin can also be determined by freeze-drying. However, not all of the mu-cins come into solution after freeze-drying; therefore, this method of con-centration determination can result in large errors as well as in theselective removal of mucin species.

Binding of B. hyodysenteriae to pig mucins. White 96-well plates(Corning Life Sciences, NY, USA) were coated overnight at 4°C with 6�g/ml mucins in 0.5 M GuHCl. Wells were washed three times withPBS-T and blocked with 200 �l of 5% fetal bovine serum (FBS) for 1 h.Bacteria were harvested from TSA plates (as described above), washed inPBS, centrifuged at 2,500 � g for 5 min, and resuspended in PBS–5% FBS.A bacterial suspension (100 �l) diluted to108 bacterial cells/ml was addedper well, and the plates were shaken during incubation for 2 h at 40°C in ananaerobic environment. Plates were washed three times with PBS-T andonce with PBS. Subsequently, 100 �l of PBS was added to each well,followed by the addition of an equal volume of BacTiter-Glo reagent(Promega, Madison, WI, USA). Incubation proceeded for 5 min at roomtemperature. Relative luminescence unit (RLU) was measured in an Infi-nite M200 microplate reader (Tecan, Männedorf, Switzerland) with anintegration time of 1,000 ms per well. Controls included wells without thebacteria (PBS only) in mucin-coated wells and in non-mucin-coated wellsincubated with the bacterial suspension followed by addition of PBS andreagent. In order to confirm that the differences in B. hyodysenteriae bind-ing to pig mucins were not due to variations in the mucin glycan contentbetween samples, plates for a glycan detection assay (described above)were simultaneously coated and the assay was performed with the bindingexperiments. Only samples with a glycan value of 17,000 to 24,000 Eucounts were included to ensure that the analysis occurred within the linearrange of the assay, and the B. hyodysenteriae binding signal was normal-ized to the glycan value for that particular coating and mucin combina-tion. Results were obtained from three independent experiments with fivetechnical replicates for each mucin, and data were plotted as relative lu-minescence units per glycan unit.

Statistical analysis. Statistical analysis was performed using Graph-Pad Prism version 6 software (La Jolla, CA, USA). Results are expressed asmeans � standard errors of the means (SEM) for normally distributeddata and as medians with interquartile ranges (IQR) for data that did notfollow a normal distribution (determined using the D’Agostino-Pearsonomnibus test). Data were analyzed using the Mann-Whitney test, theKruskal-Wallis test, or one-way analysis of variance (ANOVA) whereverapplicable, and P values of �0.05 were considered statistically significant.

RESULTSClinical signs, bacterial shedding, and histology after experi-mental inoculation. Five inoculated pigs excreted B. hyodysente-riae in their feces and developed clinical signs of SD, includingmucoid or hemorrhagic diarrhea. A milder case of diarrhea wasobserved in one of the five pigs with clinical signs of SD. Themajority of the pigs had acute dysentery at the time of sacrifice(Table 1). Pig 4 had a longer duration of dysentery; however, the

clinical signs did not change during the 25-day period, and themacroscopic lesions corresponded with those of acute dysentery.Pig 3 had recovered from clinical signs before the day it was eu-thanized. Fecal shedding of B. hyodysenteriae by the inoculatedpigs that developed SD started simultaneously with the onset ofclinical signs and continued until the time of sacrifice. The controlpigs did not excrete B. hyodysenteriae in their feces and did notpresent any clinical signs of SD at any time point during the ex-periment. In line with previous reports (20, 26), severe lesionswere observed in the colon of pigs with acute dysentery, includingnecrotic colitis, hyperemic mucosa, and fluid content with largeamounts of mucus. Microscopically, the mucosa of pigs with SDhad a thickened mucus layer (Fig. 1), the epithelium containedabundant goblet cells, and the colonic crypts were elongated, di-lated, and filled with mucus and cell debris. Inflammatory cellswere observed in the lamina propria, consisting of lymphocytes,plasma cells, and transmigrating neutrophils. The pigs in the con-trol group, as well as the inoculated pigs that did not develop SD,had no significant histopathological lesions.

Colonic mucus disorganization during swine dysentery is ac-companied by de novo expression of MUC5AC and increasedexpression of MUC2. Fluorescence microscopy of the pig colontissue revealed that the mucus layer in the healthy pig colon, in-cluding in the colon of the inoculated pigs that did not developSD, was organized in striations parallel to the mucosa and con-sisted mainly of the MUC2 mucin (Fig. 1A to C), similarly to themucus structure reported for the mouse colon (2, 27). In contrast,during infection with B. hyodysenteriae, a massive increase inMUC2 levels and de novo production of MUC5AC was observedin the four inoculated pigs with severe clinical signs of dysentery(Fig. 1D to F). MUC5AC expression was not observed by immu-nofluorescence in the inoculated pig with milder clinical signs ofdysentery. Both MUC2 and MUC5AC were produced by gobletcells, and when MUC5AC was present in a goblet cell, it was usu-ally present in a cell that also produced MUC2 (Fig. 1D and E). Inaddition to the massive increase in mucus layer thickness thatoccurred in dysenteric pigs, the mucus organization was vastlychanged by infection, as the striated organization was lost and themucus appeared instead to flow in “rivers” with eukaryotic cells inbetween, often at a 45° angle from the mucosa.

The antibodies used have previously been shown to detect theirspecific targets in humans and mice (27, 28), but no MUC2 orMUC5AC antibodies have been verified for use in pigs. To becertain that the stain represented MUC5AC and MUC2, we con-firmed that the antibodies we used for the immunofluorescenceindeed bound to the isolated mucins in specific manners that dif-fered between the antibodies (Fig. 2A and B). The specificity of theMUC5AC antibody was further supported by the use of a secondantibody; both MUC5AC antibodies followed a tissue distributionin the porcine stomach analogous to the distribution observed inthe human stomach and murine stomach. In addition, we de-signed qPCR primers specific for swine MUC2 and MUC5AC and,indeed, the mRNA levels of MUC2 and MUC5AC increased 4-foldand more than 15-fold, respectively, in the colon tissue of pigswith clinical signs of SD compared to the levels in the tissue fromthe control pigs (Fig. 3). The expression of MUC5AC was notupregulated in the colon tissue of the inoculated pig with milderclinical signs of dysentery. The mRNA levels of MUC1, a mucingene whose expression is induced during some bacterial infections

B. hyodysenteriae Binding to Porcine Colonic Mucins

April 2015 Volume 83 Number 4 iai.asm.org 1613Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

in the mouse (3, 11), did not increase in the pigs with SD com-pared to the controls (Fig. 3).

Swine dysentery is associated with a 5-fold increase in mucincontent. Mucins from B. hyodysenteriae-inoculated and control

pigs were isolated from the colonic mucus and analyzed in orderto determine changes in their composition during infection. Mu-cins were extracted as previously described (23), and GuHCl-sol-uble and insoluble mucins were obtained. Although the insoluble

FIG 1 Colon tissue sections from control and B. hyodysenteriae-inoculated pigs stained for MUC2 and MUC5AC. Immunofluorescence of MUC2 (green) andMUC5AC (red) in colon tissue counterstained with DAPI (blue) is shown. Panels A to C show the striated organization of the mucus in the colon of control pigsalong with expression of MUC2. In contrast, panels D to F show a disorganized mucus barrier with de novo expression of MUC5AC and increased expression ofMUC2 in the colon of pigs with clinical signs of SD.

FIG 2 MUC5AC and MUC2 content in the colon of B. hyodysenteriae-inoculated pigs. (A) The peak of antibody reactivity to MUC5AC and MUC2 coincidedwith the glycan detection peak in GuHCl-soluble mucin fractions isolated from a B. hyodysenteriae-inoculated pig with clinical signs of SD. (B) The mucinpopulation of one pig was more heterogeneous with distinctly different mucin peaks, demonstrating that the antibodies against MUC2 and MUC5AC recognizedifferent mucins. (C and D) MUC5AC (C) and MUC2 (D) antibody reactivity to GuHCl-soluble and insoluble mucins isolated from B. hyodysenteriae-inoculated pigs that developed SD (1, pig 1; 2, pig 2; 3, pig 3; 4, pig 4; 5, pig 5), inoculated pigs that did not develop SD, and control pigs. Results are expressedas the median with interquartile range. *, P � 0.05 (Kruskal-Wallis test with Dunn’s correction for multiple comparisons).

Quintana-Hayashi et al.

1614 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

mucins were ultimately solubilized by reduction in DTT, they arereferred to here as “insoluble.” During isopycnic density gradientcentrifugation, molecules concentrate as bands where the mole-cule density matches the density of the surrounding solution. Asmucins are highly glycosylated, and sugars have a high density,

density gradient centrifugation separates mucins from the less gly-cosylated nonmucin molecules. The initial CsCl– 4 M GuHClisopycnic density gradient procedure rendered the isolated mu-cins free of nonmucin proteins; however, they were contaminatedwith DNA (Fig. 4A). Therefore, a second CsCl– 0.5 M GuHClgradient procedure was performed in all the samples, ensuringremoval of DNA contamination (Fig. 4B). The median mucindensity of the inoculated pigs was 1.527 g/ml (IQR � 0.015). Nodifferences in mucin density between inoculated and control pigswere noted (P � 0.05) (Fig. 4D). Quantification of mucins basedon their carbohydrate content revealed that the pig colon mucinsof both B. hyodysenteriae-inoculated and control pigs were mainlyinsoluble, with less than 20% of the mucins being soluble inGuHCl (Fig. 4C). Pigs with clinical signs of SD had 5-fold-highermucin content (P � 0.05) than the controls (Fig. 4C). The amountof mucins isolated from control pigs was similar to the mucincontent of samples from the inoculated pigs that did not developSD (P � 0.9) (Fig. 4C).

In most density gradient samples, MUC5AC and MUC2 anti-body reactivity coincided with the glycan peak (Fig. 2A), althoughthere were differences in the MUC2 and MUC5AC curves in onesample, demonstrating that the antibodies indeed recognized dif-ferent mucins (Fig. 2B). MUC5AC was present in the GuHCl-soluble material and the insoluble material in similar proportions(45% and 55%, respectively) (Fig. 2C). Mucins from the pigs withSD contained more MUC5AC than the mucins from the controls

FIG 3 MUC5AC, MUC2, and MUC1 mRNA expression in B. hyodysenteriae-inoculated and control pigs. Data represent normalized fold expression levelsof MUC5AC, MUC2, and MUC1 mRNA in the colon tissue of B. hyodysente-riae-inoculated pigs with clinical signs of SD and controls determined by qPCRanalysis. Expression data were normalized to ACTB and RPL4 reference genes.Fold changes were calculated using the threshold cycle (CT) method. Re-sults are expressed as medians with interquartile ranges. *, P � 0.05; **, P �0.005 (Mann-Whitney test).

FIG 4 Isolation, density, and glycan content of colonic mucins from B. hyodysenteriae-inoculated and control pigs. (A) Mucin fractions were recovered from thedensity gradients and analyzed for their glycan content. Here, a representative sample of soluble mucins isolated from a B. hyodysenteriae-inoculated pig withclinical signs of SD after the first gradient in CsCl– 4 M GuHCl (starting density of 1.39 g/ml) shows that low-density nonmucin proteins (A280) are excluded fromthe pooled mucin fractions. Bar, pooled mucin fractions 2 to 7. (B) Representative sample of soluble mucins isolated from a control pig, showing baselineseparation between the glycan peak and DNA after a second gradient in CsCl– 0.5 M GuHCl (starting density, 1.5 g/ml). Bar, pooled mucin fractions 1 and 2. (C)Glycan content of GuHCl-soluble and insoluble mucins isolated from inoculated pigs with clinical signs of SD (1, pig 1; 2, pig 2; 3, pig 3; 4, pig 4; 5, pig 5),inoculated pigs that did not develop SD, and control pigs. The mucin content in the colon was 5-fold higher in inoculated pigs with clinical signs of SD than inthe controls. (D) Density (g/ml) of GuHCl-soluble and insoluble mucins isolated from control and B. hyodysenteriae-inoculated pigs (with and without clinicalsigns of SD), showing no differences between the groups. Results are expressed as medians with interquartile ranges. *, P � 0.05 (Kruskal-Wallis test with Dunn’scorrection for multiple comparisons).

B. hyodysenteriae Binding to Porcine Colonic Mucins

April 2015 Volume 83 Number 4 iai.asm.org 1615Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

and the mucins from the inoculated pigs that did not develop SD(P � 0.05) (Fig. 2C). In line with the immunofluorescence andqPCR results, the pig with mild clinical signs of SD had the lowestlevel of MUC5AC antibody reactivity. Both GuHCl-soluble andinsoluble mucins contained MUC2, with the majority (80% to90%) of MUC2 present as insoluble mucin. In line with the im-munofluorescence and qPCR results, the MUC2 protein level wasalso increased in pigs with SD compared to the controls and com-pared to the inoculated pigs that did not develop SD (P � 0.05)(Fig. 2D).

Increased ability of B. hyodysenteriae to bind to colonic mu-cins from pigs with clinical signs of swine dysentery. B. hyo-dysenteriae bound to colonic mucins isolated from both controland inoculated pigs. The patterns of B. hyodysenteriae binding tomucins differed between individual pigs (insoluble mucins, over-all P � 0.0001; soluble mucins, overall P � 0.0001) (Fig. 5A). Thissuggests that B. hyodysenteriae has an adhesin that recognizes aspecific glycan structure(s), as bacterial adhesins usually recognizethese, and that the mucin glycans differ between individuals (24).The level of B. hyodysenteriae binding per mucin glycan unit tosoluble mucins from pigs with clinical signs of SD was higher thanthat seen with the controls (P � 0.0001), and a similar trend wasobserved for the insoluble mucins (P � 0.0595) (Fig. 5B). Al-though B. hyodysenteriae bound more to the soluble mucins iso-lated from pig 3 than to the soluble mucins isolated from otherpigs with clinical signs of SD (Fig. 5A), the overall binding differ-ence between control and inoculated pig mucins remained statis-tically significant (P � 0.0002) even after excluding the pig 3 data.Taking into account the fact that the total mucin content isolatedfrom pigs with clinical signs of SD was higher than the mucincontent isolated from healthy pigs, the ability of B. hyodysenteriaeto bind to mucins from pigs with clinical signs of SD increased7-fold (P � 0.005) (Fig. 5C).

DISCUSSION

The present report provides new insights into the composition ofpig colonic mucins during health and disease as well as into mucininteractions with B. hyodysenteriae. The insights resulted from val-idation, optimization, and generation of methods and tools that

now can be specifically applied to the swine host. We demon-strated changes in the mucus environment of the swine colonduring infection with B. hyodysenteriae, evidenced by disorga-nized mucus and a much thicker mucus layer as well as by 5-fold-higher mucin content, accompanied by de novo MUC5AC synthe-sis. We identified that B. hyodysenteriae bound to swine colonicmucins in manners that differed between individuals and mucinpopulations and that the levels increased with infection. As a resultof these changes, the altered mucin environment provided morebacterial binding sites, increasing the overall binding ability of B.hyodysenteriae to colonic mucus 7-fold.

Successful isolation of mucins involves the removal of low-density nonmucin proteins as well as DNA contaminants. Purecolonic mucins, soluble and insoluble in GuHCl, were obtained bytwo isopycnic density gradient centrifugation steps in CsCl withdifferent GuHCl molarities, as previously described (29). As in thecase of human colonic mucus (30), we reported a higher contentof insoluble mucins than of mucins soluble in guanidinium in thepig. Mucins are large molecules that form complex networks byconnecting the mucin subunits via disulfide bonds. It has beensuggested that the higher content of insoluble mucins in the colondenotes the presence of more covalent bonds, indicating the needfor further solubilization by reduction (30). The density we ob-served for pig colonic mucins was higher than the density (1.38g/ml) previously reported for human colonic mucins (30). Sincehuman MUC2 and pig MUC2 are highly homologous and sincehuman glycosylation is similar in monosaccharide composition topig glycosylation, differences in density are likely to mainly reflectdifferences in the extent of glycosylation. Thus, pig colonic mu-cins appear to be more heavily glycosylated than the human coun-terparts. The main carbohydrates that compose glycoproteinsboth in humans and in pigs are glucosamine, galactosamine, ga-lactose, fucose, and sialic acid (30–32).

Besides lubricating the intestinal surface for the transit of thefecal bolus, goblet cell-secreted mucus protects the surface epithe-lium from bacterial invasion. The mucus layer of healthy pigs wasconstituted mainly of MUC2 mucin, organized in a striated fash-ion perpendicular to the mucosal surface, similarly to the mucuscomposition of the mouse colon (6). During B. hyodysenteriae

FIG 5 Binding of B. hyodysenteriae to colonic mucins. (A) Binding pattern of B. hyodysenteriae to soluble and insoluble mucins isolated from controls (pigs Ato F) and inoculated pigs with clinical signs of SD (pigs 1 to 5). Results are expressed as the means � SEM of the results of technical replicates. *, P � 0.05; ****,P � 0.0001 (one-way ANOVA, with Tukey’s correction for multiple comparisons). (B) B. hyodysenteriae binding to soluble and insoluble mucins isolated fromcontrols and pigs with SD, showing higher binding to the soluble mucins isolated from pigs with clinical signs of SD than to those isolated from the control group.Results are expressed as medians with interquartile ranges. ****, P � 0.0001 (Mann-Whitney test). (C) Binding ability of B. hyodysenteriae relative to the totalmucin content observed in pigs with SD (1, pig 1; 2, pig 2; 3, pig 3; 4, pig 4; 5, pig 5) and control pigs (i.e., binding to mucin at a set concentration � the totalamount of mucin recovered from that sample). Results are expressed as medians with interquartile ranges. **, P � 0.005 (Mann-Whitney test). Data shown arerepresentative of the results of three independent experiments.

Quintana-Hayashi et al.

1616 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

infection, we found a loss of the striated organization and a sub-stantial increase in MUC2 and de novo secretion of MUC5ACmucins. We recently reported dynamic changes in the mucus bar-rier during Citrobacter rodentium infection in mice, with struc-tural loss and decrease of the inner mucus layer at the onset andmiddle time points of infection (27). However, during the clear-ance phase, the mucus layer thickness increased but had an orga-nization similar to that seen in uninfected mice, and no Muc5acwas detected (27). The changes observed in B. hyodysenteriae-in-fected pigs are thus completely different from any of the mucuschanges identified during C. rodentium infection and clearance.

MUC2 and MUC5AC are both gel-forming mucins secreted bygoblet cells. The MUC2 mucin is predominantly secreted in theintestine. There is evidence from Muc2 knockout mice that thelack of Muc2 increases the susceptibility to Salmonella and C. ro-dentium infections (33, 34). Unlike MUC2, MUC5AC does notform part of the normal mucin repertoire in the colon. Instead, itis commonly found in the normal gastric mucosa (5), airway ep-ithelium (35), and conjunctiva (36). MUC2 and MUC5AC mRNAlevels were increased in the colon tissue of pigs with clinical signsof swine dysentery compared to the levels in the control pigs,demonstrating that the mucus change is regulated at the transcrip-tional level, in contrast to the increases in mucus thickness seen inC. rodentium infection without changes in mRNA levels (27). Ad-ditionally, the fact that MUC1 expression was not increased in theinoculated pigs compared to the controls further supports theconclusion that B. hyodysenteriae infection has an effect on mucinregulation different from that seen in the C. rodentium model,where Muc1 levels are increased (27). Similarly to our results,expression of MUC5AC and MUC2 in rabbit ileal loops inocu-lated with Shigella flexneri and Shigella dysenteriae has been de-scribed (37). In addition, Muc5ac expression is increased in miceinfected with the intestinal nematode Trichuris muris (38). In pigs,immunohistochemical staining with an antibody against humanMUC5AC has indicated that the level of this mucin is increasedduring infection with Salmonella enterica serovar Typhimurium(39), while MUC5AC mRNA levels were elevated during infectionwith Trichuris suis (40). During nematode infection, Muc5ac in-duction has a protective role in mice, decreasing nematode bur-den and viability (41). Moreover, Muc5ac deficiency hampers theclearance of the parasite, increasing the susceptibility to chronicinfection (41). Altered mucin expression in the colon of pigs withSD was first reported by Wilberts et al., after immunohistochem-ical staining with an antibody against human MUC5AC indicatedits presence in pigs with acute dysentery following inoculationwith B. hyodysenteriae or “B. hampsonii” (20), suggesting a com-mon mucin response in the colon during infection with thesepathogens. Our results suggest that during infection, de novo se-cretion of MUC5AC in the colon could depend on the stage of thedisease, as it was not detected in the pig sacrificed 1 day after theonset of clinical signs, which presented with only mild diarrhea.Furthermore, the similar mucin profiles of the inoculated pigs thatdid not develop SD and the control pigs suggest that de novo se-cretion of MUC5AC in the colon depends on the ability of thebacterium to colonize the host. Further experiments are requiredto determine whether the de novo MUC5AC secretion plays a pro-tective role during B. hyodysenteriae infection in the pig.

Successful colonization of the host by enteric pathogens in-volves penetration of the mucus layer overlying the epithelium.Genomic evidence shows that B. hyodysenteriae carries genes as-

sociated with potential virulence factors involved in motility, che-motaxis, and tissue injury by proteases and hemolysins that, ifexpressed, could facilitate colonization of the colon (42). Thus far,the importance of motility and chemotaxis in B. hyodysenteriaecolonization has not been thoroughly demonstrated. A strongchemotactic response to pig mucins and components such as fu-cose and serine has been described (43, 44), although decreasedattraction to mucins at concentrations greater than 6% has alsobeen reported (45). Colonization of the gastrointestinal tract canalso be mediated by bacterial adhesion to carbohydrate structuressuch as blood group antigens that act as receptors. For example, H.pylori strains that express the BabA adhesin bind to the Lewis bblood group antigen expressed in the human gastric mucosa, re-sulting in blood group- and strain-dependent binding (46), andthe FedF adhesin expressed in F18-fimbriated E. coli binds to gly-cosphingolipids isolated from intestinal epithelium of bloodgroup A and O pigs (47). AO blood group antigens are expressedin the pig intestine, with a predominance of blood group A (48);thus, individual pigs carry different glycan structures in their in-testines. Here we showed that B. hyodysenteriae bound to mucinsfrom all pigs in the study but that the levels of binding per mucinglycan unit differed between the mucin populations and with dis-ease status. Given that other infections have been previouslyshown to induce changes in mucin glycosylation (49), it is likelythat the differences in the levels of B. hyodysenteriae binding reflectdifferences in the pig-mucin glycan repertoire rather than differ-ences in the mucin density or in the extent of glycosylation.

Mucins from pigs with clinical signs of SD bound more B.hyodysenteriae than mucins from the control pigs. During infec-tion, the mucin secretion potentially provides distinct carbohy-drate structures for B. hyodysenteriae binding. The mucous nicheis very unstable, and pathogen binding to mucins may prevent themore intimate adherence that can occur between the pathogenand, for example, glycolipids of the cell membrane. Indeed, mucinbinding to the human gastric pathogen H. pylori acts as a decoyand prevents prolonged adherence (13). Furthermore, in the rhe-sus monkey model of H. pylori infection, animals with mucins thatbind H. pylori more effectively have a lower H. pylori density intheir stomachs, indicating that mucin binding to H. pylori aids inremoving the bacteria from the gastric niche (49). However, it isnot certain if these principles apply to B. hyodysenteriae; the mas-sively thick disorganized mucus layer may not be as unstable as anormal mucus layer, and there is a possibility that the protectivefunction of the mucus changes under these conditions. B. hyo-dysenteriae may indeed induce these mucus changes to create amore favorable niche instead.

In conclusion, B. hyodysenteriae bound to mucins from all pigsin manners that differed between the mucin populations and in-creased with SD. Together with the massive mucus induction anddisorganization that occurred during infection, this demonstratesthe presence of major changes in the colon mucus niche during B.hyodysenteriae infection.

ACKNOWLEDGMENTS

This work was supported by the Swedish Research Council Formas (grantno. 221-2011-1036 and 221-2013-590), the Swedish Research Council(grant no. 521-2011-2370 and 522-2007-5624), The Swedish CancerFoundation, Ragnar Söderbergs Stiftelser, the Jeansson Foundation, andthe Institute for the Promotion of Innovation by Science and Technology

B. hyodysenteriae Binding to Porcine Colonic Mucins

April 2015 Volume 83 Number 4 iai.asm.org 1617Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

in Flanders (IWT Vlaanderen), Brussels, Belgium (grant IWT LO100850).

The funders had no role in the study design, data collection and anal-ysis, decision to publish, or preparation of the manuscript.

REFERENCES1. McGuckin MA, Linden SK, Sutton P, Florin TH. 2011. Mucin dynamics

and enteric pathogens. Nat Rev Microbiol 9:265–278. http://dx.doi.org/10.1038/nrmicro2538.

2. Johansson ME, Sjovall H, Hansson GC. 2013. The gastrointestinal mu-cus system in health and disease. Nat Rev Gastroenterol Hepatol 10:352–361. http://dx.doi.org/10.1038/nrgastro.2013.35.

3. McAuley JL, Linden SK, Png CW, King RM, Pennington HL, GendlerSJ, Florin TH, Hill GR, Korolik V, McGuckin MA. 2007. MUC1 cellsurface mucin is a critical element of the mucosal barrier to infection. JClin Invest 117:2313–2324. http://dx.doi.org/10.1172/JCI26705.

4. Singh PK, Hollingsworth MA. 2006. Cell surface-associated mucins insignal transduction. Trends Cell Biol 16:467– 476. http://dx.doi.org/10.1016/j.tcb.2006.07.006.

5. Nordman H, Davies JR, Lindell G, de Bolos C, Real F, Carlstedt I. 2002.Gastric MUC5AC and MUC6 are large oligomeric mucins that differ insize, glycosylation and tissue distribution. Biochem J 364:191–200.

6. Johansson ME, Phillipson M, Petersson J, Velcich A, Holm L, HanssonGC. 2008. The inner of the two Muc2 mucin-dependent mucus layers incolon is devoid of bacteria. Proc Natl Acad Sci U S A 105:15064 –15069.http://dx.doi.org/10.1073/pnas.0803124105.

7. Atuma C, Strugala V, Allen A, Holm L. 2001. The adherent gastrointes-tinal mucus gel layer: thickness and physical state in vivo. Am J PhysiolGastrointest Liver Physiol 280:G922–G929.

8. Lindén SK, Florin TH, McGuckin MA. 2008. Mucin dynamics in intes-tinal bacterial infection. PLoS One 3:e3952. http://dx.doi.org/10.1371/journal.pone.0003952.

9. Boltin D, Perets TT, Vilkin A, Niv Y. 2013. Mucin function in inflam-matory bowel disease: an update. J Clin Gastroenterol 47:106 –111. http://dx.doi.org/10.1097/MCG.0b013e3182688e73.

10. Sando L, Pearson R, Gray C, Parker P, Hawken R, Thomson PC,Meadows JR, Kongsuwan K, Smith S, Tellam RL. 2009. Bovine Muc1 isa highly polymorphic gene encoding an extensively glycosylated mucinthat binds bacteria. J Dairy Sci 92:5276 –5291. http://dx.doi.org/10.3168/jds.2009-2216.

11. McGuckin MA, Every AL, Skene CD, Linden SK, Chionh YT, SwierczakA, McAuley J, Harbour S, Kaparakis M, Ferrero R, Sutton P. 2007.Muc1 mucin limits both Helicobacter pylori colonization of the murinegastric mucosa and associated gastritis. Gastroenterology 133:1210 –1218.http://dx.doi.org/10.1053/j.gastro.2007.07.003.

12. Parker P, Sando L, Pearson R, Kongsuwan K, Tellam RL, Smith S. 2010.Bovine Muc1 inhibits binding of enteric bacteria to Caco-2 cells. Glyco-conj J 27:89 –97. http://dx.doi.org/10.1007/s10719-009-9269-2.

13. Linden SK, Sheng YH, Every AL, Miles KM, Skoog EC, Florin TH,Sutton P, McGuckin MA. 2009. MUC1 limits Helicobacter pylori infec-tion both by steric hindrance and by acting as a releasable decoy. PLoSPathog 5:e1000617. http://dx.doi.org/10.1371/journal.ppat.1000617.

14. Linden SK, Sutton P, Karlsson NG, Korolik V, McGuckin MA. 2008.Mucins in the mucosal barrier to infection. Mucosal Immunol 1:183–197.http://dx.doi.org/10.1038/mi.2008.5.

15. Songer JG, Harris DL. 1978. Transmission of swine dysentery by carrierpigs. Am J Vet Res 39:913–916.

16. Hidalgo A, Carvajal A, Vester B, Pringle M, Naharro G, Rubio P. 2011.Trends towards lower antimicrobial susceptibility and characterization ofacquired resistance among clinical isolates of Brachyspira hyodysenteriaein Spain. Antimicrob Agents Chemother 55:3330 –3337. http://dx.doi.org/10.1128/AAC.01749-10.

17. Sperling D, Smola J, Cizek A. 2011. Characterisation of multiresistantBrachyspira hyodysenteriae isolates from Czech pig farms. Vet Rec 168:215.http://dx.doi.org/10.1136/vr.c4247.

18. Rohde J, Kessler M, Baums CG, Amtsberg G. 2004. Comparison of methodsfor antimicrobial susceptibility testing and MIC values for pleuromutilindrugs for Brachyspira hyodysenteriae isolated in Germany. Vet Microbiol102:25–32. http://dx.doi.org/10.1016/j.vetmic.2004.03.023.

19. Alvarez-Ordonez A, Martinez-Lobo FJ, Arguello H, Carvajal A, RubioP. 2013. Swine dysentery: aetiology, pathogenicity, determinants of trans-

mission and the fight against the disease. Int J Environ Res Public Health10:1927–1947. http://dx.doi.org/10.3390/ijerph10051927.

20. Wilberts BL, Arruda PH, Kinyon JM, Madson DM, Frana TS, BurroughER. 27 February 2014, posting date. Comparison of lesion severity, distri-bution, and colonic mucin expression in pigs with acute swine dysenteryfollowing oral inoculation with “Brachyspira hampsonii” or Brachyspirahyodysenteriae. Vet Pathol http://dx.doi.org/10.1177/0300985813516646.

21. Song Y, Hampson DJ. 2009. Development of a multiplex qPCR for de-tection and quantitation of pathogenic intestinal spirochaetes in the faecesof pigs and chickens. Vet Microbiol 137:129 –136. http://dx.doi.org/10.1016/j.vetmic.2008.12.020.

22. Nygard AB, Jorgensen CB, Cirera S, Fredholm M. 2007. Selection ofreference genes for gene expression studies in pig tissues using SYBR greenqPCR. BMC Mol Biol 8:67. http://dx.doi.org/10.1186/1471-2199-8-67.

23. Nordman H, Davies JR, Herrmann A, Karlsson NG, Hansson GC,Carlstedt I. 1997. Mucus glycoproteins from pig gastric mucosa: identi-fication of different mucin populations from the surface epithelium.Biochem J 326(Pt 3):903–910.

24. Skoog EC, Sjoling A, Navabi N, Holgersson J, Lundin SB, Linden SK.2012. Human gastric mucins differently regulate Helicobacter pylori pro-liferation, gene expression and interactions with host cells. PLoS One7:e36378. http://dx.doi.org/10.1371/journal.pone.0036378.

25. Bäckström M, Link T, Olson FJ, Karlsson H, Graham R, Picco G,Burchell J, Taylor-Papadimitriou J, Noll T, Hansson GC. 2003. Recom-binant MUC1 mucin with a breast cancer-like O-glycosylation producedin large amounts in Chinese-hamster ovary cells. Biochem J 376:677– 686.http://dx.doi.org/10.1042/BJ20031130.

26. Jacobson M, Fellstrom C, Lindberg R, Wallgren P, Jensen-Waern M. 2004.Experimental swine dysentery: comparison between infection models. J MedMicrobiol 53:273–280. http://dx.doi.org/10.1099/jmm.0.05323-0.

27. Gustafsson JK, Navabi N, Rodriguez-Pineiro AM, Alomran AH, Pre-maratne P, Fernandez HR, Banerjee D, Sjovall H, Hansson GC, LindenSK. 2013. Dynamic changes in mucus thickness and ion secretion duringCitrobacter rodentium infection and clearance. PLoS One 8:e84430. http://dx.doi.org/10.1371/journal.pone.0084430.

28. Navabi N, McGuckin MA, Linden SK. 2013. Gastrointestinal cell linesform polarized epithelia with an adherent mucus layer when cultured insemi-wet interfaces with mechanical stimulation. PLoS One 8:e68761.http://dx.doi.org/10.1371/journal.pone.0068761.

29. Fogg FJ, Hutton DA, Jumel K, Pearson JP, Harding SE, Allen A. 1996.Characterization of pig colonic mucins. Biochem J 316(Pt 3):937–942.

30. Herrmann A, Davies JR, Lindell G, Mårtensson S, Packer NH, SwallowDM, Carlstedt I. 1999. Studies on the “insoluble” glycoprotein complexfrom human colon. Identification of reduction-insensitive MUC2oligomers and C-terminal cleavage. J Biol Chem 274:15828 –15836.

31. Marshall T, Allen A. 1978. The isolation and characterization of thehigh-molecular-weight glycoprotein from pig colonic mucus. Biochem J173:569 –578.

32. Podolsky DK, Isselbacher KJ. 1983. Composition of human colonicmucin. Selective alteration in inflammatory bowel disease. J Clin Invest72:142–153.

33. Zarepour M, Bhullar K, Montero M, Ma C, Huang T, Velcich A, Xia L,Vallance BA. 2013. The mucin Muc2 limits pathogen burdens and epi-thelial barrier dysfunction during Salmonella enterica serovar Typhimu-rium colitis. Infect Immun 81:3672–3683. http://dx.doi.org/10.1128/IAI.00854-13.

34. Bergstrom KS, Kissoon-Singh V, Gibson DL, Ma C, Montero M, ShamHP, Ryz N, Huang T, Velcich A, Finlay BB, Chadee K, Vallance BA.2010. Muc2 protects against lethal infectious colitis by disassociatingpathogenic and commensal bacteria from the colonic mucosa. PLoSPathog 6:e1000902. http://dx.doi.org/10.1371/journal.ppat.1000902.

35. Hovenberg HW, Davies JR, Herrmann A, Linden CJ, Carlstedt I. 1996.MUC5AC, but not MUC2, is a prominent mucin in respiratory secretions.Glycoconj J 13:839 – 847. http://dx.doi.org/10.1007/BF00702348.

36. Inatomi T, Spurr-Michaud S, Tisdale AS, Zhan Q, Feldman ST, GipsonIK. 1996. Expression of secretory mucin genes by human conjunctivalepithelia. Invest Ophthalmol Vis Sci 37:1684 –1692.

37. Radhakrishnan P, Halagowder D, Devaraj SN. 2007. Altered expressionof MUC2 and MUC5AC in response to Shigella infection, an in vivo study.Biochim Biophys Acta 1770:884 – 889. http://dx.doi.org/10.1016/j.bbagen.2007.01.019.

38. Hasnain SZ, Wang H, Ghia JE, Haq N, Deng Y, Velcich A, Grencis RK,Thornton DJ, Khan WI. 2010. Mucin gene deficiency in mice impairs

Quintana-Hayashi et al.

1618 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

host resistance to an enteric parasitic infection. Gastroenterology 138:1763–1771. http://dx.doi.org/10.1053/j.gastro.2010.01.045.

39. Kim CH, Kim D, Ha Y, Cho KD, Lee BH, Seo IW, Kim SH, Chae C.2009. Expression of mucins and trefoil factor family protein-1 in the colonof pigs naturally infected with Salmonella typhimurium. J Comp Pathol140:38 – 42. http://dx.doi.org/10.1016/j.jcpa.2008.10.002.

40. Kringel H, Iburg T, Dawson H, Aasted B, Roepstorff A. 2006. A timecourse study of immunological responses in Trichuris suis infected pigsdemonstrates induction of a local type 2 response associated with wormburden. Int J Parasitol 36:915–924. http://dx.doi.org/10.1016/j.ijpara.2006.04.008.

41. Hasnain SZ, Evans CM, Roy M, Gallagher AL, Kindrachuk KN, BarronL, Dickey BF, Wilson MS, Wynn TA, Grencis RK, Thornton DJ. 2011.Muc5ac: a critical component mediating the rejection of enteric nema-todes. J Exp Med 208:893–900. http://dx.doi.org/10.1084/jem.20102057.

42. Bellgard MI, Wanchanthuek P, La T, Ryan K, Moolhuijzen P, AlbertynZ, Shaban B, Motro Y, Dunn DS, Schibeci D, Hunter A, Barrero R,Phillips ND, Hampson DJ. 2009. Genome sequence of the pathogenicintestinal spirochete Brachyspira hyodysenteriae reveals adaptations to itslifestyle in the porcine large intestine. PLoS One 4:e4641. http://dx.doi.org/10.1371/journal.pone.0004641.

43. Kennedy MJ, Yancey RJ, Jr. 1996. Motility and chemotaxis in Serpulina

hyodysenteriae. Vet Microbiol 49:21–30. http://dx.doi.org/10.1016/0378-1135(95)00174-3.

44. Milner JA, Sellwood R. 1994. Chemotactic response to mucin by Ser-pulina hyodysenteriae and other porcine spirochetes: potential role in in-testinal colonization. Infect Immun 62:4095– 4099.

45. Naresh R, Hampson DJ. 2010. Attraction of Brachyspira pilosicoli to mucin.Microbiology 156:191–197. http://dx.doi.org/10.1099/mic.0.030262-0.

46. Lindén S, Nordman H, Hedenbro J, Hurtig M, Boren T, Carlstedt I.2002. Strain- and blood group-dependent binding of Helicobacter pylori tohuman gastric MUC5AC glycoforms. Gastroenterology 123:1923–1930.http://dx.doi.org/10.1053/gast.2002.37076.

47. Coddens A, Diswall M, Angstrom J, Breimer ME, Goddeeris B, Cox E,Teneberg S. 2009. Recognition of blood group ABH type 1 determinantsby the FedF adhesin of F18-fimbriated Escherichia coli. J Biol Chem 284:9713–9726. http://dx.doi.org/10.1074/jbc.M807866200.

48. King TP, Kelly D. 1991. Ontogenic expression of histo-blood groupantigens in the intestines of suckling pigs: lectin histochemical and immu-nohistochemical analysis. Histochem J 23:43–54. http://dx.doi.org/10.1007/BF01886507.

49. Lindén S, Mahdavi J, Semino-Mora C, Olsen C, Carlstedt I, Boren T,Dubois A. 2008. Role of ABO secretor status in mucosal innate immunityand H. pylori infection. PLoS Pathog 4:e2. http://dx.doi.org/10.1371/journal.ppat.0040002.

B. hyodysenteriae Binding to Porcine Colonic Mucins

April 2015 Volume 83 Number 4 iai.asm.org 1619Infection and Immunity

on April 13, 2018 by guest

http://iai.asm.org/

Dow

nloaded from