Molecular Basis of Leukocyte Rolling on PSGL-1PREDOMINANT ROLE OF CORE-2 O-GLYCANS AND OF TYROSINE SULFATE RESIDUE 51*

Received for publication, May 3, 2002, and in revised form, October 10, 2002Published, JBC Papers in Press, October 25, 2002, DOI 10.1074/jbc.M204360200

Michael Pierre Bernimoulin‡, Xian-Lu Zeng‡, Claire Abbal‡, Sylvain Giraud‡, Manuel Martinez‡,Olivier Michielin§¶, Marc Schapira‡, and Olivier Spertini‡�

From the ‡Division and Central Laboratory of Hematology, Centre Hospitalier Universitaire Vaudois, Bugnon 46, 1011Lausanne, Switzerland, the §Ludwig Institute for Cancer Research, Lausanne Branch, chemin des Boveresses 155,Epalinges, and the ¶Swiss Institute for Bioinformatics, chemin des Boveresses 155, Epalinges, Switzerland

Interactions between the leukocyte adhesion receptorL-selectin and P-selectin glycoprotein ligand-1 play animportant role in regulating the inflammatory responseby mediating leukocyte tethering and rolling on adher-ent leukocytes. In this study, we have examined theeffect of post-translational modifications of PSGL-1 in-cluding Tyr sulfation and presentation of sialylated andfucosylated O-glycans for L-selectin binding. The func-tional importance of these modifications was deter-mined by analyzing soluble L-selectin binding and leu-kocyte rolling on CHO cells expressing variousglycoforms of PSGL-1 or mutant PSGL-1 targeted at N-terminal Thr or Tyr residues. Simultaneous expressionof core-2 �1,6-N-acetylglucosaminyltransferase and fu-cosyltransferase VII was required for optimal L-selectinbinding to PSGL-1. Substitution of Thr-57 by Ala but notof Thr-44, strongly decreased L-selectin binding and leu-kocyte rolling on PSGL-1. Substitution of Tyr by Pherevealed that PSGL-1 Tyr-51 plays a predominant role inmediating L-selectin binding and leukocyte rollingwhereas Tyr-48 has a minor role, an observation thatcontrasts with the pattern seen for the interactions be-tween PSGL-1 and P-selectin where Tyr-48 plays a keyrole. Molecular modeling analysis of L-selectin and P-selectin interactions with PSGL-1 further supportedthese observations. Additional experiments showed thatcore-2 O-glycans attached to Thr-57 were also of criticalimportance in regulating the velocity and stability ofleukocyte rolling. These observations pinpoint thestructural characteristics of PSGL-1 that are requiredfor optimal interactions with L-selectin and may be re-sponsible for the specific kinetic and mechanical bondproperties of the L-selectin-PSGL-1 adhesion receptor-counterreceptor pair.

Selectins play a major role in regulating leukocyte migrationin inflammatory lesions by mediating leukocyte rolling alongvascular wall at site of inflammation (1–8). L-selectin is ex-pressed by most leukocytes whereas P-selectin and E-selectinexpression is induced on activated platelets and/or endothelialcells (1, 2, 4, 5, 7, 9). E-, P-, and L-selectin function at differentalthough overlapping phases of the inflammatory reaction (10).

P-selectin interacts with its major ligand P-selectin glycopro-tein ligand-1 (PSGL-1)1 and supports leukocyte rolling alongpostcapillary venules at the earliest phase of inflammation(11–13). Several studies have indicated that L-selectin medi-ates both primary leukocyte-endothelial interactions (14, 15)and secondary interactions between circulating and adherentleukocytes, which both participate in leukocyte recruitment ininflammatory lesions. Secondary interactions are mainly sup-ported by the interaction of PSGL-1 with L-selectin (16–18).

PSGL-1 is a mucin-like glycoprotein expressed as a ho-modimer on leukocyte microvilli (4, 19–21). P-selectin bindswith relatively high affinity (Kd �300 nM) (22) to PSGL-1 byreacting with N-terminal tyrosine sulfate residues and with thesLex tetrasaccharide determinants presented by core-2 O-gly-cans attached to Thr-57 (23–33). Binding studies performedwith glycosulfopeptides indicated a contribution of each tyro-sine sulfate residue in supporting P-selectin binding with apredominant role of Tyr-48 (34). The molecular contacts be-tween P-selectin and PSGL-1 were identified by the analysis ofthe crystal structure of P-selectin co-complexed with the N-terminal peptide of PSGL-1 (23). These studies revealed theinvolvement of Tyr-48 and -51, but no interaction was observedbetween P-selectin and Tyr-46 (23).

Previous observations indicated the involvement of O-gly-cans attached to Thr-57 and tyrosine sulfate residues in sup-porting L-selectin- and P-selectin-mediated rolling (35). In thepresent study, we characterized the PSGL-1 determinants thatinteract with L-selectin. Adhesion studies indicated that O-glycosylation of Thr-57 and sulfation of Tyr-46 and -51 play acritical role in supporting recombinant L-selectin binding toPSGL-1 and leukocyte rolling on PSGL-1. In addition, thesedeterminants were shown to play a major role in stabilizingrolling velocity, a key feature for the regulation of leukocyteexposure to chemotactic stimuli that lead to cell arrest and firmadhesion. By contrast, Tyr-48 played only a minor role in sup-porting L-selectin-mediated adhesion whereas it was shown tobe critical for P-selectin-mediated interactions with PSGL-1(23, 34).

EXPERIMENTAL PROCEDURES

Antibodies and Chimeric Selectins—The anti-L-selectin monoclonalantibodies (mAbs) LAM1–3, LAM-14 (36), HECA–452 (ATCC HB11485), and CSLEX-1 (ATCC number: HB-10135) were purified fromhybridoma culture medium. mAbs PL1 and PL2 were purchased fromCoulter Immunotech (Marseille, France) and KPL1 from BD BiosciencePharMingen (Heidelberg, Germany). L-selectin/IgM heavy chain (L-

* This work was supported by Grant 32-065177.01 from the SwissNational Foundation for Scientific Research. The costs of publication ofthis article were defrayed in part by the payment of page charges. Thisarticle must therefore be hereby marked “advertisement” in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

� To whom correspondence should be addressed: Division of Hematol-ogy, University of Lausanne, BH 18-544, 1011-CHUV Lausanne,Switzerland. Tel.: 41-21-314-42-26; Fax: 41-21-314-41-80; E-mail:Olivier.Spertini@chuv.hospvd.ch.

1 The abbreviations used are: PSGL-1, P-selectin glycoprotein li-gand-1; mAb, monoclonal antibody; FITC, fluorescein isothiocyanate;RMSD, root mean-squared deviation; IRES, internal ribosome entrysite.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 1, Issue of January 3, pp. 37–47, 2003© 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org 37

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

selectin/�) and CD4/� chimera were produced by transient transfectionof COS-7 cells using the DEAE method (37, 38).

cDNAs—PSGL-1 cDNA was a gift from Genetics Institute (Boston,MA) (39), fucosyltransferase VII (FucT-VII) cDNA from J-B Lowe(Howard Hughes Institutes, Ann Harbor, MI) and core-2 �1,6-N-acetyl-glucosaminyltransferase transferase (C2GnT) from M. Fukuda (theBurnham Institute, La Jolla Cancer Research Center, San Diego, CA).The cDNA sequence encoding the internal ribosome entry site (IRES) ofthe encephalomyocarditis virus sequence was a gift from P. Aebischer(EPFL, Lausanne, Switzerland). The pZeoSV and the pcDNA3.1 vectorswere from Invitrogen (Groningen, The Netherlands). The IRES se-quence was inserted in the multiple cloning sites of the pZeoSV vector(pIRES Zeo SV vector). C2GnT and FucT-VII cDNAs were then sub-cloned in the pIRES Zeo SV vector to permit the translation of C2GnTand FucT-VII sequences from one mRNA. The expression cassette wasconstructed by inserting the C2GnT sequence followed by the IRES andthe FucT-VII cDNA sequences in the multiple cloning site of the pZeoSV vector. This type of vector allows the expression of the target gene(C2GnT) and the selection marker (sLex expression associated to FucT-VII activity) from the same promoter so that virtually all transfectedcells expressing the selection marker also express the gene of interest(40–42).

Targeted point mutations were introduced in the N-terminal regionof PSGL-1 using the QuickChange site-directed mutagenesis kit (Strat-agene, Woodinville, WA), according to the manufacturer instructions.Sequences of the forward and reverse primers used to generate wild-type and mutant PSGL-1 shown in Fig. 1 were CAGGCCACCGAATA-TGAGTATCTAGATTTTGATTTCCTGCC and GGCAGGAAATCAAAA-TCTAGATACTCATATTCGGTGGCCTG for PSGL-1 Y46F/Y48F/Y51F; CAGGCCACCGAATATGAGTATCTAGATTTTGATTTCCTGCCand GGCAGGAAATCAAAATCTAGATACTCATATTCGGTGGCCTGfor PSGL-1 Y48F/Y51F; CAGGCCACCGAATATGAGTTTCTAGATTT-TGATTTCCTGCC and GGCAGGAAATCAAAATCTAGAAACTCATAT-TCGGTGGCCTG for PSGL-1 Y46F/Y51F; CAGGCCACCGAATTTGA-GTATCTAGATTTTGATTTCCTGCC and GGCAGGAAATCAAAATCT-AGATACTCAAATTCGGTGGCCTG for PSGL-1 Y46F/Y51F; CAGGCC-ACCGAATTTGAGTTTCTAGATTATGATTTCCTGCC and GGCAGGA-AATCATAATCTAGAAACTCAAATTCGGTGGCCTG for PSGL-1Y46F/Y48F; GATTTCCTGCCTGAGGCGGAGCCTCCAGAAATGCTG-AGG and CCTCAGCATTTCTGGAGGCTCCGCCTCAGGCAGGAAATCfor PSGL-1 T57A; CGGGACCGGAGACAGGCTGCAGAATATGAGTA-CCTAGAT and ATCTAGGTACTCATATTCTGCAGCCTGTCTCCGGT-CCCG for PSGL-1 T44A. Polymerase chain reactions (PCR) were per-formed using Pfu Polymerase (Stratagen), and PCR products werecloned into pCR-Blunt vector (Invitrogen) after digestion of methylatedcDNAs with DpnI. Sequences of the constructs were verified bydideoxynucleotide sequencing.

Cells and Transfections—Heparinized blood samples were obtainedfrom healthy donors. Lymphocytes were isolated by blood centrifuga-tion on Ficoll-Hypaque and monocyte depletion by adherence on plastic(43). Neutrophils were isolated from Ficoll-Hypaque pellets by dextransedimentation and erythrocyte hypotonic lysis. CHO/dhfr� cells (ATCCnumber: CRL 9096) were stably transfected with cDNAs encoding wild-type or mutant PSGL-1, subcloned in pCDNA3.1 vector. When indi-cated, CHO cells were co-transfected with FucT-VII cDNA subcloned inpZeoSV vector (Invitrogen) or in the pIRES Zeo SV expression vector,which allows the simultaneous translation of C2GnT and FucT-VIIsequences. Transfections were performed using LipofectAMINE™ Plus(Invitrogen). CHO dhfr� were cultured in MEM� medium containingribonucleotides, deoxyribonucleotides, and 10% fetal calf serum; COS-7cells were cultured in Dulbecco’s modified Eagle’s medium/10% fetalcalf serum. Transfectants were selected in medium containing 400

�g/ml G418 (Invitrogen) and, when required, 200 �g/ml Zeocin (Invitro-gen). Individual clones expressing high levels of the various forms ofPSGL-1, C2GnT, and FucT-VII-dependent expression of sLex and thecutaneous lymphocyte antigen (CLA) were isolated by limiting dilutionsand identified by immunophenotypic analysis. The expression ofPSGL-1, sLex, and CLA was assessed using, respectively, PL2,CSLEX-1, and HECA-452 mAbs. CHO cells, which were selected foradhesion studies, expressed similar levels of PSGL-1 and of sLex/CLA.The expression of C2GnT and FucT-VII mRNAs in CHO cells express-ing wild-type or mutant PSGL-1 was detected by RT-PCR using the onetube Titan System™ (Roche Diagnostic, Rotkreuz, Switzerland). Se-quences of forward and reverse primers used for C2GnT PCR amplifi-cation were GGCAGTGCCTACTTCGTGGTCA and ATGCTCATCCAA-ACACTGGATGGCAAA; for FucT-VII, CCCACCGTGGCCCAGTACCG-CTTCT and CTGACCTCTGTGCCCAGCCTCCCGT; for PSGL-1, ATG-CCTCTGCAACTCCTCCT and CTGCTGAATCCGTGGACAGGTT. Theexpression levels of the various forms of PSGL-1 by CHO cells weredetermined by the measurement of antigen site density using theDAKO QIFIKIT® (Dako, Glostrup, Denmark). Antibody binding sitedensity was calculated (44) using PL2 mAb to assess PSGL-1 expres-sion. PL2 binding sites were found equal to 115 � 37 (mean � S.D.)binding sites/�m2 in CHO cells expressing constructs used to performexperiments illustrated in Figs. 4–8. CHO cells used in experimentsillustrated in Figs. 2 and 3 expressed higher levels of PSGL-1 (247 � 19PL2 binding sites/�m2). The determination of sLex and CLA expressionindicated that CHO cells used for L-selectin/� binding studies andadhesion assays expressed comparable levels of FucT-VII activity.

Immunophenotypic Analysis—One or two color flow cytometry anal-ysis was carried out by incubating cells with appropriate unlabeledmAbs, FITC-, PE-conjugated mAbs (10 �g/ml) or soluble adhesion re-ceptors (L-selectin/� or CD4/� chimera at 50 �g/ml) (37, 38). Whenrequired goat anti-mouse IgG-FITC (Tago BIOSOURCE Europe S.A.,Nivelles, Belgium), goat anti-mouse IgM-FITC (Tago BIOSOURCE), orrabbit anti-rat IgM-FITC were used as secondary antibodies (Dako).L-selectin/� and CD4/� chimeric proteins were suspended in phos-phate-buffered saline containing 1% bovine serum albumin and 1 mM

CaCl2. Cell surface binding of chimeric proteins was detected using apolyclonal FITC-conjugated rabbit anti-human IgM heavy chain anti-body (Dako). The specificity of L-selectin/� binding to PSGL-1 wasindicated by the abrogation of L-selectin/� binding in presence of 5 mM

EDTA or 100 �g/ml anti-L-selectin mAb LAM1–3 or 10 �g/ml anti-PSGL-1 mAb KPL1. In experiments performed to evaluate the role ofsialic acid residues in supporting neutrophil rolling on PSGL-1, CHO-PSGL-1 cells, co-expressing C2GnT and FucT-VII, were cultured for 30min at 37 °C in PBS containing 0.1 units/ml Vibrio cholerae neuramin-idase (Roche Diagnostics). The reactivity of the mAb CSLEX-1 withsLex was abrogated by this treatment. Flow cytometry was performedwith a Epics XL-MCL cytofluorimeter (Coulter Electronics, Hialeah,FL). A total of 5000 cells were analyzed in each experiment.

Cell Adhesion Assays—A laminar flow was generated in a parallelplate flow chamber (GlycoTech Corp Rockville, MD) mounted on a glasscoverslip (Polylabo SA, Plan-les-Ouates, Switzerland) covered with aconfluent monolayer of transfected CHO cells. Neutrophils suspendedin RPMI 1640/1% fetal calf serum at 0.5 � 106/ml, lymphocytes (106/ml),300.19 pre-B cells stably expressing L-selectin (300.19-L-selectin cells,0.5 � 106/ml) or K-562 cells cells stably expressing P-selectin (K562P-selectin cells, 0.5 � 106/ml), were perfused through the chamber usinga syringe pump (Harvard Apparatus, Indulab AG, Gams, Switzerland)for 5 min, at room temperature, under a constant shear stress. Leukocyteinteractions with CHO cells were visualized using a phase contrastmicroscope (Leica Leitz DM IL, Renens, Switzerland) and a highresolution Sony CCD-IRIS videocamera (Japan). Images were recordedon an S-VHS-recorder (Panasonic MD 830, Telecom Lausanne,Switzerland). Sequential images of leukocyte interactions with trans-fected CHO cells were analyzed using a digital image analysis system(Mikado software, GPL SA, Martigny, Switzerland) and a Power-Macintosh 8600/200 workstation equipped with a Scion LG-3 board(Scion, Frederick, MD) (38). Cell-cell interactions were analyzed fromvideotapes at 2–4 min of perfusion. Leukocyte interactions with CHOcells, in 0.27-mm2 fields, were considered for the analysis when theinteraction time was �1 s and when the distance traveled by leukocytesduring observation periods (20 s) was �1 cell diameter. These cells wereconsidered as rolling cells. Experiments were performed in quadrupli-cates under constant shear stress. Rolling velocities illustrated in Figs.3b and 6 were measured in the direction of flow by tracking individualcells every 0.25 s, for up to 4 s, using digitized images. 300–800independent determinations of cell velocity were measured for eachtested condition. Frame-by-frame velocity data obtained by tracking

FIG. 1. N-terminal amino acid sequences of wild-type and mu-tant PSGL-1. The first 21 amino acids of mature PSGL-1 are indicated.Amino acid substitutions at Tyr-46, -48, and -51 by Phe and at Thr-57and -44 by Ala are shown in bold.

Molecular Basis of PSGL-1 Interactions with L-selectin38

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

cells every 0.032 s are illustrated in Figs. 7a and 8a and were used toassess the mean velocity � S.D. of each tracked cell over 2–5 s obser-vation periods. The mean velocity of frame-by-frame tracked cells wasincluded between percentile 25–75 of the velocity of each cell populationillustrated in Fig. 6. The S.D. value of the mean velocity of each trackedcell was then used to calculate the mean � S.D. of cell-rolling velocitiesof each cell population. The mean � S.D. was used as an indicator of thevariation of cell-rolling velocity. 373–1477 independent determinationsof frame-by-frame velocity were measured for each tested conditions.The anti-L-selectin mAb LAM 1–3 and the anti-PSGL-1 mAbs PL1 orKPL1 were used as inhibitors of L-selectin interaction with PSGL-1.The isotype-matched mAbs LAM1–14 and PL2 were used as controls. Inexperiments evaluating the inhibitory effect of HECA-452, a rat IgMmAb was used as control (Dako). Leukocytes expressed similar levels ofL-selectin before and at the end of each experiment.

Lymphocytes, 300.19-L-selectin cells and K-562 P-selectin cells didnot significantly arrest on CHO-PSGL-1 (6 � 6 lymphocytes/min/mm2)whereas neutrophils occasionally firmly adhere to CHO-PSGL-1 cells.Arrested cells were defined as cells which did not move during anobservation period �2 s. Neutrophil arrest was abrogated in presence ofthe adhesion-blocking anti-CD18 mAb TS1/18 (Endogen, Woburn, MA).

Model of PSGL-1 Interactions with L-selectin and P-selectin—P-se-lectin and L-selectin interactions with PSGL-1 were compared using aL-selectin homology model based on the crystal structure of P-selectinco-complexed with PSGL-1 (PDB Data Bank ID: 1G1S) (23). 66% se-quence identity and 85% sequence similarity were disclosed betweenP-selectin and L-selectin using a dynamic programming method imple-mented in the MODELLER program (45). With this sequence homology,the probability that both L-selectin and P-selectin share the same foldis very high (46–48). A root mean-squared deviation (RMSD) of 0.67 Åwas calculated for all C� atoms between the L-selectin model and theP-selectin template with the Swiss PDB viewer program (49). Assumingthat PSGL-1 interactions with L-selectin and P-selectin are highlysimilar, we used the coordinates of PSGL-1 (PDB Data Bank ID: 1G1S)and superimposed L-selectin on P-selectin to analyze L-selectin inter-actions with PSGL-1. Hydrogen-bonding pattern was analyzed usingthe HBPLUS program and standard geometric definitions consideringthe distance and the angle between the hydrogen atom and the accep-tor/donor atoms (50). To compute hydrogen bonds, we used, as criteria,3,9 Å as maximal distance between heavy atoms and 90° as minimalangle between the donor (D) atom, the hydrogen (H) atom, and theacceptor (A) atom (DHA angle), the probability of finding energeticallyfavorable hydrogen bonds being smaller at longer distances or smallerangles (51).

The mobility of P-selectin loops was studied in detail with the SwissPDB viewer (49) and the MOLMOL programs (52) using the crystalstructure of P-selectin co-complexed with its ligands PSGL-1 (1G1S),sLex (1G1Q), and the uncomplexed form (1G1R) (23). PSGL-1-sulfatedTyr-48 was previously reported to interact with a first loop constitutedof P-selectin amino acids 42–48 and with a second loop constituted ofamino acids 108–114. PSGL-1-sulfated Tyr-51 interacts with a thirdloop constituted of amino acid 64–89 (23). The mobility of each loop wasassessed by calculating with the MOLMOL program the local RMSDs ofthe lectin domain amino acid backbone atoms between the differentP-selectin structures (52–54). Regions constituted of residues with localRMSDs higher than the mean local RMSD (1.3 Å) were defined asmobile.

Statistical Analysis—Analysis of variance and the Bonferroni multi-ple comparison test or the Kruskal-Wallis non parametric ANOVA testwere used to assess statistical significance of differences betweengroups. The Mann-Whitney test was used to compare the medians oftwo unpaired groups. p values of �0.05 were considered as significant.

RESULTS

Sialylated, Fucosylated, Core-2 O-Glycans Are Essential toSupport Leukocyte Rolling on PSGL-1—The requirement insLex/CLA and core-2 O-glycans to support L-selectin-mediatedinteractions with PSGL-1 was examined by analyzing L-selec-tin/� chimera binding and leukocyte rolling on CHO cells co-transfected with PSGL-1 cDNA in pcDNA3.1 vector and/orFucT-VII cDNA in pZeo SV and/or C2GnT and FucT-VIIcDNAs in pIRES Zeo SV vector. Five different transfectantscontaining cDNA sequences of (1) FucT-VII alone, (2) C2GnTand FucT-VII, (3) PSGL-1 alone, (4) PSGL-1 and FucT-VII, or(5) PSGL-1, C2GnT and FucT-VII were obtained. CHO cellsstably expressed similar levels of PSGL-1 and/or sLex/CLA as

ascertained by determination of antibody binding site density(mean � S.D.: 247 � 19 PL2 binding sites/�m2) and immuno-staining of CHO cell monolayers with mAbs PL2 (anti-PSGL-1), CSLEX-1 (anti-sLex), or HECA-452 (anti-CLA) (Fig. 2a).

L-selectin/� chimera weakly interacted with CHO cells ex-pressing FucT-VII cDNA alone or co-expressing C2GnT andFucT-VII cDNAs (Fig. 2b, upper panels). L-selectin/� bound toa much higher percentage of CHO cells when PSGL-1 wasco-expressed with both FucT-VII and C2GnT (Fig. 2b, lowerright panel).

Neutrophil rolling was studied under flow conditions at aconstant shear stress of 1.25 dyn/cm2. Mock-transfected CHOcells or CHO cells transfected with PSGL-1 cDNA alone did notsupport neutrophil rolling (mean number of rolling cells/min/mm2 � S.E.: 1 � 0.3, n � 4 (not illustrated) versus 1 � 0, n �4). Although CHO cells transfected with the pIRES vectorcontaining C2GnT and FucT-VII cDNA sequences expressedsLex/CLA (Fig. 2a) and bound L-selectin/� (Fig. 2b), the expres-sion of C2GnT and FucT-VII was not sufficient to confer toCHO cells the ability to support neutrophil rolling (3 � 2 rollingcells/min/mm2, n � 4, Fig. 3a).

Interestingly, neutrophil rolling was observed on CHO cellsco-transfected with PSGL-1 and FucT-VII cDNAs even in theabsence of C2GnT expression (64 � 18 rolling cells/min/mm2,n � 5, p � 0.02, Fig. 3a, shaded box). The presentation ofsLex/CLA residues at the termini of core-2 O-glycans attachedto PSGL-1 strongly increased neutrophil recruitment at thesurface of CHO cells. Neutrophil rolling on CHO cells co-ex-pressing PSGL-1, C2GnT, and FucT-VII cDNA sequences wasincreased by 6-fold over the data obtained without C2GnTexpression (416 � 45 rolling neutrophils/min/mm2 versus 64 �48 rolling cells/min/mm2, n � 5, p � 0.0008, Fig. 3a, black box).

FIG. 2. Role of core-2 O-glycans and sLex/CLA in modulatingL-selectin interactions with PSGL-1. a, immunophenotypic analy-sis of the expression of sLex and CLA by CHO cells, stably transfectedwith C2GnT/FucT-VII/PSGL-1 cDNAs, using mAbs CSLEX-1 (anti-sLex) and HECA-452 (anti-CLA). b, functional studies examining L-selectin/� chimera binding to CHO cells expressing high levels of theindicated cDNAs. Binding of L-selectin/� was completely inhibited bythe presence of 5 mM EDTA (dotted lines). The proportion of positivecells is indicated in each histogram. mAbs and L-selectin/� did not bindsignificantly (� 2%) to mock-transfected CHO cells.

Molecular Basis of PSGL-1 Interactions with L-selectin 39

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

This observation emphasizes the key role played by core-2O-glycans in supporting PSGL-1 binding to L-selectin. TheL-selectin specificity of this interaction was indicated by thecomplete inhibition of neutrophil rolling in presence of LAM1–3mAb (98 � 1% of inhibition, n � 6). The adhesion blocking PL-1mAb inhibited neutrophil rolling by 91 � 3% (n � 6). Thenon-blocking anti-L-selectin mAb LAM1–14 and anti-PSGL-1mAb PL2 had no significant inhibitory effect.

Sialylation of PSGL-1 Is Required to Support NeutrophilRolling—The importance of sialic acid residues in supportingL-selectin interactions with PSGL-1 was evaluated by analyz-ing neutrophil rolling on CHO cells, co-expressing PSGL-1,C2GnT, and FucT-VII, treated with V. cholerae neuraminidase(0.1 units/ml) for 30 min at 37 °C. Sialidase treatment inhibitedneutrophil rolling by 93 � 3% (145 � 26, n � 8 versus 9 � 4rolling neutrophils/mm2/min, n � 24; p � 0.0001, not illus-trated) indicating that sialic acid residues play a key role inregulating L-selectin-dependent rolling on PSGL-1.

Regulation of Neutrophil-rolling Velocity by Core-2 O-Gly-cans—Neutrophil-rolling velocity on CHO-PSGL-1/FucT-VII orCHO-PSGL-1/C2GnT/FucT-VII cells was analyzed under a con-stant shear stress of 1.25 dyn/cm2 (Fig. 3b). Significantly lowerrolling velocities were observed on CHO-PSGL-1/C2GnT/FucT-VII cells (median-rolling velocity: 39 �m/s, range: 3.4–257�m/s, P25 � 24 �m/s, P75 � 61 �m/s, p � 0.0001, Fig. 3b, blackcurve) than on CHO-PSGL-1/FucT-VII cells (median-rolling ve-locity: 113 �m/s, range: 2.4–348 �m/s, P25 � 73 �m/s, P75 � 177�m/s, Fig. 3b, gray curve). These observations emphasized thecritical role played by core-2 O-glycans, decorated by sLex/CLAresidues, in the regulation of neutrophil-rolling velocity onPSGL-1.

O-Glycans Attached to Thr-57 Are Essential to SupportL-selectin Binding and Neutrophil Rolling on PSGL-1—Therole of core-2 O-glycans attached to Thr-57 was evaluated byreplacing Thr-57 by Ala (PSGL-1 T57A, Fig. 1). Similarly,

Thr-44, another potential site of O-glycosylation, was replacedby Ala (PSGL-1 T44A). CHO cells stably expressed similarlevels of PSGL-1 (mean � S.D.: 115 � 37 PL2 binding sites/�m2), sLex, and CLA. L-selectin/� strongly reacted with wild-type PSGL-1 or PSGL-1 T44A (Fig. 4a, left and center panels)whereas it only weakly bound to PSGL-1 T57A (Fig. 4a, rightpanel). L-selectin/� binding was not completely inhibited by thereplacement of Thr-57 by Ala indicating that additional struc-tures support L-selectin/� binding to PSGL-1. The N-terminaltyrosine sulfation consensus is the most likely alternate poten-tial binding site. Sialyl Lex/CLA determinants expressed at thesurface of CHO cells may also play a role (Fig. 2b, upperpanels).

Replacement of Thr-44 by Ala did not impair neutrophilrolling on CHO-PSGL-1 T44A cells (335 � 28, n � 4 versus322 � 58 rolling neutrophils/mm2/min, n � 9) whereas Thr-57replacement by Ala decreased neutrophil rolling by 97 � 1%(335 � 28 versus 7 � 2 rolling neutrophils/mm2/min, n � 8; p �0.001). These observations indicate that O-glycans attached toThr-57 play a major role in supporting neutrophil tetheringand rolling on PSGL-1 (Fig. 4b). Similar results were obtainedwith peripheral blood lymphocytes. The replacement of Thr-57by Ala decreased lymphocyte recruitment on CHO-PSGL-1cells by 74 � 3% (1596 � 177 versus 412 � 43 rolling lympho-cytes/mm2/min, n � 4, p � 0.001, not shown).

Regulation of L-selectin Interaction with PSGL-1 by N-termi-nal Tyrosine Su1fate Residues—Point mutations were intro-duced in PSGL-1 cDNA to exchange Tyr-46, -48 and -51 by Pheand Thr-57 by Ala. Five constructs (PSGL-1 Y46F/Y48F;PSGL-1 Y46F/Y51F, PSGL-1 Y48F/Y51F, PSGL-1 Y46F/Y48F/Y51F, and PSGL-1 Y46F/Y48F/Y51F/T57A; Fig. 1) were stablyco-expressed in CHO cells with pIRES Zeo SV vector containingC2GnT/FucT-VII cDNA sequences. CHO cells exhibited similarlevels of PSGL-1 (mean � S.D.: 115 � 37 PL2 binding sites/�m2), sLex, and CLA (not shown). L-selectin/� chimerastrongly bound to CHO cells co-expressing C2GnT/FucT-VIIand wild-type PSGL-1 cDNAs (Fig. 5a, upper left panel). Theinteraction of L-selectin/� chimera was reduced by the replace-ment of two Tyr residues by Phe (Fig. 5a, lower panels). Inter-estingly, L-selectin/� bound more efficiently to mutant PSGL-1

FIG. 3. Role of core-2 O-glycans and sLe/CLA in regulatingneutrophil recruitment and velocity on PSGL-1 expressingcells: a, neutrophils were perfused under a constant shear stress of 1.25dyn/cm2 on CHO cells stably co-transfected with C2GnT/FucT-VII/PSGL-1 cDNAs, as indicated. Neutrophil rolling was analyzed by video-microscopy at 2–4 min of perfusion. Results represent the mean � S.E.of four experiments. b, velocity of neutrophil rolling on CHO cells stablyco-transfected with C2GnT/FucT-VII cDNAs with or without PSGL-1cDNA, after 2–4 min of perfusion. Curves were constructed using 720independent determinations of rolling velocity and are representative offour experiments.

FIG. 4. Core-2 O-glycans attached to Thr-57 mediate L-selectininteractions with PSGL-1. a, binding of L-selectin/� to CHO cellsstably expressing FucT-VII, C2GnT and wild-type or mutant PSGL-1cDNAs. Thr-44 or -57 were substituted by Ala in PSGL-1 T44A andPSGL-1 T57A. The proportion of positive cells is indicated in eachhistogram. b, neutrophil recruitment on CHO cells stably co-expressingFucT-VII, C2GnT and PSGL-1 T44A or PSGL-1 T57A cDNAs. Resultsrepresent the mean � S.E. of 4–8 experiments (***, p � 0.001).

Molecular Basis of PSGL-1 Interactions with L-selectin40

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

expressing a single tyrosine residue at position 46 or 51 (Fig.5a, lower left and right panels) than at position 48 (Fig. 5a,lower central panel).

The N-terminal Tyrosine Sulfation Consensus of PSGL-1Regulates Neutrophil and Lymphocyte Recruitment at CHOCell Surface—The role of Tyr-46, -48, -51 in supporting neutro-phil and T-lymphocyte rolling was assessed under laminar flowconditions using a constant shear stress of 1.25 dyn/cm2. Re-placement of Tyr-46, -48, and -51 by Phe decreased by 82 � 8%neutrophil rolling on CHO-PSGL-1/C2GnT/FucT-VII cells.Thus, 409 � 36 neutrophils/min/mm2 rolled on wild-typePSGL-1 (n � 7) whereas only 74 � 32 neutrophils/min/mm2

(n � 5, p � 0.0001) rolled on CHO-PSGL-1 Y46F/Y48F/Y51F

cells (p � 0.0001, Fig. 5b). Tyrosine replacement by Phe leavinga single Tyr residue also strongly affected neutrophil recruit-ment. Neutrophil rolling decreased: 1) by 56 � 13% in theabsence of Tyr-48 and -51 (180 � 50 neutrophils/min/mm2, n �5, p � 0.0001); 2) by 72 � 8% after replacement of Tyr-46 and-51 by Phe (115 � 29 neutrophils/min/mm2, n � 5, p � 0.0001);and 3) only by 35 � 8% after exchange of Tyr-46 and -48 by Phe(266 � 29 neutrophils/min/mm2, n � 5, p � 0.01). These resultssuggest, like observations made with L-selectin/� chimera, thatTyr-51 plays a predominant role in regulating L-selectin inter-actions with PSGL-1.

Similar results were obtained with peripheral blood lympho-cytes, which rolled efficiently on wild-type PSGL-1 (1594 � 74

FIG. 5. Role of N-terminal tyrosine sulfate residues in mediating L-selectin/� binding and neutrophil recruitment on PSGL-1. a,binding of L-selectin/� to CHO cells stably expressing FucT-VII, C2GnT, and wild-type or mutant PSGL-1 cDNAs. Tyr-46 and/or -48 and/or -51were substituted by Phe; Thr-57 was substituted by Ala in PSGL-1 Y46F/Y48F/Y51F/T57A. The proportion of positive cells is indicated in eachhistogram. b, neutrophil recruitment on CHO cells stably co-expressing FucT-VII, C2GnT, and mutant PSGL-1 in which the indicated tyrosineresidues were substituted by Phe. Neutrophils were perfused under a constant shear stress of 1.25 dyn/cm2. Results represent the mean � S.E.of five experiments. c, lymphocyte recruitment on CHO cells expressing wild-type or mutant PSGL-1. Results represent the mean � S.E. of threeexperiments. d recruitment of 300.19-L-selectin-cells and e, of K-562-P-selectin cells on wild-type or mutant PSGL-1 cDNAs. Results are expressedas percentage of rolling cells (� S.E.). ***, p � 0.001; **, p � 0.01; *, p � 0.05.

Molecular Basis of PSGL-1 Interactions with L-selectin 41

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

lymphocytes/min/mm2, n � 3, Fig. 5c). Lymphocyte rolling wasreduced by 32 � 5% on mutants expressing Tyr-51 as singlesulfated Tyr residue (PSGL-1 Y46F/Y48F: 1085 � 67 lympho-cytes/min/mm2, n � 3, p � 0.01), by 69 � 3% on mutantsexpressing Tyr-48 (PSGL-1 Y46F/Y51F: 481 � 45 lymphocytes/min/mm2, n � 3, p � 0.001) and by 52 � 4% on mutantsexpressing Tyr-46 (PSGL-1 Y48F/Y51F: 754 � 52 lymphocytes/min/mm2, n � 3, p � 0.001, Fig. 5c). These observations con-firm: 1) that the presence of a single Tyr residue is less efficientthan three Tyr residues to support leukocyte rolling on PSGL-1and 2) that Tyr-51 plays a predominant role in supportinglymphocyte interactions with PSGL-1.

Additional experiments were performed to examine whetherthe predominant role of Tyr-51 in supporting L-selectin inter-action with PSGL-1 was dependent on wall shear stress. At alltested shear stress (1.0, 2.0, and 3.0 dyn/cm2), the recruitmentof 300.19 cells on PSGL-1 Y46F/Y51F, which express Tyr-48,was lower than on mutants expressing Tyr-51 (number of cells/min/mm2 that rolled on PSGL-1 Y46F/Y51F at 1.0 dyn/cm2

(mean � S.E.): 138 � 12; at 2.0 dyn/cm2: 171 � 19; at 3.0dyn/cm2: 201 � 29). The number of rolling cells was signifi-cantly higher on PSGL-1 Y46F/Y48F (number of rolling cells at1.0 dyn/cm2: 290 � 23; at 2.0 dyn/cm2: 374 � 20; at 3.0 dyn/cm2:627 � 35, p � 0.001). These observations confirmed that Tyr-51plays a predominant role in mediating L-selectin-dependentrolling on PSGL-1 and indicate that this property is not de-pendent on shear stress. In contrast, a predominant role forTyr-46 was observed only at 1.0 dyn/cm2 (number of rollingcells/min/mm2 on PSGL-1 Y48F/Y51F at 1 dyn/cm2: 205 � 18,p � 0.05 versus 138 � 12 on PSGL-1 Y46F/Y51F). These resultsindicated that tyrosine residues distinctly contribute to supportL-selectin-dependent rolling. Since experiments performedwith PSGL-1 glycosulfopeptides previously showed that tyro-

sine residues distinctly contribute to support P-selectin binding(34), we compared side-by-side the role of tyrosine sulfate res-idues in supporting L-selectin and P-selectin-dependent roll-ing. Adhesion studies were performed with 300.19-L-selectincells and K-562 P-selectin cells under a constant shear stress of2.0 and 3.0 dyn/cm2. Results were expressed as percentage ofrolling cells. Under a constant shear stress of 2.0. dyn/cm2,476 � 35 (mean � S.E.) 300.19-L-selectin cells (% of rollingcells: 100 � 6) and 433 � 7 K-562-P-selectin cells (100 � 10%),rolled on wild-type PSGL-1 (Fig. 5, d and e). Tyrosine replace-ment by Phe leaving Tyr-48 as single tyrosine residue stronglydecreased L-selectin-dependent rolling (% of rolling cells: 33 �3, p � 0.001, n � 3, Fig. 5d) whereas P-selectin-mediatedrolling was not significantly reduced (96 � 8%, n � 3, Fig. 5e).Similar results were obtained under a shear stress of 3.0.dyn/cm2 (% of 300.19-L-selectin-rolling cells on PSGL-1 Y46Y/Y51F: 30 � 3, p � 0.001, n � 3 versus 82 � 6 K-562-P-selectin-rolling cells, n � 3) confirming that tyrosine sulfate residuesdistinctly contribute to support L-selectin and P-selectin-de-pendent rolling, Tyr-51 playing a major role in supportingL-selectin-dependent rolling whereas Tyr-48 has an essentialrole in mediating P-selectin-dependent rolling (Fig. 5, d and e).

Leukocyte Rolling Velocity on PSGL-1 Is Regulated byN-terminal Tyr Sulfate Residues and O-Glycans Attached toThr-57—Neutrophils rolled significantly faster on PSGL-1Y46F/Y48F/Y51F (median-rolling velocity: 80 �m/s, P25: 29�m/s; P75 � 155 �m/s; n � 3, Fig. 6a) than on wild-typePSGL-1 (median: 44 �m/s, P25 � 23 �m/s; P75 � 69 �m/s; n �3, p � 0,001, Fig. 6a) emphasizing the key role played bytyrosine residues in supporting neutrophil rolling. Higher roll-ing velocities were also observed on mutants expressing a sin-gle N-terminal tyrosine residue (Fig. 6a). Among these mu-tants, lower rolling velocities were observed on PSGL-1 Y48F/

FIG. 6. Regulation of leukocyte rolling velocity by tyrosine sulfate residues. a, neutrophils were perfused under a constant shear stressof 1.25 dyn/cm2 on CHO cells stably co-transfected with C2GnT/FucT-VII and wild-type or mutant PSGL-1 cDNAs. The rolling velocity ofneutrophils was assessed at 2–4 min of perfusion and represent 300–800 independent determinations. Data are representative of threeexperiments. b, rolling velocity of lymphocytes under the conditions described in a. Data are representative of three experiments. c, rolling velocityof 300.19-L-selectin cells and d, of K-562-P-selectin cells under a constant shear stress of 2.0 dyn/cm2. Data are representative of three experiments.

Molecular Basis of PSGL-1 Interactions with L-selectin42

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Y51F and PSGL-1 Y46F/Y48F presenting Tyr-46 or -51 assingle sulfated tyrosine residue (median-rolling velocity onTyr-46: 43 �m/s, P25 � 18 �m/s, P75 � 92 �m/s; p � 0.001, n �3; median-rolling velocity on Tyr-51: 47 �m/s, P25 � 22 �m/s,P75 � 92 �m/s; p � 0.01, n � 3, Fig. 6a) than on PSGL-1Y46F/Y51F expressing only Tyr-48 (median-rolling velocity: 61�m/s, P25 � 25 �m/s, P75 � 132 �m/s, p � 0.001, n � 3).

Lymphocytes rolled faster than neutrophils on wild-typePSGL-1 (median rolling velocity of lymphocytes: 58 �m/s,P25 � 48 �m/s, P75 � 71 �m/s, n � 4 versus 44 �m/s, P25 � 23�m/s, P75 � 69 �m/s for neutrophils, n � 5, p � 0.0001). Thereplacement of all three Tyr by Phe strongly increased lympho-cyte-rolling velocity (median-rolling velocity on PSGL-1 Y46F/Y48F/Y51F: 163 �m/s, P25 � 135 �m/s, P75 � 198 �m/s, n � 4,p � 0,0001, Fig. 6b). The replacement of 2 N-terminal Tyrresidues by Phe also significantly increased lymphocyte-rollingvelocities on PSGL-1 (p � 0.0001, n � 4, Fig. 6b). Lower rollingvelocities were observed on PSGL-1 mutants expressing Tyr-51or -46 than on mutants expressing only Tyr-48 (p � 0.001, n �4, Fig. 6b). Lymphocyte-rolling velocities on mutants express-ing Tyr-51 (PSGL-1 Y46F/Y48F, median-rolling velocity: 123�m/s, P25 � 99 �m/s, P75 � 150 �m/s, n � 4) or Tyr-46(PSGL-1 Y48F/Y51F, median: 116 �m/s, P25 � 92 �m/s, P75 �145 �m/s) were not statistically different. On the other hand,higher rolling velocities were observed on PSGL-1 Y46F/Y51F,which expressed Tyr-48 (median-rolling velocity 150 �m/s,P25 � 119 �m/s, P75 � 190 �m/s, n � 4, p � 0.001). Additionalexperiments were performed with 300.19 cells expressing L-selectin to show that the predominant role of Tyr-51 in regu-lating L-selectin-dependent rolling velocity was not cell type-specific. The rolling velocity of 300.19-L-selectin cells was

significantly lower on PSGL-1 Y46F/Y48F (median-rolling ve-locity: 89 �m/s; P25: 75 �m/s; P75 � 109 �m/s) than on PSGL-1Y46F/Y51F (median-rolling velocity: 173 �m/s; P25: 135 �m/s;P75 � 195 �m/s, p � 0.001) or PSGL-1 Y48F/Y51F (median-rolling velocity: 121 �m/s; P25: 98 �m/s; P75 � 159 �m/s, p �0.05) confirming that Tyr-51 plays a key role in regulatingL-selectin-dependent rolling on PSGL-1 whereas Tyr-48 has aless important role. The distinct contribution of Tyr sulfateresidues in regulating cell rolling velocity was not dependenton shear stress. Thus, 300.19 cells rolled faster on PSGL-1Y46F/Y51F than on PSGL-1 Y46F/Y48F at 1.0, 2.0 and 3.0dyn/cm2 (median cell rolling velocity on PSGL-1 Y46F/Y51Fversus PSGL-1 Y46F/Y48F at 1.0 dyn/cm2: 140 �m/s versus 92�m/s; at 2.0 dyn/cm2: 173 �m/s versus 88 �m/s; at 3.0 dyn/cm2:174 �m/s versus 92 �m/s; p � 0.001).

The contribution of tyrosine sulfate residues in regulatingL-selectin- and P-selectin-dependent rolling velocity was exam-ined in experiments comparing side-by-side 300.19-L-selectinand K-562-P-selectin rolling under a constant shear stress of2.0 dyn/cm2. Rolling velocities of 300.19-L-selectin cells on mu-tant PSGL-1 was strongly increased by the replacement ofTyr-46 and -51 by Phe, leaving Tyr-48 as single tyrosine resi-due (median-rolling velocity on wild-type versus PSGL-1 Y46F/Y51F: 41 �m/s (P25: 30 �m/s; P75 � 80 �m/s) versus 174 �m/s(P25: 135 �m/s; P75 � 195 �m/s), p � 0.001, n � 3, Fig. 6c). Incontrast, rolling velocity of K-562-P-selectin cells was not sig-nificantly increased on PSGL-1 Y46F/Y51F (median-rolling ve-locity on wild-type versus PSGL-1 Y46F/Y51F: 8 �m/s (P25: 4�m/s; P75 � 18 �m/s) versus 11 �m/s (P25: 5 �m/s; P75 � 20�m/s); n � 3, Fig. 6d) whereas significantly higher rollingvelocity were observed on PSGL-1 Y48F/Y51F (median-rolling

FIG. 7. Tyrosine sulfate residues stabilize leukocyte motions. a, frame-by frame rolling velocity of 300.19-L-selectin cells on CHO cellsstably expressing C2GnT/FucT-VII and wild-type or mutant PSGL-1. The velocity of tracked cells was determined by measuring cell displacementswithin successive video frames (0.032 s) in the flow direction, under a shear stress of 1.25 dyn/cm2. Data are representative of 5–11 experiments.b, distribution of distances traveled by 300.19 cells rolling on wild-type PSGL-1 or mutant PSGL-1 during successive 0.032-s observation periods.Data are representative of 891–1477 determinations.

Molecular Basis of PSGL-1 Interactions with L-selectin 43

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

velocity: 19 �m/s (P25: 12.5 �m/s; P75 � 26 �m/s); n � 3, p �0.001, Fig. 6d). The key role played by Tyr-48 in regulatingP-selectin-dependent cell-rolling velocity contrasts with its mi-nor role in supporting L-selectin-dependent rolling on PSGL-1.These differences indicate that N-terminal tyrosine sulfate res-idues are distinctly involved when they support L-selectin orP-selectin interactions with their common ligand.

O-glycans presented by Thr-57 played an essential role inregulating lymphocyte-rolling velocity. The replacement ofThr-57 by Ala strikingly increased rolling velocities (median-rolling velocity on PSGL-1 T57A: 176 �m/s, P25 � 137 �m/s,P75 � 238 �m/s, n � 4, p � 0.0001, Fig. 6b). Surprisingly,lymphocyte rolling at very high velocities was still observed onPSGL-1 Y46F/Y48F/Y51F/T57A mutants, which lack core-2 O-glycans attached to Thr-57 and N-terminal tyrosine residues(PSGL-1 Y46F/Y48F/Y51F/T57A: 202 �m/s, P25 � 153 �m/s,P75 � 280 �m/s, n � 4, p � 0.001, Fig. 6b).

Additional analysis was performed to examine the frame-by-frame velocity of 300.19-L-selectin cells rolling on PSGL-1 mu-tants under a constant shear stress of 1.25 dyn/cm2. The veloc-ity of tracked cells was determined by measuring celldisplacements within successive video frames (0.032 s) in theflow direction. Each increase in velocity is represented by apeak and each decrease by a valley (Fig. 7a). The replacementof tyrosine sulfate residues by Phe strongly increased the vari-ations of cell-rolling velocity indicated by higher irregularity in“peaks” and “valleys”, as illustrated in Fig. 7a. The observedinstability of cell rolling was quantified by calculating the S.D. ofthe mean velocity of each tracked cell. The pooled data obtainedfrom the whole cell population were used to determine the meanS.D. of rolling velocities on wild-type and each PSGL-1 mutant.More irregular rolling velocities were observed on PSGL-1 mu-tants devoid of tyrosine sulfate residues or expressing Tyr-48 assingle tyrosine sulfate residue (mean � S.D. of 300.19-L-selectincell-rolling velocities on PSGL-1 Y46F/Y48F/Y51F: 170 �m/s ver-sus 163 �m/s on PSGL-1 Y46F/Y51F, n � 5, p � 0.001) than onwild-type PSGL-1 (mean � S.D.: 60 �m/s, n � 5, p � 0.001, Fig.7a). The stability of rolling velocity was less affected on mutantPSGL-1 expressing Tyr-46 (mean � S.D. on PSGL-1 Y48F/Y51F:111 �m/s, n � 5) or Tyr-51(mean � S.D. on PSGL-1 Y46F/Y48F:117 �m/s, n � 6) than Tyr-48 (Fig. 7a).

The distribution of travel distances illustrated in Fig. 7b wasassessed by measuring cell displacements within successivevideo frames (0.032 s; 891–1477 determinations for each cellcategory). Data obtained for each cell category were pooled andillustrated in Fig. 7b. The replacement of tyrosine sulfate res-idues strongly affected cell displacements. A significantlyhigher percentage of 300.19-L-selectin cells rolled � 4.1 �m onPSGL-1 Y46F/Y48F/Y51F, within a video frame, than on wild-type PSGL-1 (53.2 versus 15.7%, p � 0.004, Fig. 7b). A broaderrange of travel distances was observed on mutants expressingTyr-48 as single sulfated tyrosine. Thus, the 300.19-L-selectincells more frequently traveled � 4.1 �m on PSGL-1 Y46F/Y51Fthan on PSGL-1 Y48F/Y51F (37.3 versus 11.0%, number ofobserved events: �891, p � 0.001) or PSGL-1 Y46F/Y48F(18.6%, p � 0.003).

The analysis of the variation of velocity and travel distancesof 300.19-L-selectin cells on PSGL-1 T57A lead to similar ob-servations. In the absence of O-glycans attached to Thr-57(PSGL-1 T57A), 300.19-L-selectin cells exhibited a very unsta-ble rolling velocity (mean � S.D. of rolling velocities on PSGL-1T57A: 198 �m/s (n � 7) versus 60 �m/s on wild-type PSGL-1(n � 5), p � 0.001, Fig. 8a). In contrast, the replacement ofThr-44 by Ala had no effect (mean � S.D. on PSGL-1 T44A: 77�m/s, n � 7). Similarly to observations made on PSGL-1 T57A,the rolling velocity of 300.19-L-selectin cells was very unstablein the absence of sLex/CLA presentation by core-2 O-glycans(mean � S.D. on CHO cells co-transfected with PSGL-1 andFucT-VII cDNAs without C2GnT cDNA: 162 �m/s, n � 11, p �0.001, not illustrated). A higher percentage of cells rolled onlonger distances on PSGL-1 T57A than on wild-type PSGL-1(no. of cells that rolled �4.1 �m: 64.9 versus 20.2%, no. ofdeterminations: n � 440, p � 0.001) or on PSGL-1 T44A (64.9versus 16.5%, n � 373, p � 0.001, Fig. 8b).

Lack of Inhibition of L-selectin-dependent Rolling on PSGL-1by CSLEX-1 and HECA-452 mAbs.—The anti-CLA mAbHECA-452 was reported to inhibit by �90% L-selectin-depend-ent lymphocyte rolling on the human vascular endothelial cellline EA hy926 transfected with FucT-VII cDNA suggestingthat CLA, a sLex determinant, is a major determinant of endo-thelial L-selectin ligand(s) (55). In contrast to these observa-tions, neutrophil rolling was not significantly reduced by

FIG. 8. Role of core-2 O-glycans attached to Thr-57 in stabilizing leukocyte motions. a, frame-by frame rolling velocity of 300.19-L-selectin cells on CHO cells stably expressing C2GnT/FucT-VII and wild-type or mutant PSGL-1, under a shear stress of 1.25 dyn/cm2. The velocityof tracked cells was determined as explained in the legend of Fig. 7. Data are representative of 5–11 experiments. b, distribution of distancetraveled by 300.19 cells rolling on wild-type or mutant PSGL-1 during successive 0.032-s observation periods. Data are representative of 373–1331determinations.

Molecular Basis of PSGL-1 Interactions with L-selectin44

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

HECA-452 mAb (no. of neutrophils rolling on PSGL-1 in pres-ence of HECA-452 mAb versus control mAb, mean � S.E.:239 � 21 versus 213 � 49 neutrophils/min/mm2, n � 6).

Molecular Modeling of L-selectin Interactions with PSGL-1—The RMSD calculated between all P-selectin structures (23) foreach amino acids allowed for the identification of the regions ofhigh and low mobility (52). Loops 42–48 and 108–114 of L-selectin and P-selectin, which interact with PSGL-1-sulfatedTyr-48, have low mobility and are surrounded by low mobilityregions. In contrast, loop 64–89 of L-selectin and P-selectin,which interacts with PSGL-1-sulfated Tyr-51, exhibits highmobility. Thus, we analyzed only the interactions of loops42–48 and 108–114 of L-selectin with sulfated Tyr-48 ofPSGL-1. Hydrogen-bonding pattern between L-selectin or P-selectin and Tyr-48 was calculated using the HBPLUS pro-gram, based on a homology model obtained with the MOD-ELLER program (45, 50). Hydrogen bonds involved in theinteractions of sulfated Tyr-48 with L-selectin and P-selectinare indicated in Table I and Fig. 9. Two potential hydrogenbonds were disclosed between Ser-47 of L-selectin and the sul-fate group of Tyr-48, whereas P-selectin binding to PSGL-1-sulfated Tyr-48 is supported (1) by 4 hydrogen bonds locatedbetween Ser-46, Ser-47, His-114, and the sulfate group ofTyr-48 and (2) by an additional hydrogen bond located betweenthe peptidic backbones of Lys-112 and Tyr-48 (Fig. 9 and TableI). Importantly, the basic residue present at position 114 ofP-selectin (His-114) is absent on L-selectin.

DISCUSSION

The determinants of PSGL-1 that mediate L-selectin andP-selectin binding include tyrosine sulfate residues and O-glycans attached to Thr-57 (24, 33, 34, 56–62). The crystalstructure analysis of P-selectin co-complexed with the N-termi-nal peptide of PSGL-1 showed that O-glycans terminated bysLex/CLA as well as Tyr-48 and -51 play an essential role insupporting P-selectin binding. In addition, although this inter-action had not been highlighted in the crystallographic studymentioned above, rolling adhesion assays and glycosulfopep-tide binding studies have suggested a role for PSGL-1 Tyr-46 inadhesion to P-selectin (23, 24, 34, 35). The results presentedhere show that P-selectin and L-selectin use similar mecha-nisms to bind to PSGL-1. However, the three tyrosine sulfateresidues of PSGL-1 do not contribute in an equal fashion to L-and P-selectin binding. Specifically, our results indicate thatTyr-48 is of key importance in supporting P-selectin-mediatedrolling on PSGL-1 whereas it only plays a minor role in medi-ating L-selectin binding. In addition, the present study showsthat: 1) sialylated and fucosylated core-2 O-glycans attached toThr-57 are essential to allow optimal L-selectin binding toPSGL-1 and 2) to support and stabilize leukocyte rolling onCHO-PSGL-1 cells; 3) at least 2 or 3 N-terminal Tyr sulfateresidues are required to optimally support leukocyte recruit-ment and rolling; and 4) Tyr-51 plays a predominant role in

recruiting and stabilizing leukocyte rolling on PSGL-1.We have defined here the minimal molecular requirements

supporting L-selectin interactions with PSGL-1. L-selectin/�weakly bound to sLex/CLA-expressing CHO cells in the absenceof PSGL-1 (Fig. 2b, upper panel). However, this interaction wasnot sufficient to support neutrophil rolling (Fig. 3a). This ob-servation is consistent with the notion that low affinity inter-actions between L-selectin and sLex cannot efficiently supportL-selectin-mediated rolling (13). Interestingly, a low number ofneutrophils rolled on CHO-PSGL-1/FucT-VII cells even in theabsence of C2GnT suggesting that the presentation of sLex/CLA by core-2 O-linked glycans is not essential to supportL-selectin-dependent rolling (Fig. 3a). The strong reduction inneutrophil rolling and L-selectin/� binding observed after thereplacement of Thr-57 (but not of Thr-44) by Ala confirmed theessential role played by Thr-57 in presenting O-glycans in-volved in L-selectin binding (Fig. 4). Interestingly, leukocyterolling was less affected by the replacement of the whole tyro-sine sulfation consensus by Phe residues, suggesting a predom-inant role for core-2 O-glycans (Fig. 5, b and c). A critical rolefor sialic acid residues was indicated by the abrogation ofneutrophil rolling on PSGL-1 after sialidase treatment of CHOcells. Similar observations were previously reported for P-se-lectin (22, 34, 37, 63). Sialic acid residues presented by sLex/CLA determinants most likely play a key role in thisinteraction.

C2GnT co-expression with FucT-VII and PSGL-1 stronglyincreased leukocyte recruitment and decreased rolling velocity(Fig. 3). Similar observations were made by others who studiedPSGL-1 interactions with P-selectin in vitro using leukocyteisolated from C2GnT-deficient mice or in vivo in C2GnT-defi-cient mice (25, 28). Higher rolling velocities on P-selectin wereobserved in the absence of C2GnT suggesting that core-2 O-linked glycans have a major role in regulating leukocyte-rolling

TABLE IHydrogen bonds mediating L-selectin and P-selectin interactions with sulfated Tyr-48

The hydrogen bonding pattern was obtained using the HBPLUS program (69). The donor (D) and the acceptor (A) atoms are defined by the threeletter code amino acid, residue numbers and atom types (in the X-ray structure (23), the Tyr-SO3-48 corresponds to Tys607 and Tyr-SO3-51 to Tys610). D-A distance: distance between the donor and the acceptor atoms. DHA: angle centered on the hydrogen (H) and linking the donor andacceptor atoms.

Protein Donor atom Acceptor atom D-A distances [Å] DHA angle

L-selectin Ser-47 N Tyr-SO 3-48 O3 2.66 126.0Ser-47 OG Tyr-SO 3-48 O3 3.17 121.7

P-selectin Ser-46 OG Tyr-SO 3-48 O3 3.34 172.4Ser-47 N Tyr-SO 3-48 O3 3.08 152.5Ser-47 OG Tyr-SO 3-48 O3 3.02 164.2Lys-112 N Tyr-SO 3-48 O 3.13 160.0His-114 NE2 Tyr-SO 3-48 O2 2.72 155.2

FIG. 9. Models of L-selectin (A) and P-selectin interactions (B)with PSGL-1-sulfated Tyr-48. Drawings were made with the LIG-PLOT program (68) and contain the labels of the residues and the atomsinvolved in the interactions. The presence of hydrogen bonds is indi-cated by dashed lines. The bond lengths are expressed in Å. Carbonatoms are shown in black, nitrogen atoms in dark gray, oxygen atoms inlight gray, and sulfur atoms in white. L, L-selectin; P, P-selectin.

Molecular Basis of PSGL-1 Interactions with L-selectin 45

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

velocity. The present study extends these observations to L-selectin. By stabilizing and reducing leukocyte-rolling velocityon L-selectin or P-selectin, core-2 O-glycans may improve theexposure of rolling cells to cytokines or chemokines at site ofinflammation and promote leukocyte arrest and firm adhesionfollowing integrin activation.

Whereas the results of this study confirm that L-selectininteraction with PSGL-1 is dependent on the expression ofO-glycans attached to Thr-57 and of N-terminal tyrosine sul-fate residues (Figs. 4 and 5) (35), they also revealed thatPSGL-1 mutants exhibiting a single tyrosine sulfate residuewere not as efficient as wild-type PSGL-1 in supporting leuko-cyte rolling. Moreover, these results showed that tyrosine sul-fate residues did not contribute equally to L-selectin interac-tions with PSGL-1. A predominant role for Tyr-51 wasindicated by: 1) the lower rolling velocities (Fig. 6), 2) the moreefficient recruitment of leukocytes on PSGL-1 Y46F/Y48F ex-pressing Tyr-51 as single tyrosine sulfated residue (Fig. 5), 3)the more efficient binding of L-selectin/� to PSGL-1 Y46F/Y48F(Fig. 5a), and 4) the increased stability of leukocyte-rollingvelocity on this mutant PSGL-1 (Fig. 7).

Experiments performed with glycosulfopeptides previouslyindicated that Tyr-48 plays a major role in mediating theinteractions of the N-terminal peptide of PSGL-1 with P-selec-tin (34). Adhesion studies performed with K-562-P-selectincells demonstrated with whole cells that Tyr-48 plays a pre-dominant role in supporting P-selectin-mediated rolling inter-actions with PSGL-1 whereas it had only a minor role inmediating L-selectin-dependent rolling (Fig. 6). These observa-tions are in keeping with crystal structure analysis that re-vealed a major role for His-114 in mediating P-selectin bindingto PSGL-1 Tyr-48 (23). The analysis of hydrogen-bonding pat-tern disclosed additional potential bonds, which maystrengthen P-selectin interactions with Tyr-48 (Fig. 9 and Ta-ble I). The absence of a basic amino acid residue at position 114of L-selectin and the lower number on hydrogen bonds mayexplain why Tyr-48 of PSGL-1 plays only a minor role insupporting L-selectin binding to PSGL-1 (Fig. 9 and Table I). Ofnote, molecular modeling analysis of L-selectin interactionswith Tyr-48 is consistent with results of adhesion studies per-formed under flow at various shear stress and validate thismodel.

L-selectin and P-selectin are likely to bind to PSGL-1 in asimilar fashion because of the conservation of residues withinthe sLex binding site and the presence of a basic residue (Lys)at position 85 (23). Electrostatic interactions most likely play amajor role in supporting the negatively charged Tyr-51 bindingto L-selectin Lys-85 and to P-selectin Arg-85. An important rolefor Lys-85 in supporting L-selectin binding to PSGL-1 is sug-gested by the elevated partial charge of the ammonium groupof Lys-85 (�0.69) (64). In comparison, a lower charge is asso-ciated to the iminium group of Arg-85 (�0.12) of P-selectin. Theabsence of a basic amino acid residue at position 114 of L-selectin and the presence of Lys-85 may explain why sulfatedTyr-51 plays a predominant role in supporting L-selectin inter-actions with PSGL-1 whereas sulfated Tyr-48 is less important.

L-selectin/� binding studies and adhesion assays indicatedthat Tyr-46 plays an important role in supporting L-selectininteractions with PSGL-1. Leukocyte rolling was more stableand slower on PSGL-1 Y48F/Y51F than on PSGL-1 Y46F/Y51F(Figs. 6 and 7). Interestingly, the involvement of Tyr-46 inP-selectin binding was not revealed by crystal structure anal-ysis (23) whereas binding studies of PSGL-1 glycosulfopeptidesto P-selectin (34) and adhesion studies performed with K-562-P-selectin cells (Figs. 5e and 6d) indicate that Tyr-46 supportsthis reaction. The role of Tyr-46 in mediating L-selectin and

P-selectin binding was recently further supported by the abilityof the anti-PSGL-1 mAb PS-4, which reacts with Tyr-46 but notwith Tyr-48 or -51, to inhibit L-selectin-dependent rolling onPSGL-1.2

Rolling is an important step during which leukocytes areexposed to chemoattractants at sites of inflammation, a reac-tion that leads to integrin activation and leukocyte firm adhe-sion. Frame by frame analysis of cell displacements indicatesthat cell rolling occurs through a series of steps or jerks thatappear to represent receptor-ligand dissociation events (65–67). Rolling through selectins is unaffected by alterations inselectin density and hydrodynamic forces acting on the cell(65). This surprising stability of rolling has been explained bythe ability of leukocyte to reach a dynamic balance betweenformation and breakage of bonds between selectins and theirligands over a wide range of wall shear stress and liganddensities (66, 67). The stereospecific interactions of tyrosinesulfate and O-glycans with P-selectin and L-selectin create ahigh affinity binding site (23, 27, 34), which contributes torolling stabilization. The highly irregular cell rolling observedon PSGL-1 mutants devoid of tyrosine sulfate residues or ex-pressing Tyr-48 as single tyrosine sulfate residue (Fig. 7a)indicates that Tyr-46 and -51 play a major role in the ability ofPSGL-1 to stabilize L-selectin-mediated rolling. Similar obser-vations were made for core-2 O-glycans attached to Thr-57which present sLex/CLA to L-selectin (Fig. 8a). Post-transla-tional modifications of PSGL-1 may facilitate endothelium sur-veillance for signs of inflammation and thereby represent im-portant additional levels of regulation of leukocyte traffic.

Acknowledgments—We thank Dr. Philippe Schneider, Dr. Jean-Daniel Tissot, and the staff of the Centre de Transfusion Sanguine atLausanne for providing blood samples. We thank Dr. J. Lowe forFucT-VII cDNA and Dr. M. Fukuda for C2GnT cDNA.

REFERENCES

1. Springer, T. A. (1994) Cell 76, 301–3142. Kansas, G. S. (1996) Blood 88, 3259–32873. Rosen, S. D., and Bertozzi, C. R. (1994) Curr. Opin. Cell Biol. 6, 663–6734. McEver, R. P., and Cummings, R. D. (1997) J. Clin. Invest. 100, 485–4915. McEver, R. P., Moore, K. L., and Cummings, R. D. (1995) J. Biol. Chem. 270,

11025–110286. Campbell, J. J., and Butcher, E. C. (2000) Curr. Opin. Immunol. 12, 336–3417. Vestweber, D., and Blanks, J. E. (1999) Physiol. Rev. 79, 181–2138. McEver, R. P. (2002) Curr. Opin. Cell Biol. 14, 581–5869. Tedder, T. F., Steeber, D. A., Chen, A., and Engel, P. (1995) FASEB J. 9,

866–87310. Ley, K., Bullard, D. C., Arbones, M. L., Bosse, R., Vestweber, D., Tedder, T. F.,

and Beaudet, A. L. (1995) J. Exp. Med. 181, 669–67511. Norman, K. E., Moore, K. L., McEver, R. P., and Ley, K. (1996) Blood 86,

4417–442112. Yang, J., Hirata, T., Croce, K., Merrill-Skoloff, G., Tchernychev, B., Williams,

E., Flaumenhaft, R., Furie, B. C., and Furie, B. (1999) J. Exp. Med. 190,1769–1782

13. Norman, K. E., Katopodis, A. G., Thoma, G., Kolbinger, F., Hicks, A. E., Cotter,M. J., Pockley, A. G., and Hellewell, P. G. (2000) Blood 96, 3585–3591

14. Ley, K., Tedder, T. F., and Kansas, G. S. (1993) Blood 82, 1632–163815. Jung, U., Bullard, D. C., Tedder, T. F., and Ley, K. (1996) Am. J. Physiol. 271,

H2740–274716. Bargatze, R. F., Kurk, S., Butcher, E. C., and Jutila, M. A. (1994) J. Exp. Med.

180, 1785–179217. Walcheck, B., Moore, K. L., McEver, R. P., and Kishimoto, T. K. (1996) J. Clin.

Invest. 98, 1081–108718. Kunkel, E. J., Chomas, J. E., and Ley, K. (1998) Circ. Res. 82, 30–3819. Moore, K. L. (1998) Leuk. Lymphoma 29, 1–1520. Li, F., Erickson, H. P., James, J. A., Moore, K. L., Cummings, R. D., and

McEver, R. P. (1996) J. Biol. Chem. 271, 6342–634821. Shao, J. Y., Ting-Beall, H. P., and Hochmuth, R. M. (1998) Proc. Natl. Acad.

Sci. U. S. A. 95, 6797–680222. Mehta, P., Cummings, R. D., and McEver, R. P. (1998) J. Biol. Chem. 273,

32506–3251323. Somers, W. S., Tang, J., Shaw, G. D., and Camphausen, R. T. (2000) Cell 103,

467–47924. Liu, W., Ramachandran, V., Kang, J., Kishimoto, T. K., Cummings, R. D., and

McEver, R. P. (1998) J. Biol. Chem. 273, 7078–708725. Sperandio, M., Thatte, A., Foy, D., Ellies, L. G., Marth, J. D., and Ley, K.

2 S. Giraud, C. Abbal, M. P. Bernimoulin, M. Gikic, A.-S. Rivier,M. Schapira, and O. Spertini, manuscript in preparation.

Molecular Basis of PSGL-1 Interactions with L-selectin46

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

(2001) Blood 97, 3812–381926. Epperson, T. K., Patel, K. D., McEver, R. P., and Cummings, R. D. (2000)

J. Biol. Chem. 275, 7839–785327. Wilkins, P. P., McEver, R. P., and Cummings, R. D. (1996) J. Biol. Chem. 271,

18732–1874228. Snapp, K. R., Heitzig, C. E., Ellies, L. G., Marth, J. D., and Kansas, G. S. (2001)

Blood 97, 3806–381129. Ellies, L., Tsuboi, S., Petryniak, B., Lowe, J. B., Fukuda, M., and Marth, J. D.

(1998) Immunity 9, 881–89030. Maly, P., Thall, A., Petryniak, B., Rogers, C. E., Smith, P. L., Marks, R. M.,

Kelly, R. J., Gersten, K. M., Cheng, G., Saunders, T. L., Camper, S. A.,Camphausen, R. T., Sullivan, F. X., Isogai, Y., Hindsgaul, O., von Andrian,U. H., and Lowe, J. B. (1996) Cell 86, 643–653

31. Weninger, W., Ulfman, L. H., Cheng, G., Souchkova, N., Quackenbush, E. J.,Lowe, J. B., and von Andrian, U. H. (2000) Immunity 12, 665–676

32. Homeister, J. W., Thall, A. D., Petryniak, B., Maly, P., Rogers, C. E., Smith,P. L., Kelly, R. J., Gersten, K. M., Askari, S. W., Cheng, G., Smithson, G.,Marks, R. M., Misra, A. K., Hindsgaul, O., von Andrian, U. H., and Lowe,J. B. (2001) Immunity 15, 115–126

33. Rodgers, S. D., Camphausen, R. T., and Hammer, D. A. (2001) Biophys. J. 81,2001–2009

34. Leppanen, A., White, S. P., Helin, J., McEver, R. P., and Cummings, R. D.(2000) J. Biol. Chem. 275, 39569–39578

35. Ramachandran, V., Nollert, M. U., Qiu, H. Y., Liu, W. J., Cummings, R. D.,Zhu, C., and McEver, R. P. (1999) Proc. Natl. Acad. Sci. U. S. A. 96,3771–13776

36. Spertini, O., Kansas, G. S., Reimann, K. A., Mackay, C. R., and Tedder, T. F.(1991) J. Immunol. 147, 942–949

37. Spertini, O., Cordey, A.-S., Monai, N., Giuffre, L., and Schapira, M. (1996)J. Cell Biol. 135, 523–531

38. Xie, X., Rivier, A.-S., Zakrzewicz, A., Bernimoulin, M., Zeng, X.-L., Wessel,H. P., Schapira, M., and Spertini, O. (2000) J. Biol. Chem. 275,34818–34825

39. Sako, D., Chang, X.-J., Barone, K. M., Vachino, G., White, H. M., Shaw, G.,Veldman, G. M., Bean, K. M., Ahern, T. J., Furie, B., Cumming, D. A., andLarsen, G. R. (1993) Cell 75, 1179–1186

40. Jackson, R. J., Howell, M. T., and Kaminski, A. (1990) Trends Biochem. Sci. 15,477–483

41. Jang, S. K., Krausslich, H. G., Nicklin, M. J., Duke, G. M., Palmenberg, A. C.,and Wimmer, E. (1988) J. Virol. 62, 2636–2643

42. Rees, S., Coote, J., Stables, J., Goodson, S., Harris, S., and Lee, M. G. (1996)BioTechniques 20, 102–110

43. Giuffre, L., Cordey, A.-S., Monai, N., Tardy, Y., Schapira, M., and Spertini, O.(1997) J. Cell Biol. 136, 945–956

44. Ting-Beall, H. P., Needham, D., and Hochmuth, R. M. (1993) Blood 81,2774–2780

45. Sali, A., and Blundell, T. L. (1993) J. Mol. Biol. 234, 778–81546. Chotia, C., and Lesk, A. M. (1986) EMBO J. 5, 823–82647. Martin, A. C. R., MacArthur, M., and Thornton, J. (1997) Proteins: Struct.

Funct. Genet. 1, 14–2848. Moult, J., Fidelis, K., Zemla, A., and Hubbard, T. (2001) Proteins: Struc. Funct.

Genet. 45, 2–749. Guex, N., and Peitsch, M. C. (1997) Electrophoresis 18, 2714–272350. McDonald, I. K., and Thornton, J. M. (1994) J. Mol. Biol. 238, 777–79351. Ma, Y. Q., and Geng, J. G. (2002) J. Immunol. 168, 1690–169652. Koradi, R., Billeter, M., and Wuthrich, K.(1996) J. Mol. Graph. 14,

51–55:29–3253. Dunbrack, R. L. J., and Karplus, M. (1994) Nat. Struct. Biol. 1, 334–34054. Dunbrack, R. L. J., and Karplus, M. (1993) J. Mol. Biol. 230, 543–57155. Tu, L., Delahunty, M. D., Ding, H., Luscinskas, F. W., and Tedder, T. F. (1999)

J. Exp. Med. 189, 241–25256. Li, F., Wilkins, P. P., Crawley, S., Weinstein, J., Cummings, R. D., and

McEver, R. P. (1996) J. Biol. Chem. 271, 3255–326457. Goetz, D. J., Greif, D. M., Ding, H., Camphausen, R. T., Howes, S., Comess,

K. M., Snapp, K. R., Kansas, G. S., and Luscinskas, F. W. (1997) J. Cell Biol.137, 509–519

58. Leppanen, A., Mehta, P., Ouyang, Y. B., Ju, T. Z., Helin, J., Moore, K. L., vanDie, I., Canfield, W. M., McEver, R. P., and Cummings, R. D. (1999) J. Biol.Chem. 274, 24838–24848

59. Pouyani, T., and Seed, B. (1995) Cell 83, 333–34360. Sako, D., Comess, K. M., Barone, K. M., Camphausen, R. T., Cumming, D. A.,

and Shaw, G. D. (1995) Cell 83, 323–33161. Wilkins, P. P., Moore, K. L., McEver, R. P., and Cummings, R. D. (1995) J. Biol.

Chem. 270, 22677–2268062. Ouyang, Y. B., Lane, W. S., and Moore, K. L. (1998) Proc. Natl. Acad. Sci.

U. S. A. 95, 2896–290163. Moore, K., Stults, N., Diaz, S., Smith, D., Cummings, R., Varki, A., and

McEver, R. (1992) J. Cell Biol. 118, 445–45664. MacKerell, J., A. D, Bashford, D., Bellott, M., Dunbrack Jr., R. L., Evanseck,

J. D., Field, M. J., Fischer, S., Gao, J., Guo, H., Ha, S., Joseph-McCarthy, D.,Kuchnir, L., Kuczera, K., Lau, F. T. K., Mattos, C., Michnick, S., Ngo, T.,Nguyen, D. T., Prodhom, B., Reiher III, W. E., Roux, B., Schlenkrich, M.,Smith, J. C., Stote, R., Straub, J., Watanabe, M., Wiorkiewicz-Kuczera, J.,Yin, D., and Karplus, M. (1998) J. Phys. Chem. 102, 3586–3616

65. Lawrence, M. B., and Springer, T. A. (1991) Cell 65, 859–87366. Alon, R., Chen, S., Puri, K. D., Finger, E. B., and Springer, T. A. (1997) J. Cell

Biol. 138, 1169–118067. Chen, S., and Springer, T. A. (1999) J. Cell Biol. 144, 185–20068. Wallace, A. C., Laskowski, R. A., and Thornton, J. M. (1995) Protein Eng. 8,

127–13469. McDonald, I. K., and Thornton, J. M. (1995) Protein Eng. 8, 217–224

Molecular Basis of PSGL-1 Interactions with L-selectin 47

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Martinez, Olivier Michielin, Marc Schapira and Olivier SpertiniMichael Pierre Bernimoulin, Xian-Lu Zeng, Claire Abbal, Sylvain Giraud, Manuel

CORE-2 O-GLYCANS AND OF TYROSINE SULFATE RESIDUE 51 Molecular Basis of Leukocyte Rolling on PSGL-1: PREDOMINANT ROLE OF

doi: 10.1074/jbc.M204360200 originally published online October 25, 20022003, 278:37-47.J. Biol. Chem. 

  10.1074/jbc.M204360200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/278/1/37.full.html#ref-list-1

This article cites 69 references, 33 of which can be accessed free at

by guest on October 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from