the journal of biological chemistry val. 36, 25, … · the journal of biological chemistry 0 1992...

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The American Society for Biochemistry and Molecular Biology, Inc

Val. 267, No 36, Issue of ' December 25, PP. 25690-25696,1992 Printed in U. S. A.

Heterologous Expression, Purification, and Biochemistry of the Oligomycin Sensitivity Conferring Protein (OSCP) from Yeast*

(Received for publication, June 22, 1992)

Arindam Mukhopadhyay, Xue-qiong Zhou, Misook Uh, and David M. MuellerS From the The University of Health Sciences, The Chicago Medical School, Department of Biological Chemistry, North Chicago, Illinois 60064

Yeast Saccharomyces cereuisiae oligomycin sensitivity conferring proteins (OSCP) have been expressed in Escherichia coli. Heterologous expression results in production of a protein that is identical to yeast mature OSCP, including the absence of the initiating methionine residue. Yeast OSCP expressed in E. coti has been purified to homogeneity and it is able to reconstitute oligomycin-sensitive ATPase using purified F1- and F1/ OSCP-depleted membranes (electron transport particles (ETP)). Binding of F1 to ETP is dependent on the addition of OSCP. Binding studies using 35S-OSCP indicate that OSCP binds to ETP with a Kd of 200 nM and a capacity of 420 pmol/mg particle protein, whereas OSCP does not interact with F1 in the absence of ETP. These data indicate that yeast OSCP must first form a specific complex with Fo, which then binds F1 forming the functional complex.

To identify functional domains in yeast OSCP, two deletion mutants have been made. Antibodies directed to these deletion products do not inhibit OSCP-dependent binding of F1 to ETP. However, antibodies directed against the last one-third of OSCP greatly reduce the oligomycin sensitivity of the reconstituted ATPase. These data suggest that OSCP is involved in a functional role in energy transduction or proton translo- cation and serves a structural role in the yeast mitochondrial ATP synthase.

The yeast mitochondrial ATP synthase is a multimeric protein with a calculated molecular mass of about 580,000 daltons (1). The ATP synthase can be separated into two portions, a water soluble F,-ATPase and an integral membrane F, portion. F, has the composition, a&y&, and an overall molecular mass of about 360,000 daltons (1-6). The Fa portion is composed of at least three different subunits, subunits a, b, and c with a less well defined stoichiometry (3, 7).

The F, is bound to Fo by a number of possible proteins, including subunit 4, F6, and the oligomycin sensitivity conferring protein (OSCP)' (8-12). The Fs protein, although shown

*This work was supported by Grant DMB-9020248 from the National Science Foundation, by a grant-in-aid from the American Heart Association and with funds contributed in part by the American Heart Association of Metropolitan Chicago, and by Grant 1ROlGM44412-01 from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "adver- tisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ To whom correspondence should be addressed. The abbreviations used are: OSCP, oligomycin sensitivity confer-

ring protein (subunit 5 of the ATP synthase); F1, water-soluble portion of the ATP synthase; Fo, membrane portion of the ATP synthase; IPTG, isopropyl P-D-thiogalactopyranoside; PMSF, phenylmethylsulfonyl fluoride; PEG, polyethylene glycol.

to be essential in bovine ATP synthase (12, 131, has not yet been identified in yeast, making its role in the ATP synthase uncertain. The role of OSCP in the ATP synthase is also uncertain. Although it is clear that reconstitution of the ATP synthase requires OSCP, it is not clear if OSCP serves any- thing more than a structural role. Does OSCP also participate in a functional role either by a direct method, transferring protons from Fa to F,, or by an indirect method, transducing the energy of the proton gradient to a conformational high energy state which is then passed onto F1?

This study provides information on the structure and function of yeast OSCP. Yeast OSCP has been expressed and radiolabeled with ["Slcysteine in Escherichia coli, purified, and demonstrated to be functional. Direct binding studies have been performed with 35S-OSCP, ETP, and F,. Two deletion mutants have been made that dissect OSCP. Studies with these deletion mutant proteins and antibodies directed against them provide evidence that OSCP serves a functional role, as well as the structural role, in the ATP synthase.

EXPERIMENTAL PROCEDURES

Strains and Growth Media-Yeast D-273-10B (Mata, ATCC 24567) was used throughout in this study. The bacterial hosts used for cloning and expression of OSCP and the deletion products are HMS174 (F- recA rKIZ- mKI2+ Rip) and BL21(DE3) (F- ompT rB- me-) (14). Yeast were grown in semi-synthetic galactose medium (15) a t room temperature. For expression of OSCP, bacteria were grown in minimal medium with 100 pg/ml ampicillin at 37 "C. Transfor- mation of E. coli was performed by the RbCl method (16).

Isolation of F1-ATPase and ETP-Mitochondrial membranes were isolated from yeast using glass beads as described (17). F1-ATPase was purified as described (17) with the addition of 20% glycerol to all the solutions until the enzyme was eluted off the DE23 column. The ATPase had a specific activity of over 120 pmol/min/mg of protein. This was stored at 4 "C in 70% saturated ammonium sulfate. Before use, F,-ATPase was centrifuged in a microcentrifuge a t 15,000 X g, dissolved in the desired buffer, and passed through a centrifuge column equilibrated with the desired buffer. Electron transport particles were prepared as described (18) and stored a t -80 "C in 0.25 M sucrose, 10 mM Tris acetate, pH 7.5, a t 10 mg protein/ml.

Expression of OSCP, NB, and BB in E. coli-The gene coding for OSCP, ATP5, has been described earlier (19). For expression of OSCP in E. coli, the T7 expression system of Studier was used (14). To express OSCP in the T7 system, a number of site-directed mutations were made in the ATP5 gene. Fig. 1 illustrates the amino acid and DNA sequence of the ATP5 gene and the T7 expression vector, pet3a, in the area of interest. Since expression of mature OSCP was desired, it was necessary to modify the ATP5 gene to eliminate the first 17 amino acids that code for the leader sequence. In addition, it was

cloning of the gene into pET3a. Both of these goals were achieved by necessary to create a restriction endonuclease site that would allow

introduction an NheI site by the replacement of TC to AG, as shown in boldface. This allowed ligation of the NheI site directly into the NheI site of the T7 expression vector. A second restriction endonuclease site, BglII, was created at the 3' end of ATP5 to direct it into the BamHI site of pET3a. A third site-directed mutation was performed to eliminate the Hind111 site at position 468. This makes the

25690

Yeast OSCP 25691

HindIII site a t position 37 unique and thereby helps in future sub- cloning. The resulting modified ATP5 gene is referred to as NHBATP5. The T7 expression system for expression of OSCP was made by cloning the NheI-BglII restriction fragment from NHBATP5 into pet3aARV after digestion with NheI and BamHI. The vector pet3aARV was made by removing the EcoRV fragment from pet3a (14), creating a vector that has a unique NheI site. These clones were confirmed by restriction map analysis and is referred as pet- NHBATP5.

For expression of deletion mutant, NB, NHBATP5 was digested with NheI and BamHI. The restriction fragment was cloned into pet3aARV after digestion with NheI and BamHI. The resulting clone is referred to as petNB. Expression of petNB results in synthesis of the first 129 amino acids of mature OSCP (195 amino acids) with the addition of the peptide Asp-Pro-Ala-Ala at the carboxyl terminus which was derived from pet3a. For expression of BB, the BamHI- BglII restriction fragment of pNHBATP5 was ligated into pet3b after digestion with BamHI. The correct orientation and identity was confirmed by restriction map analysis. The resulting clone is referred to as petBB. Expression of petBB results in the expression of the last 66 amino acids of OSCP with the addition of 12 amino acids at the amino terminus which was derived from pet3b.

Plasmids petNHBOSCP, petNB, andpetBB were transformed into BL21(DE3). For expression, cells were grown at 37 "C in M9 media with 100 pg/ml ampicillin to an OD600 reached 0.6. Isopropyl 8 - D - thiogalactopyranoside (IPTG) was added to 0.5 mM, and the cells were shaken for an additional 4 h. The cells were harvested by centrifugation, washed in cold water, and stored a t -80 "C until used.

Purification of OSCP and BB-Cells were stored after induction with IPTG from a 1-liter culture were thawed and suspended in 40 ml of 10% sucrose, 50 mM Tris-C1, pH 8.0, 0.15 M NaCl, 0.3 mg/ml

to 10 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM PMSF in lysozyme. The cells were incubated on ice for 1 h and then adjusted

dimethly sulfoxide, 1 pg/ml leupeptin, 1 pg/ml pepstatin a, and 0.1% Triton X-100. The cells were mixed well and incubated on ice for 10 min. To this suspension, 0.5 volumes of 1 M sodium phosphate, pH 8.0, was added. The suspension was sonicated on ice three times for 1 min, with 1-min breaks. The suspension was centrifuged a t 100,000 X g for 30 min a t 4 "C.

The supernatant was collected and adjusted to 25% saturated ammonium sulfate with the addition of solid ammonium sulfate. The solution was clarified by centrifugation a t 10,000 rpm in the SS-34 rotor and filtered through Whatman filter paper. The solution was adjusted to 60% saturated ammonium sulfate and centrifuged as above. For purification of BB, the pellet was dissolved in 8 mM Hepes, pH 6.9, 0.4 mM EDTA, 0.2 mM EGTA, 0.01% Tween 20, 1 mM dithiothreitol, 1 mM PMSF, 1 pg/ml leupeptin, and 1 pg/ml pepstatin a. This was taken directly to the carboxymethylcellulose column described below. For purification of OSCP, the pellet was dissolved in 21 ml of 20 mM Tris acetate, pH 7.5, 0.7 M NaCl, 0.01% Tween 20, 1 mM dithiothreitol, 1 mM PMSF, 1 pg/ml leupeptin, and 1 pg/ml pepstatin a. To this, PEG 400 (9 ml) was added, and the solution was incubated for 30 min on ice. The solution was centrifuged for 30 min a t 18,000 rpm and the supernatant saved. Cold ethanol (10 ml) was added dropwise, and the solution was incubated on ice for 30 min and centrifuged as above. The supernatant was saved and stored on ice. The pellet was suspended in 8 mM Hepes, pH 6.9,0.4 mM EDTA, 0.2 mM EGTA, 0.01% Tween 20, 1 mM dithiothreitol, 1 mM PMSF, 1 pg/ml leupeptin, and 1 pg/ml pepstatin a (10 ml) and dialyzed overnight in 6,000-8,000 molecular weight cutoff dialysis tubes. After dialysis, nearly all of the precipitate was dissolved. The remaining that was not dissolved was removed by centrifugation. This pellet was combined with the pellet that was obtained from the centrifugation of the alcoholic solution that was stored overnight on ice. This pellet was suspended in 10 ml of the Hepes buffer solution and dissolved by the addition of solid urea to about 30%. This solution was dialyzed overnight as in the Hepes buffer solution. OSCP that was dissolved in urea and renatured had identical biochemical properties as OSCP not denatured in urea.

The solutions containing OSCP and BB were applied to a 1.5 X 8- cm carboxymethylcellulose column equilibrated with the Hepes buffer solution. The column was washed with buffer (100 ml) and eluted with a 0-0.5 M NaCl gradient in the Hepes buffer solution (50 ml). OSCP and BB elute in the middle or early part of the gradient. The peak was determined by AzBo.,,,, and the peak fraction was collected, concentrated in an AMICON centricon 10, and the product precipitated by the addition of ammonium sulfate to 60% saturation.

Recently, the purification of OSCP has been modified to increase

the ease and yield of OSCP. The method was identical up to and including the precipitation step with PEG 400. After this step, the purification was identical to that presented for the purification of 35S- OSCP, described below.

sitive ATPase was reconstituted with F,-ATPase and ETP essentially Reconstitution of Oligomycin-sensitiue ATPase-Oligomycin-sen-

as described (18, 20). ETP (90 pg) were incubated for 30 min at 30 "C with F, (40 pg) and varying amounts of OSCP in 0.25 M sucrose, 50 mM Tris acetate, 5% glycerol, 1 mM ATP, 0.5 mM EDTA, and 0.02% Tween 20, pH 7.5 (R-buffer) in a total volume of 0.2 ml. The samples were centrifuged for 5 min in a microcentrifuge, and the particles were washed with 0.25 M sucrose, 50 mM Tris acetate, 0.5 mM EDTA, pH 7.5, (0.5 ml) and suspended in 20 pl of the same buffer. F, was prepared as described above and desalted using a spin column (21) before use. ATPase activity was measured by the coupled enzyme reaction (22) in the presence and absence of 10 pg of oligomycin.

Site-directed Mutagenesis-Oligonucleotide site directed mutagenesis was performed by the method of Kunkel (23). ATP5 was cloned into M13 mp18 (16) to obtain single-stranded template. Three rounds of mutagenesis were performed. After each round, the entire gene was sequenced using the dideoxy method (24) to ensure that no other mutations were present. The tl-.ree oligonucleotides used were

ACTCGTTTGZnd GGATTGAAAAGGCTTTcAGC;wh&e t5e underlined nucleotides represents the variants bases. These oligonucleotides were used to create the NheI, the BglII, and eliminate the internal HindIII restriction sites, respectively. Oligonucleotides were synthesized and purified as described (17).

In Vivo Radiolabeling of OSCP, NB, and BB-Deletion products, NB and BB, and OSCP were radiolabeled in uiuo using [?3]rnethio- nine (1,000 Ci/mmol, 10 mCi/ml) and [35S]cysteine (1,300 Ci/mmol, 10 mCi/ml). Cells were grown in M9 media (3.0 ml) to an ODw of 0.6, IPTG was added to 0.5 mM, and the cells were incubated for 1 h a t 37 "C with shaking. Rifampacin (200 pg/ml) was added, and the cells were incubated for 1.5 h as above and then 4 p1 of [35S]cysteine or ["S]methionine was added. The cells were shaken overnight at 37 "C, collected by centrifugation, suspended in sample buffer for electrophoresis, and stored at -20 "C until use.

Purification of 35S-OSCP-The cells from a 50-ml culture were radiolabeled, collected, and lysed as described above. 35S-OSCP was purified as described above up to an including precipitation with PEG. At this point, the solution was clarified by centrifugation and dialyzed with Spectra/Por CE 100,000 membranes. These membranes were demonstrated to retain OSCP in equilibrium dialysis studies even though OSCP is only 21,000 daltons. The solution was loaded directly onto the carboxymethylcellulose column, eluted as described above, and fractions containing 35S-OSCP were pooled and adjusted to 5 M NaC1. This solution was applied to a 3-ml butyl-agarose column equilibrated with the same buffer. 35S-OSCP escapes from the column as radioactively and chemically pure. The solution was dialyzed against 8 mM Hepes, 0.5 mM EDTA, 0.25 mM EGTA, pH 7.3, and concentrated using an AMICON centricon 10. The solution was stored on ice until it was ready for use.

Binding of "sSs-OSCP to ETP and F,-Radiolabeled OSCP with ["S]cysteine typically yield a specific activity of 3 X IO6 cpm/mg protein. Equilibrium binding studies with F, and "S-OSCP were performed using 0.2-ml chambers (InstruMed, Union Bridge, MD) and Spectra/Por CE 300K membranes. Equilibrium dialysis was performed in 50 mM Tris acetate, 2.0 mM ATP, 1.0 mM EDTA, 1 mg/ ml lysozyme with 36 pg/ml F, in the lower chamber and "S-OSCP (up to 35 pg/ml a t 38,000 cpm/mg protein ) in the upper chamber. The reaction was shaken for 36 h at room temperature, and samples from the upper and lower chambers were measured for radioactivity. During this time, F, showed no loss in activity and did not cross the membrane. Alternatively, '"S-OSCP was added to both chambers with F, added to the upper chamber and the reaction shaken for 12 h. Both of these conditions allowed equilibration of %OSCP across the membrane. The studies indicated that "5s-OSCP did not bind to F1. As a positive control, E T P was added in addition to F, or antiserum directed against OSCP were added. In both cases, 'j's- OSCP concentrated in the appropriate chamber.

Binding of "S-OSCP to E T P was performed essentially as described by Dupuis and Vignais (20). ETP (10 mg protein/ml) were prepared using NaBr and ammonium hydroxide as described by Tzagoloff (18) and stored a t -80 "C until used. E T P were prepared by diluting them with 8 volumes of R-buffer. The suspension was centrifuged for 3 min in a microcentrifuge (15,000 X g), and the pellet was suspended in R-buffer to 75% of its initial volume. F1-ATPase,

GCTGCTGCTAGCAAAGCTGC, ATATAGTTAGATCTGGTCG-

25692 Yeast OSCP stored in 70% ammonium sulfate, was centrifuged for 10 min in a microcentrifuge, the pellet dissolved in R-buffer, and placed on a centrifuge column containing Sephadex G-50 and equilibrated with R-buffer. OSCP and 3sSs-OSCP (5 X lo6 cpm/mg) was prepared as described and diluted to the desired concentration. For the binding reaction, 95 pg of ETP protein, 0.125-27.6 pg of ”S-OSCP, and when indicated, 40 pg of F1 were incubated in R-buffer (0.2 ml) for 30 min. at 30 “C. The solution was centrifuged for 3 min a t 15,000 X g a t 4 “C, and 0.1 ml of the supernatant (free OSCP) was taken in Budgetsolve scintillation mixture (Research Products International, Mount Pros- pect, IL). The pellet (bound OSCP) was suspended in R-buffer (0.1 ml), assayed for protein by the bicinchoninic acid (BCA) method (25), and 0.075 ml counted as described above. The data was plotted and analyzed using the ligand binding-1 site with background routine of GraFit (26). The data weighting was set as simple and robust.

Preparation of Antiserum-Antiserum made against OSCP was described previously (19). For antiserum against BB, purified BB (1- 5 pg) was dissolved in sterile normal saline, mixed well with complete Freund‘s adjuvent, and injected intradermally into rabbits. After 3-4 weeks, BB (1 pg) in normal saline was injected into the ear vein and repeated after 4 weeks. Serum was collected at various times throughout the procedure.

Protein Determination, Protein Gel Electrophoresis, and Western Blot Analysis-Protein was determined by one of two methods. For determination of soluble protein, the Bradford method was utilized except that Serva Blue G (Serva, Westbury, NY) was used (25). For determination of particle protein, the BCA method was utilized (25). In both cases, bovine serum albumin served as the standard. SDS- polyacrylamide gel electrophoresis was performed by the method of Laemmali (27) using a 12.5% acrylamide. For autoradiography, the gel was dried after the staining process. XAR-5 film was exposed to the gel for the indicated time at room temperature. Western blot analysis was performed as described (28). The samples were detected using Vectastain (Vector Laboratories, Burlingame, CA) which uses biotinylated horseradish peroxidase, biotinylated anti-rabbit IgG, and avidin DH for the cross-linkage.

Protein Sequencing-Protein sequencing was performed using a Biosearch gas phase sequencer. For analysis of OSCP isolated from E. coli, OSCP was desalted by reverse phase high performance liquid chromatography. For analysis of OSCP from yeast mitochondria, yeast F1-Fo ATP synthase was purified (29) and the subunits separated by SDS-gel electrophoresis and electrotransferred to ProBlott (Applied Biosystems). Subunit 5 of the ATP synthase was sequenced directly on the ProBlott paper.

RESULTS

The vector used for expression of yeast OSCP in E. coli, the changes made in OSCP to effect the expression, and the purification scheme of OSCP are described under “Experi- mental Procedures.” Fig. 1 illustrates that expression of OSCP in pet3a should result in mature OSCP with the possible addition of an initiating Met on the amino end. Expression of OSCP is induced by the addition of IPTG which turns on the expression of the T7 RNA polymerase gene (14). Time analysis of OSCP production after addition of IPTG indicated that the greatest level of expression occurred 3-5 h after -

6 1 Met Ala Ser net Thr Gly Gly Gln Gln Met Gly Ar9 CAT ATG ATG ACT GGT GGA CAG W ATG GGT CGC

NheI B r n I

AmiroTaminutdYcutCmdBovineCC) ’

YOSCP: m R w T m F A s S L 3 ’ w P P V

BOSCP: ~VSGLSaOVRCFSTSVVRPFAK-LVRPPV : :..:. .. ... . ...

-manucpaeirunmbsc

+16 GCT GCT GCT TCC M GCT GCT GCT wud*prqocacO A111 Ala Ala Ser LIS Ala Ala Ala GCT GCT AAA GCT GCT GCT O l m p ( B 0 l d )

NheI

FIG. 1. Constructs used to express yeast OSCP in E. coli. Two changes were made in the nucleotide sequence (boldface) to provide a unique NheI restriction site. This allows the insertion of the OSCP gene in frame with the T7 transcription-translation vector. The expressed protein is predicted to correspond exactly with yeast mature OSCP with the single addition of a Met at the amino terminus.

induction with IPTG (data not shown). Typically, cells were collected after 4 h of induction with IPTG for purification of OSCP.

SDS-gel electrophoresis of the protein fractions during the purification is shown in Fig. 2. Amino-terminal sequence analysis on the purified product indicates that the initiating Met was removed in E. coli (data not shown). Amino acid terminal sequence analysis of OSCP purified from yeast mitochondria gives the same sequence as that determined for the recombinant OSCP. Thus, recombinant OSCP is identical to OSCP purified from yeast mitochondria.

Reconstitution of oligomycin-sensitive ATPase with purified OSCP is shown in Fig. 3. Using NaBr extracted submitochondrial particles (ETP), binding of Fl-ATPase is dependent on the addition of OSCP. Addition of 2.5 mM ammonium ion has a slight stimulator effect on yeast OSCP binding activity; however, higher concentrations of ammonium ion increase nonspecific interaction of F1 to ETP (data not

M 1 2 3 4 5 6

66 I 97 =

43 - 31 - 22 * 14m

FIG. 2. Expression of OSCP in E. coli and its purification. Shown is the Coomassie Blue stain of protein after individual purification steps after separation by SDS-gel electrophoresis. Purifica- tion of OSCP was achieved by lysis of the bacteria followed by ammonium sulfate fractionation of the soluble protein. The ammonium sulfate precipitate (60%) was dissolved in buffer and fraction- ated with PEG 400 (30%), the soluble protein precipitated with cold ethanol (25%), dissolved in Hepes buffer, pH 6.9, dialyzed, and applied on a carboxymethylcellulose column. OSCP eluted to near homogeneity in a linear 0-0.5 M NaCl gradient at about 0.15 M NaC1. The samples are as follows: lane I , total cell protein (20 pg); lane 2, total soluble extract (20 pg); lane 3, ethanol/PEG precipitation (20 pg); lane 4, carboxymethylcellulose load (20 pg); lanes 5 and 6, the elutant of the carboxymethylcellulose column (5 pg). Lanes 5 and 6 represent two independent purifications. The molecular weight markers are in lane M.

K .- 2 5

-Oligomycin

7 1

” 0 1 2 3 4 5 6

pg OSCP

FIG. 3. Reconstitution of oligomycin-sensitive ATPase with recombinant OSCP. Reconstitution with Fl and ETP was performed as described under “Experimental Procedures” in the presence of the indicated amount of OSCP. ATPase was measure in the absence (0) and presence (A) of oligomycin. The data is the average of two experiments. The inset plot shows the percent ATPase inhibited by oligomycin as a function of added OSCP.

Yeast OSCP 25693

shown). ATPase activity is inhibited to about 90% with the reconstituted system using 1 pg of OSCP. Binding of F1 is saturated; beyond 2 pg of added OSCP there is no additional binding of F1 to ETP.

Fig. 3 demonstrates that binding of F1 to ETP is dependent on the addition of added OSCP. This suggests that OSCP interacts with F, and Fo. To investigate the binding properties of OSCP with F, and Fo, binding studies were performed with 3'S-OSCP (cf. Fig. 7 and "Experimental Procedures"). Fig. 4 demonstrates that "S-OSCP binds with ETP with an apparent Kd of 200 nM and a capacity of 420 pmol of OSCP/mg of particle protein. However, the binding was not changed by more than 10% by the addition of F1 to the reaction. In contrast, dialysis equilibrium binding studies with "'S-OSCP and F1 (see "Experimental Procedures") showed no indication that OSCP interacted with F1 without the addition of ETP. These data suggest that OSCP interacts with Fo first and then the OSCP.Fo complex is able to bind F, forming the complete complex.

Beef heart OSCP has been shown to be an elongated molecule with the axial ratio of 3 to 1 (30). Thus, OSCP might consist of a t least two domains, one that interacts with F, and one that interacts with Fo. To investigate the domain structure of yeast OSCP, two deletion mutants, NB and BB, were made which divide the molecule into the first two-thirds and the last one-third of the molecule, as illustrated in Fig. 5. Coin- cidently, these deletions separated the polar carboxyl terminus from the more hydrophobic amino end (19). In addition to the deletion products, NB contains four additional amino acids derived from the vector. Similarly, BB contains a 14- amino acid extension at the amino terminus that is derived from the expression vector.

Expression and radiolabeling of OSCP, NB, and BB is shown in Fig. 6. The experiments were performed in variance to the expression of OSCP shown in Fig. 2. In this experiment, IPTG was added to induce the T7 RNA polymerase and then

R g 200

Cap.= 420 pmoleslmg

0 Kd = 200 nM U c =I 0 m o

0 2000 4000

Free OSCP (nM) FIG. 4. Binding of 36S-OSCP to ETP. The binding of "S-OSCP

to ETP was measured by varying the amount of OSCP added to the reaction (0.00125-28 pg OSCP). The points represent the average of two experiments. The curve represents the fit of the data with a K d value of 240 nM and a capacity of 420 pmol/mg particle protein.

OSCP coding Region

NB Deh. Mutant

FIG. 5. Schematic of the deletion mutants. Two deletion mutants, NB and BB, were made to examine the domain structure of OSCP. The open box indicates OSCP coding region, whereas the shaded region indicates coding region from the vector. NB comprises the first two-thirds of OSCP, whereas BB comprises the last one- third of OSCP.

A 35S-Myt + =s-cys

M 1 2 3 4 5 6 1 2 3 i j i IPTG - - - + . "

97 66 43

31

21 14

B "

43-

31-

2 8 14.

FIG. 6. Radiolabeling of OSCP, NB, and BB. A , Coomassie Blue stain of total E. coli proteins after separation by SDS-polyacrylamide gel electrophoresis. Protein was isolated from E. coli BL21(DE3) with the appropriate T 7 constructs of OSCP (lanes 1 and 4 ) , NB (lanes 2 and 5 ) , and BB (lanes 4 and 6). The protein was isolated after growth in the absence (lanes 1-3) or presence (lanes 4- 6 ) of IPTG. The arrows indicate the pertinent peptides. As indicated, the proteins were labeled with [:"S]methionine and [:"S]cysteine after the addition of rifampicin. B, shown is an autoradiogram of the gel in A. The protein gel was dried and KodaK XAR5 film was exposed for 20 min a t room temperature. The molecular weight markers are shown in lane M.

rifampacin was added to inhibit the host E. coli RNA polymerase and selectively radiolabel OSCP, NB, and BB (cf. "Ex- perimental Procedures").

Coomassie Blue stain of the products identifies the correct products, indicated by the arrows (OSCP, NB, and BB in decreasing molecular weights), with induction with IPTG. Only BB was radiolabeled with [:"S]Met (Fig. 6B, lanes 4-6, [:"S]Met). This is consistent with the fact that the terminal Met is removed from OSCP and NB in vivo. BB is radiolabeled with [:"S]Met, since it has a 14-amino acid NH, terminus that contains three methionine residues, which were derived from the vector. All the products were radiolabeled with [?3] Cys, since OSCP and NB contain a single cysteine residue, whereas BB contains methionine (Fig. 6B, lanes 4-6, [:"SI Cys). These experiments confirm the absence of the methionine in OSCP after expression in E. coli and provide radiolabeled OSCP which was used for monitoring the binding of OSCP to F1 and ETP in equilibrium binding studies.

At least two approaches can be used to determine the domain structure of OSCP. First, direct binding of the deletion products to ETP and F, can be determined by equilibrium binding studies. This approach is being undertaken and will be reported elsewhere. Another approach is to generate antibodies against the deletion products. If the antigenic sites are involved in binding ETP or F1, then addition of the antibodies to the reaction should inhibit the reconstitution of the oligomycin-sensitive ATPase. Therefore, antibodies directed against OSCP and BB were made.

Fig. 7 shows the immune reactivity of antibodies prepared against OSCP and BB. In this analysis, the amount of protein separated on SDS-gel electrophoresis was adjusted to make the levels of OSCP, NB, and BB equivalent (Fig. 7A, lane I (OSCP), lane 2 (NB), and lane 3 (BB)). Western blot analysis indicated that the antibodies prepared against OSCP were directed primarily against NB, whereas antibodies made against BB were directed against BB and did not cross-react with NB. This is indicated because the antibody preparation

25694 Yeast OSCP A

,.l.

FIG. 7. Immune reactivity of antibodies against BB and OSCP. A, the Coomassie Blue stain of total E. coli proteins from cells expressing OSCP (lane I), NB (lane 2 ) , and BB (lane 3) is shown in A. These samples are the same as those shown in Fig. 6 except that the load was decreased by 10-fold for OSCP and BB to equalize the level of the respective proteins. The molecular weight markers are shown in lane M. B, Western blot analysis of the samples shown in A using antiserum against OSCP and BB. The arrows indicate the positions of OSCP, NB, and BB. Note that the antiserum made against OSCP is reactive against OSCP and NB but not BB.

TABLE I Effect of immune serum on OSCP actiuity

Oligomycin (0g)-sensitive ATPase was reconstituted (see "Exper- imental Procedures") with recombinant OSCP (1 pg) in the presence of preimmune serum or immune serum against OSCP and BB. OSCP was preincubated with serum for 15 min prior to the addition of F1 and ETP to the reaction mixture. ATPase activity was measured in the absence and presence of oligomycin, as indicated. These data represent the average of two experiments.

ATPase Sample Preimmune Immune activity Inhibition

serum serum -0rr +og

$1 mg protein pmol/min/ %

Control 20 5.50 1.03 81 Control 40 4.23 1.27 70 Anti-OSCP 20 4.60 1.40 70 Anti-OSCP 40 4.09 1.44 65 Anti-BB 20 4.37 2.52 42 Anti-BB 40 3.77 3.08 20

against OSCP reacted with the OSCP and NB, but very little with BB (lanes 1-3, anti-OSCP). In contrast, antibodies made against BB reacted with OSCP and BB, but not a t all to NB (lanes 1-3, anti-BB). Thus, the two antibody preparations were directed against the different regions of OSCP.

These antibodies were used in reconstitution experiments to determine if they would inhibit reconstitution of the oligomycin-sensitive ATPase. Table I illustrates that preincu- bation of anti-OSCP or anti-BB with OSCP before reconstitution had little effect on the binding of F, to ETP. This is surprising, since Fig. 3 indicated that the binding of F1 to ETP is dependent on addition of OSCP.

Although both antibody preparations had little effect on binding of F1 to ETP, antibodies against BB uncoupled the ATPase, as measured by oligomycin sensitivity of the ATPase. In this context, a coupled ATPase is defined as the coupling of ATP hydrolysis to the pumping of protons through Fo. In this sense, oligomycin sensitivity correlates well with a coupled ATPase. These results suggest that OSCP is involved in

a functional role in the ATP synthase, as well as the well documented structural role.

To confirm that the uncoupling effect was due to the antibodies and not to something in the serum, the effect of serum was tested after depletion of the antibodies. The antibodies directed against BB were depleted by incubating the serum with purified BB prior to the incubation with OSCP. Table I1 shows that addition of BB can reverse the effect of the antibodies. This experiment demonstrates that the uncoupling effect was due to the antibodies directed against BB.

It was of interest to determine if partial assembly of the oligomycin-sensitive ATPase could protect against the effect of the antibody before the addition of the antibodies. If possible, this would provide information on the domain structure of the enzyme. Table I11 illustrates that neither the addition of ETP or F1 before the addition of antibodies could protect against the antibodies. Some protection was imparted only when the complete oligomycin-sensitive ATPase was

TABLE I1 Reuersal of the effect of antiBB antibody on the reconstitution of

oligomycin (Og) sensitive ATPase by the addition of BB Immune serum against OSCP and BB were added in the reconsti-

tution reaction of the oligomycin-sensitive ATPase with varying amount of purified BB. BB was incubated for 15 min with immune serum. OSCP (1 pg) was added and the mixture was incubated for an additional 15 min. Finally, F, and ETP were added to complete the reconstitution reaction and incubated for a final 30 min. ATPase activity was measured in the absence and presence of oligomycin, as indicated.

ATPase Experiment Immune serum

I B B ~ activity inhibition Average

-0g +Og pmol/min/

" mg protein %

1 Anti-OSCP 4.20 1.02 76 2 4.32 1.00

1 Anti-OSCP 0.8 3.59 1.04 74 2 4.18 0.91

1 Anti-OSCP 8.0 3.89 1.09 75 2 4.40 0.97

1 Anti-BB 3.21 2.14 39 2 3.89 2.14

1 Anti-BB 0.8 4.28 1.47 63 2 3.20 1.28

1 Anti-BB 8.0 3.59 1.12 67 2 4.45 1.50

TABLE 111 Effect of immune serum against BB on OSCP activity

First, the sample components were incubated for 30 min. Immune serum directed against BB was then added and incubated for an additional 15 min. Last, the remaining missing constituents (ETP or F,) were added and incubated for a final 30 min. Preimmune serum (20 pl) was added in place of immune serum in the last sample. ATPase was measured in the absence and presence of oligomycin (Og), as indicated. The data represent the average of two experiments.

ATPase Immune serum

activity Inhibition Sample -0g +og

Pl pmol/min/mg

protein %

OSCP 20 3.51 2.57 27 OSCP + F, 20 3.83 2.39 38 OSCP + ETP 20 3.18 2.21 31 OSCP + ETP + F1 20 4.01 1.42 65 OSCP + ETP + F1 5.20 0.93 82

Yeast OSCP 25695

assembled. Therefore, the antigenic sites that alter the coupling of the oligomycin-sensitive ATPase are not covered by formation of the OSCP:F, complex.

DISCUSSION

The mature yeast OSCP has been expressed in E. coli and purified to homogeneity. The ATP5 gene which codes for yeast OSCP (19) was modified to allow expression of mature OSCP by the introduction of an NheI restriction site that deleted the leader sequence and allowed the cloning of the altered gene in a T 7 expression vector (14). Serendipitously, the initiating methionine was also removed in uiuo, resulting in expression of the identical protein as that purified from yeast mitochondria. We were able to obtain 1.5 mg of pure OSCP from 1 liter of cells. This yield is sufficient for most structural and biochemical studies.

OSCP expressed in E. coli is able to reconstitute oligomycin- sensitive ATPase with purified F1 and NaBr-stripped mitochondrial membranes (ETP) as effectively as OSCP purified from yeast mitochondria. Consistent with the results by Tza- goloff (18), yeast F, does not bind to E T P without the addition of added OSCP. This is in contrast to bovine (20, 31) and pig heart (32) F, which apparently bind specifically to ETP in the absence of OSCP. The chloroplast and E. coli homolog of OSCP is the &subunit of the ATPase. E. coli 6 is necessary, whereas chloroplast &subunit is not necessary, for binding Fl to Fo while they both act as a proton plug as it binds to Fo (33-35). Bovine OSCP does not act by itself as a proton plug (31), but in the presence of F,, both bovine and yeast OSCP can be considered a proton plug; they couple the ATP synthase. The differences between the homologs are apparently greater in their role as a structural component than they are with regard to the functional component. In every species, OSCP is necessary for the functionally coupled enzyme, though not necessarily required for binding F, to Fo.

Using 35S-OSCP, the binding of OSCP to ETP and to F1 was determined. These experiments demonstrate that free OSCP binds to ETP but not to F,. This was a rather surprising result, since bovine OSCP was shown to bind to F, (36), and obviously, the &subunit of the E. coli and chloroplast ATPase interact with the F,. Tzagoloff (18) concluded that yeast OSCP and F1 did not interact, but the experiments were not equilibrium binding studies and subject to error. It seems logical to assume that yeast OSCP does interact with F,, since it is necessary for the binding of F, to ETP. Despite this fact, we were not able to get any evidence of binding of free OSCP to F, using equilibrium binding studies.

The binding of yeast OSCP to E T P was similar in some respects to that of bovine (20) and pig heart (32) OSCP. Similar to mammalian OSCP, yeast OSCP bound to E T P with a capacity of about 420 pmol/mg particle protein. How- ever, the apparent Kd (200 nM) was 40-fold higher than the Kd (5 nM) determined for bovine OSCP (20). Addition of F, to the reaction does not enhance the binding of OSCP to ETP. This is similar to that of pig heart OSCP (32), but for bovine OSCP, addition of F, increases the number of sites and the affinity of OSCP for E T P (20). The binding data suggest that free yeast OSCP interacts with Fo forming a Fo. OSCP complex. This interaction changes the structure of yeast OSCP and places it in a conformation that is able to interact specifically with F, forming the intact enzyme. In contrast, bovine OSCP appears to interact with either F, or F1.Fo, forming either an OSCP complex that is able to interact with F, with high affinity or the intact ATP synthase.

The binding characteristics of yeast OSCP seem to be more similar to pig heart than bovine OSCP. Pig heart OSCP

appears to interact with E T P similar to that of yeast, both in the number of sites (400-500 pmol/mg protein) and the affinity of these site (not reported but similar data), and addition of F, does not increase the number or affinity of OSCP for E T P (32). Again, as concluded earlier, the role of OSCP in the structure of the ATP synthase appears to be quite variable between species.

A note should be made on the apparent Kd value determined for yeast OSCP with ETP. This value (200 nM) appears to be higher than one might predict for specific protein-protein interactions. Although this value is high, it is only %fold higher than the reported apparent Kd of beef heart OSCP with F, (80 nM) (36, 37). The high Kd value determined for OSCP and E T P might be due to a number of reasons. Treat- ment of submitochondrial particles with NaBr and ammonium might alter the state of the F,. This change could be the result of conformational changes, chemical modification, or the differential loss of subunits that are important for the stabilizing the complex. Alternatively, the binding data might be reflecting less specific associations that mask the specific binding. The less specific sites could be sites that are functionally important or they could be an artifact of the assay. Functionally important low affinity sites might be available to dock free OSCP before it is assembled into the enzyme. It is of interest to note, that despite most estimates that OSCP forms a 1:l complex with the F1 (1, 20, 37, 38), OSCP is present in pig heart mitochondria at two copies per F1 (39). Thus, OSCP might be made in excess of the other subunits to ensure that free F1 is not present in the mitochondrion. Additional binding sites for OSCP on the membrane could be available to accelerate the assembly of the enzyme. Future studies are planned that will provide more information on the significance of the K d value of OSCP with ETP.

The goal of the deletion mutagenesis of OSCP was to determine which end of OSCP interacted with F1 and Fo. The constructs were made using the assumption that OSCP is divided into at least two domain structures and that either the deletion product, or antibodies directed against the deletion product, would inhibit the reconstitution of the oligomycin-sensitive ATPase. However, the results were quite surprising. Purified BB, which contains the last one-third of yeast OSCP, did not have any effect on the ability of OSCP to reconstitute oligomycin-sensitive ATPase despite that many fold excess of BB was added over the amount of OSCP. In addition, antibodies directed against BB and NB (NB consists of the first two-thirds of the molecule) did not have any effect on the ability of OSCP to bind F1 to ETP. Of course, this is negative data and only indicates that the serum did not contain any antibodies that recognized antigenic sites on OSCP that were necessary for assembly of the complex. It may be that antibody preparations made by other methods or in other animals, could inhibit complex formation. However, the antibodies directed against BB did provide some postive data as they uncoupled the ATPase, as measured by reduced sensitivity to oligomycin. This result suggests that yeast OSCP is directly involved in the coupling of proton translo- cation to ATP hydrolysis.

Although suggestive, the effect of the antibodies on the oligomycin sensitivity does not provide a definitive conclu- sion. There are at least two other possible effects of the antibodies that would not support the role of OSCP as a functional element in the ATP synthase. First, it is possible that the antibodies simply impair the structure of the ATP synthase, thereby uncoupling the enzyme without altering the stability. The second, albeit less likely possibility, is that the antibodies prevent oligomycin from interacting with F,,. The

25696 Yeast OSCP

oligomycin sensitivity would not, therefore, be indicative of the coupling of the system. While the latter possibility would be easy to test, the first possibility would be very difficult to test. Our attention is now being directed to genetic studies of OSCP, which will provide more definitive data on the role of OSCP in the structure and function of the ATP synthase.

Jounouchi et al. (40) have suggested from mutagenesis studies with the E. coli &subunit that overall structure of the &subunit is important and that individual residues are not critical. Since individual residues were not thought to be critical, it was suggested that the 6-subunit must not provide a functional role in the ATP synthase. We are now identifying mutants in yeast OSCP by an in vivo selection scheme. Even though OSCP is not very mutagenic, single missense mutants have been isolated that alter the function of OSCP. With the development of the E. coli expression system of yeast OSCP, we will be able to provide biochemical studies of the mutants selected in yeast.

REFERENCES

1. Todd. R. D.. Griensenbeck, T. A,, and Douglas, M. G. (1980) J. Bid. Chem. 256,5461-5467

2. Walker, J. E., Fearnley, I . M., Gay, N. J., Gibson, B. W., Northrop, F. D., Powell, S. J., Runswick, M. J., Saraste, M., and Tybulewicz, V. L. J. (1985) J . Mol. Bid. 184,677-701

3. Vignais, P. W., and Satre, M. (1984) Mol. Cell. Biochem. 60, 33-70 4. Senior, A. E., and Wise, J. G. (1983) J. Membr. Bid. 7 3 , 105-124 5. Cross, R. L., and Nalin, C. M. (1982) J . Biol. Chem. 257,2874-2881 6. Esch, F. S., and Allison, W. S. (1979) J. Biol. Chem. 2 5 4 , 10740-10746 7. Walker, J. E., Saraste, M., and Gay, N. J. (1984) Biochim. Biophys. Acta

8. Boulay, F., Dalbon, P., and Vignais, P. V. (1985) Biochemistry 2 4 , 7372- 7 6 8 , 164-200 117n l U l . 7

9. Duszynski, J., Dupuis, A., Lux, B., and Vignais, P. V. (1988) Biochemistry

10. Sandri, G., Wojtczak, L.. and Ernster, L. (1985) Arch. Biochem. Biophys. 2 7 , 6288-6296

239, 597-602 (abstr.)

11. Todd, R. D., and Douglas, M. G. (1981) J. Biol. Chem. 256,6984-6989 12. Ernster, L., Hundal, T., and Sandri, G. (1986) Methods Enzymol. 126 ,

13. Fessenden-Raden, J. M. (1972) J. Biol. Chem. 247,2351-2357 14. Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990)

Methods Enzymol. 185,61-89 15. Daum, G., Bohni, P. C., and Schatz, G. (1982) J. Biol. Chem. 257,13028-

13033 16. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Moleculor Cloning: A

Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Har- bor, NY

428-433

17. Mueller, D. M. (1988) J. Biol. Chem. 2 6 3 , 5634-5639 18. Tzagoloff, A. (1970) J. Biol. Chem. 2 4 5 , 1545-1551, 19. Uh, M., Jones, D., and Mueller, D. M. (1990) J. Bzol. Chem. 265 , 19047-

20. Duouis. A,. and Vienais. P. V. (1987) Biochemistrv 26,410-418 19052

21. Peiefsky, H . S. (1579) kethods Enzymol. 66,527-530 22. Takeshige, K., Hess, B., Bohm, M., and Zimmerman-Telschow, H. (1976)

23. Kunkel, T. A. (1985) Proc. Natl. Acad. Scz. U. S. A. 82,488-492 24. Saneer. F.. Nicklen. S.. and Coulson. A. R. (1977) Proc. Natl. Acad. Sci.

Hoppe-Seylers 2. Physiol. Chem. 3 5 7 , 1605-1622

~~ ~~~~

U:S.'A. 64, 546315467 . .

25. Stoscheck, C. M. (1990) Methods Enzymol. 182,50-68 26. Leatherbarrow. R. J. (1990) Grafit Version 2.0, Eritbacus Software Ltd.,

27. Laemmli, U. K. (1970) Nature 227,680-685 28. Towbin, H., Staehelin, T., and Gordin, J. (1979) Proc. Natl. Acad. Sci.

Staines, United Kingdom .

11 S . A . 76. 4.150-4354 - . - . . . . 29. Tzagoloff, A. (1979) Methods Enzymol. 55,351-358 30. Dupuis, A., Zaccai, G., and Satre, M. (1983) Blochemistry 2 2 , 5951-5956 31. Pringle, M. J , Kenneally, M. K., and Joshi, S. (1990) J. Biol. Chem. 2 6 5 ,

- - . "" ~-~ ~

7G19-7GR7 32. Penin, F., Deleage, G., Godinot, C., and Gautheron, D. C. (1986) Biochim.

33. Dunn, S. D., and Futai, M. (1980) J. Biol. Chem. 255,113-118 34. Engelbrecht, S., Althoff, G., and Junge, W. (1990) Eur. J . Bzochem. 189 ,

,""- ."". Biophys. Acta 8 5 2 , 55-67

1w-147

35. Engelbrecht, S., Lill, H., and Junge, W. (1986) Eur. J . Biochem. 160,635- *"" A " I

36. Noumi, T., Mosher, M. E., Natori, S., Futai, M., and Kanazawa, H. (1984)

37. Noumi, T.. Futai, M., and Kanazawa, H. (1984) J. B i d . Chem. 259,10076-

643

J. Biol. Chem. 2 5 9 , 10071-10075

10079 38. Dupuis, A,, Satre, M., and Vignais, P. V. (1983) FEBS Lett. 156,99-102 39. Penin, F., Archinard, P., Moradi-Ameli, M., and Godinot, C. (1985)

40. Jounouchi, M., Takeyama, M., Chaiprasert, P., Noumi, T., Moriyama, Y., Biochim. Biophys. Acta 810,346-353

Maeda, M., and Futai, M. (1992) Arch. Biochem. Biophys. 292 , 376-381

the journal of biological chemistry val. 36, 25, … · the journal of biological chemistry 0 1992...

Documents