the jo~al of chemistry vol. 269, no. 37, issue of 16 ... · a novel candidate metastasis-associated...

THE J O ~ A L OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 37, Issue of September 16, pp. 2295S22963, 1994 Printed in U.S.A.

A Novel Candidate Metastasis-associated Gene, mtal, Differentially Expressed in Highly Metastatic Mammary Adenocarcinoma Cell Lines cDNA CLONING, EXPRESSION, AND PROTEIN ANALYSES*

(Received for publication, June 9, 1994)

Yasushi Toh, Scot D. Pencil$, and Garth L. NicolsonO From the Department of %mor Biology, University of nxas M. D. Anderson Cancer Center, Houston, Texas 77030

To understand the genes involved in breast cancer invasion and metastasis, we analyzed a novel candidate metastasis-associated gene, mtul, which was isolated by differential cDNA library screening using the 13762NF rat mammary adenocarcinoma metastatic system. Northern blot analyses showed that the mRNA expression level of the mtal gene was 4-fold higher in the highly metastatic cell line MTLn3 than in the nonmetastatic cell line MTC.4. The mtul gene was expressed in various normal rat organs, especially in the testis, suggesting its essential normal function. The mRNA expression levels of the human homologue of this gene also correlated with the metastatic potential in two human breast cancer metastatic systems. The full-length mtul cDNA sequence contained an open reading frame encoding a protein of 703 amino acid residues, and sequence analysis by data base homology search indicated that mtul is a novel gene. The Mtal protein contained several possible phosphorylation sites, and a proline-rich amino acid stretch at the carboxyl-terminal end completely matched the consensus sequence for the src homology 3 domain-binding motif. Using antibodies raised against glutathione S-transferase-Mtal fusion protein or a synthetic oligopeptide, Western blots showed that the molecular mass of the Mtal protein was “80 kDa, and the levels of the Mtal protein also correlated with the metastatic potential, results similar to those obtained from the Northern analyses. Thus, the novel gene mtal may encode a molecule that is functional in normal cells as well as in breast cancer invasion and metastasis.

The mortality from breast cancer as well as from other solid malignancies is almost entirely the result of invasion and metastasis of neoplastic cells from the primary tumors to distant organ sites; therefore, understanding the genes and gene products involved in breast cancer metastasis is an important research goal. Metastasis is a complex series of events that in- volves several gene products, including those important for the

* This work was supported by NCI Grants R01-CA63045 and R35- CA44342 (to G. L. N.) from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertise- ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U02522.

$ Present address: Dept. of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609.

fj To whom correspondence should be addressed: Dept. of Tumor Bi-

Holcombe Blvd., Houston, TX 77030. Tel.: 713-792-7477; Fax: 713-794- ology, Box 108, University of Texas M. D. Anderson Cancer Center, 1515

0209.

invasion and detachment of neoplastic cells from the primary tumor, penetration into blood and lymphatics, arrest at distant sites by adhesion to endothelial cells, extravasation, induction of angiogenesis, evasion of host antitumor responses, and growth at metastatic sites (1, 2). The regulated expression of several tumor cell genes is thought to be important in this process (2-5).

Several techniques have been used to search for genes involved in the metastatic cascade, including somatic cell fusion, karyotypic analysis, transfection of isolated genes into recipi- ent cells, and differential or subtraction cDNA hybridization. This last technique has met with success in many, but not all, research areas (6). Genes that have been identified as differentially expressed and possibly involved in the metastasis of breast cancers by this method are mts-1, nm23, WDNM-1, WDNM-2, pGM21, and stromelysin-3 (7-12). The relevance of these genes to breast cancer metastasis varies dramatically. We have used rat mammary adenocarcinoma cell clones of increas- ing metastatic potential in experimental and spontaneous metastasis assays (13) to identify 10 differentially expressed genes that are associated with metastasis (14). In this system, gene expression was compared between the nonmetastatic cell line MTC.4, which is phenotypically stable during prolonged pas- sage in vivo or in vitro, and the highly metastatic cell line MTLn3 (15). Such stability is beneficial for differential hybridization analysis and identification of differentially expressed genes, and it is also essential for gene transfer experiments (15). Partial sequencing of these cDNAclones revealed that two of them had no homologous nucleotide sequences in the GenBankm/EMBL Data Banks. In this study, we determined the complete sequence of one of these novel cDNAs, mtal, which was originally identified as cDNA clone 10.14 (141, and studied the levels of expression of mtal in tumor cells and normal tissues. Furthermore, we expressed this cDNA in Escherichia coli, generated antibodies against the Mtal protein, and analyzed the gene product.

EXPERIMENTAL PROCEDURES Cell Lines-Rat mammary adenocarcinoma cell lines MTC.4,

MTLn2, and MTLn3 were derived from the 13762NF tumor (13). MTC.4 was a subclone of the MTC cell line, derived from the primary tumor growing in the mammary fat pad. This line is phenotypically stable and has no ability to metastasize from a primary implant in the mammaly fat pad or after intravenous injection (15). MTLn3 was derived from a spontaneous lung metastasis and is highly metastatic in syngeneic rats. MTLn2 was derived from the lung metastasis cell line MTLn, which is metastatic, but MTLn2 subsequently lost its metastatic properties (13). The human breast adenocarcinoma cell lines MDA-MB-231 and MDA- MB-468 (provided by Dr. J. E. Price, University of Texas M. D. Anderson Cancer Center) are metastatic and nonmetastatic in nude mice, respectively (16). Another human breast adenocarcinoma cell line, MCF-7 (provided by Dr. G. Heppner, Michigan Cancer Foundation), is noninvasive and nonmetastatic, whereas its derivatives, MCF7LCC1 and MCF7LCC2 (provided by Dr. N. Brunner, Finsen Laboratory, Copen-

22958

A Novel Candidate Metastasis-associated Gene, mtal 22959 hagen), are invasive, and the latter is metastatic (17, 18). All cell lines were cultured in either a-modified minimum essential medium (rat lines) or a 1:l mixture of Dulbecco's modified minimum essential medium and Ham's F-12 medium (human lines) containing 5% fetal bovine serum without antibiotics a t 37 "C in a humidified incubator (5% CO,, 95% air).

Total RNA Preparation and Northern Blot Analysis-Total cellular RNAs were isolated from growing (5&80% confluent) cultured cells or normal Fisher 344 rat organs with TRI Reagentm (Molecular Research Center, Inc., Cincinnati, OH). Ten pg of each total RNA was separated by electrophoresis through 6% formaldehyde, 1.2% agarose gel and transferred onto a nylon membrane. The filter was hybridized with 32P-labeled p10.14-C4.5 cDNA probe or 32P-labeled glyceraldehyde-3- phosphate dehydrogenase cDNA probe. After hybridization and wash- ing, autoradiography was accomplished with an intensifying screen at -80 "C. Quantification of bound radioactivity was performed using a Betascope 603 instrument (Betagen, Waltham, MA).

Screening of Rat Mammary Adenocarcinoma cDNA Libraries and Subcloning"MTLn3 and MTC.4 cDNA libraries (oligo(dT)-primed) were constructed with hZapII bacteriophage (Stratagene, La Jolla, CAI and used for differential hybridization screening as described previously (14). To obtain a full-length mtal cDNA, both libraries were used for screening with the originally isolated 10.14 cDNAclone (2.2 kilobase pairs) as a probe. Hybridization-positive clones were single plaque- isolated, and their cDNA inserts in the plasmid vector pBluescript SK- were excised in vivo from the phage vector according to the protocol provided by the manufacturer (Stratagene). The sizes of the inserts were examined by restriction digestion, followed by electrophoresis and ethidium bromide staining. The clone with the longest insert (~10.14- C4.5) was used for further study.

DNA Sequencing-After restriction mapping of the mtal cDNA clone p10.14-C4.5, a number of subclones were constructed, and the nucleotide sequences were determined for both cDNA strands. Sequencing was performed with an Applied Biosystems Automated Sequencer or in part with the Sequenase version 2.0 sequencing kit (United States Biochemical Corp.).

Computer Analyses of Nucleotide and Amino Acid Sequences-The nucleotide and deduced amino acid sequences derived from the mtal cDNAclone p10.14-C4.5 were compared to known sequences in the data bases using the BLAST network service of the National Center for Biotechnology Information. The protein motifs of the Mtal protein were searched using GCG software (Genetic Computer Group, University of Wisconsin, Madison, WI). Other features, such as hydropathy, were analyzed using DNA StriderTM 1.1.

Expression and Purification of Glutathione S-Dansferase Fusion Proteins-The SacII-BstEII fragment of the p10.14-C4.5 cDNA, which contains the whole open reading frame (see Fig. 2 A ) , was purified, and both of the ends were made blunt with T4 DNA polymerase. After ligation of the EcoRI-Not1 adaptor (Pharmacia Biotech, Inc.), the DNA fragment was inserted into the EcoRI site of the prokaryotic expression vector pGEX-2TH. A plasmid clone with the insert in the proper orientation was selected, and the nucleotide sequences at and around the junction of ligation were determined to confirm the in-frame ligation using the Sequenase version 2.0 sequencing kit. In a similar way, a plasmid containing the SacII-SmaI fragment (NH,-terminal portion of the open reading frame, 387 amino acid residues) of the p10.14-C4.5 cDNA was constructed.

The expression and purification of a glutathione S-transferase fusion protein was carried out as described previously (19). Briefly, logarith- mically growing cultures of E. coli strain NM522 containing the pGEX- 2TH recombinants were incubated with 0.05 mM isopropyl-1-thio-P-D- galactopyranoside at room temperature overnight. The cells were harvested; suspended in phosphate-buffered saline containing 1 mM phenylmethylsulfonyl fluoride, 3% aprotinin, and 1% Triton X-100; and sonicated. After ultracentrifugation (10,000 x g, 4 "C, 30 min), the su- pernatant was applied to a glutathione-Sepharose 4B column (Pharma- cia) and eluted with a solution of 50 mM Tris-HC1 (pH 9.6 at 4 "C) and 5 mM glutathione (Sigma). Insoluble protein (inclusion bodies) was purified by a modification of the method of Frangioni and Nee1 (20). The pellet was suspended in phosphate-buffered saline containing 1.5% N- laurylsarcosine (Sarkosyl), Triton X-100 was added (2% final concen- tration), and the solution was subjected to ultracentrifugation and purification as described above. Purified glutathione S-transferase fusion protein was applied to SDS-polyacrylamide gel and stained with Coo- massie Brilliant Blue.

Generation of Polyclonal Rabbit Anti-Mtal Antibodies-Antibodies against GST-Mtal fusion protein or against a synthetic oligopeptide (MWKTTDRWQQKRLK) conjugated with keyhole limpet hemocyanin

were raised in male New Zealand rabbits on a biweekly injection sched- ule. The sera were collected 14 days after the last boost.

Western Blotting-Cells were lysed in phosphate-buffered saline containing 0.5% Nonidet P-40, 100 pg/ml phenylmethylsulfonyl fluoride, and 2 pg/ml aprotinin. Samples were separated on an 8% SDS-polyacrylamide gel and transferred to a nitrocellulose filter. After blocking, the filter was incubated with 1:500 diluted anti-Mtal antibodies for 1 h and washed with phosphate-buffered saline containing 0.3% Tween 20. The filter was then incubated with horseradish peroxidase-conjugated anti- rabbit IgG antibody (Sigma) for 40 min, and specific proteins were detected using an enhanced chemiluminescence system (Amersham Corp.). For the competition assay, diluted antibodies were preincubated with 1 pg of GST-Mtal fusion protein or 0.1 pg of the synthetic oligopeptide for 1 h a t 4 "C.

RESULTS

Of the several cDNA clones that were isolated by differential hybridization screening between the highly metastatic cell line MTLn3 and the nonmetastatic cell line MTC.4, only two were unrelated to known genes after searches of the GenBankTM/ EMBL Data Banks (14). The full-length cDNA of one of these clones, originally designated clone 10.14 (14), was named mtal and was further analyzed.

Northern Blot Analyses of Novel Gene mtal in Rats and Humans-To confirm the differential expression of the mtal gene between the metastatic MTLn3 and nonmetastatic MTC.4 cell lines, we examined its steady-state mRNA levels (Fig. lA). Both cell lines expressed mtal mRNA of -3.0 kilobases in size, and the expression level was estimated to be 4-fold higher in the highly metastatic MTLn3 cell line after normalization with glyceraldehyde-3-phosphate dehydrogenase (Fig. lA).

The tissue distribution of mtal mRNA was examined in the major organs of the rat. This gene was expressed at low levels in various normal rat organs, including brain, heart, lung, liver, and kidney, but mtal mRNA was expressed at high levels in the testis (Fig. 1B).

Southern blotting showed that there are counterparts of the rat mtal gene in the human and mouse genomes (data not shown). Therefore, we examined the expression of the human homologue of the mtal gene in two well characterized human breast adenocarcinoma cell lines. As shown in Fig. lC, human breast cancer cells also expressed a homologue of the mtal mRNA of approximately the same length as rat mtal mRNA. The human breast cancer cell line MCF-7, derived from the pleural effusion of a breast cancer patient, is noninvasive and nonmetastatic in nude mice, whereas its derivatives, MCF7/ LCCl and MCF7LCC2, are invasive and metastatic (17, 18). The expression ratio of the mtal gene between nonmetastatic and metastatic cell lines was estimated by normalization with a glyceraldehyde-3-phosphate dehydrogenase probe to be MCF- 7:MCF7LCCl:MCF7/LCC2 = 1:2:4. The human breast cancer line MDA-MB-468 is nonmetastatic and MDA-MB-231 is metastatic in nude mice (16). The expression of the mtal gene in MDA-MB-231 cells was calculated to be -4 times as high as in MDA-MB-468 cells. Thus, the steady-state mRNA level of the mtal gene homologue in human breast cancer cell lines correlated with their metastatic or invasive potentials in nude mice.

Isolation of Full-length mtal cDNA and Determination of Nucleotide Sequence-As originally isolated, the 10.14 cDNA was 2.2 kilobase pairs long (141, while its mRNA was -3.0 kilobases. To obtain a full-length cDNA of mtal, the MTLn3 cDNA library was screened using the originally isolated 10.14 cDNA as a probe. However, the inserts of all of the cDNA clones obtained by this screening were shorter than the original clone (2.2 kilobase pairs). Therefore, the MTC.4 cDNA library was used for screening, although the frequency of mtal cDNA in this library was thought to be low. The insert sizes of the positive clones were determined by endonuclease digestion and subsequent electrophoresis, and clone p10.14-C4.5 was found

22960

A

28s-

18S+

B

28S+

18S+

C

cy m -I A c I- I I

A Novel Candidate Metastasis-associated Gene, mtal

0 0 c I

f mtal 3.0 kb

e* .. a f GAPDH 1.3 kb

f mtal 3.0 kb

*. ..1 f GAPDH

1.3 kb

1 2 3 4 5

28s t

e m t a 7 3.0 kb

18s t

4 GAPDH 1.3 kb

FIG. 1. Northern blot analysis of mtal gene. Ten pg of each total RNA was loaded per lane on a formaldehyde-agarose gel, transferred to a nylon membrane, and hybridized with the ”P-labeled mtal cDNA clone p10.14-C4.5. A, differential expression of the mtal gene in rat mammary adenocarcinoma cell lines. The cell lines MTLn2, MTLn3, and MTC.4 are poorly metastatic, highly metastatic, and nonmetastatic in the rat, respectively. B, expression of the mtal gene in various normal male Fisher 344 rat organs. C, differential expression of the mtal homologue gene in two human mammary adenocarcinoma metastatic systems. The cell lines MCF-7 (lane 1 ), MCF7LCCl (lane 2), and MCF7/ LCC2 (lane 3 ) are nonmetastatic, invasive, and metastatic, respectively. MDA-MB-468 (lane 4 ) and MDA-MB-231 (lane 5) are nonmetastatic and metastatic, respectively. Differences in the steady-state expression

to have the longest insert (-2.8 kilobase pairs) (data not shown). Taking the length of the poly(A)’ tail (-0.2 kilobases) into consideration, this cDNA clone was estimated to be nearly full-length. A partial restriction map of this cDNA clone is shown in Fig. 2 A . We determined the nucleotide sequence of clone p10.14-C4.5 for both strands using the Applied Biosys- tems Automated Sequencer. We also performed manual sequencing in some parts of the cDNA to alleviate misreading of the rare ambiguous sequences that were found using automated sequencing. The results showed that the p10.14X4.5 cDNA was 2756 base pairs long and contained a single open reading frame in only one of the three frames encoding a protein of 703 amino acid residues (Fig. 2B). A computer-assisted homology search was performed for this sequence at the Na- tional Center for Biotechnology Information using the BLAST network service on May 18, 1994, and no significant homology was found. In the full-length cDNA for the mtal gene, the initiation codon for translation was considered to be at nucleotides 97-99 (Fig. 2 B ) because the consensus sequence for initiation of translation (so-called Kozak’s rule) was well con- served in the mtal cDNA, especially for a purine a t position -3 and G a t position +4, which are thought to be essential (21).

The mtal cDNA can encode a protein of 703 amino acid residues (named Mtal) with a calculated molecular mass of 79.4 kDa. The estimated isoelectric point of the Mtal protein was 9.44. Hydropathy (Kyte-Doolittle) values were plotted for the predicted Mtal protein (40). The plot did not show any apparent membrane-spanning or membrane-associated re- gions, nor was there an NH,-terminal signal sequence. This protein is quite hydrophilic, suggesting that it is not a cell- surface protein, nor is it a secreted protein requiring a signal sequence. The protein contained 12 dispersed cysteine residues that may be capable of forming intra- and/or intermolecular disulfide bonds to stabilize the protein structure.

Expression of GST-Mtal Fusion Protein in E. coli and Analy- ses of Mtal Protein-The DNA fragments (the SacII-BstEII fragment containing the entire open reading frame and the SacII-SmaI fragment containing the NH,-terminal portion of 387 amino acid residues of the open reading frame of the mtal cDNA) (Fig. 2 A ) were inserted into the prokaryotic expression vector pGEX-2TH in the appropriate orientation. Fig. 3A shows the induction of GST-Mtal fusion protein in E. coli by isopropyl-1-thio-P-D-galactopyranoside and the results of purification of the induced fusion protein using a glutathione column. The protein from the entire open reading frame was expressed as a fusion protein with the expected molecular mass of -108 kDa (glutathione S-transferase is 26 kDa, and there are intervening residues of -3 kDa) (Fig. 3A, lanes 1 3 ) . The NH, terminus of the Mtal protein (387 amino acid residues or -44 kDa) was expressed as a protein with the expected molecular mass of 73 kDa (lanes 4-6). Both of the proteins were purified by glutathione affinity column chromatography (lanes 3 and 61, indicating that the open reading frame found in the p10.14X4.5 cDNA is substantially translated into protein. Most of the extra bands of lower molecular masses found during purification ap- peared to be products that were degraded in the bacterial cells.

We generated the polyclonal rabbit antibodies against the purified glutathione S-transferase fusion protein containing the NH,-terminal half of the Mtal protein and a synthetic oligopeptide (MWKTTDRYVQQKRLK) corresponding to amino acid residues 329-343 (Fig. 2B). Using these antibodies, we performed Western blot analyses with a MTLn3 cell lysate (Fig. 3B). Both anti-GST-Mtal fusion protein antibodies and anti-

level of the mtal gene were estimated by normalization with respect to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA. kb, kilobases.

A Novel Candidate Metastasis-associated Gene, mtal 22961

FIG. 2. Characterization of full- length mtal cDN.4. A, partial restriction map of clone p10.14-C4.5. The open reading frame is shown by a bold line. B , nucleotide sequence of the mtal cDNA

the Mtal protein (one-letter code). The se- and the putative amino acid sequence of

quence numbers of the nucleotides and amino acids are indicated on the right

tiation codon ATG is underlined, and the side of the sequences. The translation ini-

termination codon TAG is indicated by as- terisks. Possible phosphorylation sites for tyrosine kinase ( T Y K ) , protein kinase C (PKC), and casein kinase 2 (CK2) are shown; putative N-glycosylation sites (N- GLY) are also shown. These protein motifs of the Mtal protein were found using GCG software. A proline-rich stretch (possible src homology 3 domain-binding site (SH3-Binding)) is also shown close to the carboxyl-terminal end.

A 71

Sad I 656 1254 1M8 1895 2210 2556

Smd Hindlll BsKI &E11 Dmi Ead

6 CCGCCCCCCCCCCCCCCCCCGCCCCCGCCCCGGCCC~GCCCGGCCCCCCGCCCCCGCCCGCGCCCCGCGCCCGCGCCCCCGCCGCCGGC 90

C C C C ~ ~ C C C C C C I ~ C A T G T ~ ~ G T C ~ ~ ~ A C ~ T A T G T C T A

TYK N-GLY Y A A N M Y B V G D Y V X P E ~ S S S N P Y L I R R I E

G A C C T C M T A P I C ~ ~ ~ ~ T G T ~ C ~ T G G Z G T G T T T C T ~ A C - ~ A T Z T C C ~ A C C C T C A Z C G C G C T G E L U A N G N V E A K V Q C F Y R R R D I S S S L I A L

G C T C ~ A T C C I L C C C Z G T ~ Z C T ~ T A T A C ~ C f f i ~ C G G G G C C G G ~ C G G C G ~ ~ ~ ~ T f f i ~ ~ ~ T A C M A D K H A T L S V C Y R A G P C A D 3 C E E G E V E E E V E

~ C C M ~ Z C C T A C ~ C T ~ C T ~ T T A P I C ~ C ~ T ~ G G C A T C G f f i ~ T G T T C C T C T C T C G G C A C T T f f i A C T C T C T G C C T N P E M V D L P E K L K E Q L R E R E L F L S R Q L E S L P

N-GLY

CK2

180 28

270 58

360 88

450 118

CCCACCCILCATCPICGCGCAPICZ~ACTGTT~CCTGCTCMT~C~TC~TCAPICTCCT~CTff iACCGTGACGATTTCTTCTTC 5 4 0 A T H I R C K C S V T L L ~ B ~ E S L K S Y L E R E D F F F 148

T A C T C T C T A C T C T ~ W C ~ ~ ~ C C T C C T ~ T ~ T ~ G ~ Z T C G T G T ~ C ~ ~ ~ T ~ C A C G C T G ~ A T C ~ T 630 Y S L V Y D P Q Q K T L L A D K C E I R V G N R Y Q A D I T 178

C A T T T C C T ~ G G T ~ ~ C ~ ~ T ~ T C ~ C T f f i ~ C ~ T G T ~ ~ C C ~ M T C C ~ T T G T M A T ~ 720 D L L K D G E E D G R D Q S K L H T K V W P A X N P L V D K 208

CACATTWICCACTTTCTffiTffiTffiCCCCCTCTGTGGGT~CTTTCC~G~CCTffiATTCCACCACCTCCGTGC~ACCCTACCCTG 810 Q I D Q B L V V A R S V G T P A R A L D C S S S V R P P S L 238

C A C A T G A C T C C C C C C C C A C C C T C C C G ~ A T C ~ C C T G T T T C A T C C C A T ~ ~ ~ T ~ ~ ~ A T C T ~ G ~ A T C T C C ~ C 900 E X S A A A A S R D I T L F E A M D ~ L E K N I Y D I S K A 268

A T C T C T G C C C T T G T C C C T C P T G ~ ~ T ~ Z C T G C A C G G A T ~ ~ ~ ~ ~ T ~ A T C ~ ~ C C ~ C T T T T T G A C G M 990 I S A L V P Q G G P V L C R D E M E E W S A s E A N L F E E 298

C C T C T C G ~ T A T f f i ~ A T Z T C ~ ~ A T T C ~ ~ Z T T C T C C ~ T f f i ~ T C G C T C ~ C ~ C A T C A T T ~ T A T T A C T A C 1080 A L E K Y C K D F T D I Q Q D I L P W K S L T S I I E Y Y Y 328

A T G T G W L P I C ~ C ~ C O 1 C ~ T ~ G T C ~ A C ~ G T T T ~ C ~ Z G ~ ~ A P I C T T - A C G T T T A T A T T C C C ~ 1170 M W K T L P _ B Y V Q Q K R L K A A E A E S K L K Q V Y I P N 358

T A T ~ ~ C I L A A C C C P C ~ T ~ G T C ~ A C T G ~ ~ T G Z A C T ~ T ~ ~ ~ ~ C M G C C A C ~ C C C G G G 1260 Y N K P N P N Q I S V N S V 4 A S V V ~ G T P G Q S P G 388

C C C C G T C C C C C C T C C C - Z G T T ~ A C ~ ~ A C Z C T T ~ ~ ~ T A T T C T T G f f i G T C C C C C T ~ A T ~ A C T G ~ ~ C T C Z C C G C A 1350 A C B A C E S C Y T T Q S Y O N Y S N G P P N M Q C R L C A 418

N-GLY PKC CK2

CK2

PKC

CK2

CK2

PKC

PKC N-GLY

TYK

~ T C C C C A T C G C A T C C C ~ T C G ~ A C T G G G A C C C C C ~ T T T C C C A T G ~ - ~ C T T C T ~ C T G C A T ~ T ~ C A P I C T T G 1 5 3 0 S P E G I P A R S S C S P K F A M K T R Q A F Y L H 3 T K L 478

ACACGCATTGCCCOCCCCTTGTGCCGTGACATCCT~GCCCAT~CATCCCGCILCGCC~CCCT~T~CCATCMCACTGC~MTC 1620 T R I A R R L C R E I L R P W H A A R H P Y M P I N S A A I 508

A A G G C T G M T G C A C A C C A C G C C T O C C C G ~ C T T C C C ~ R G C C C ~ T G G T G C T G ~ C M G T ~ T A C ~ ~ C C C C T G G ~ G C T G T G C T C 1710 K A E C 3 A R L P E A S Q S P L V L K Q V V R K P L E A V L 538

PKC PKC

PKC CGGTATCTTCPIOPrCTCATCCCCGCCCGCCT~CCCGILCCCTGTGAPICRGCTCATCCACTGTGCTCRGC~TCTG~CCCTGCC~TCA 1800 R Y L E T E P R P P K P D P V K S S S S V L S S L T P A K S 568

G C C C C T C T C A T C A A C M T G G C T C C C C T ~ C A T C T T G G G C A P I C ~ G A C C T A Z G A C C ~ ~ M T G G G G T A C A T G G T C T f f i C ~ C A T G G A 1890 A P V I N N G S P T I L G K R S Y E Q E N G V D G L A N H G 598

C M ~ C A C C C ~ A T G C G ~ C A P I C T C G G M T C T C C Z C C T C ~ T G G G ~ T C C T ~ C C C A C C ~ T G C G C C T M T C C G ~ G G C T C C C T G 1980 Q T R E M G P S R N L L L N C K S Y P T K V R L I R G G S L 628

C C T C C A C C T C ~ C G C C C C C C ~ T G ~ T G G A T T G A C G C C C C A C A T G A T G T A T T T T ~ A T G G C C ~ C G ~ G A C ~ C ~ G ~ T C C G ~ 2070 P P V K R R R W N W I D A P D D V F Y M A T ~ E 3 R ~ I R K 658

PKC CTGCTCTCATCTTCACPC~GTCCTGCCCGCCG~CCTILCAPICCCTATTCCCCTGCGCCACACCC~CCZGCCGCTGCGCCCA 2160

L L S R S E 3 K ~ A A R R P Y K P I A L R Q S Q A L P l ~ R P 688

CCCCCACCTCC~CMTCMTGATGRGCCCATTGTTATTGACGACT~GCGGTCACCC~~TGGCCTGCCTGffiCCCCTCCATCACCCC 2250 703

CRGACTATCC~TGACGCCZGC~ACCCCRAGCGGCCTCCCTCCCCCACCPIOACTGCTGCCC~CCCACCCTCTGTTTCCGTMTGCCCC 2340

.

CK2 PKC SH3-Binding

P P P A E V N D E P I V I E D * " SH3-Binding

~ T C C C C C C C T C A C A T G C M A C ~ T C C T C C T C C T G G T G G A C A T G C G G G G G A P I C ~ T G T G G Z C T ~ T T A T T C C ~ A C ~ C G ~ P I O 2130 TCTTTTTTACCTTTCTGTTT~TTTCTGCCTG~CAC~AT~GMTGCCCTff iGCCGTGGGCTGC~CCCTTCTCACCTGGGGTGCC 2 5 2 0 C T C T R A G G T T T T G T T G T G T T C T G T T G A P I C G T G C C A T T T T T T A 2610 CACCTGGMTGTTMGATTffiTGCACCCACCACCGGCC~CTGCCT~C~GGZTGGTCCCTTGTCTTTTCRAGTMTTTTCATATTM 2700 ACAAAAACAA?GACTC&TMAA?&GMA&CCCC- 2 7 5 6

peptide antibodies recognized bands of -80 kDa (lanes 2 and we examined the synthesis levels of the Mtal protein in those 4 ) . These bands decreased in intensity (lane 3 ) or disappeared cell lines that were used for Northern blot analyses. As shown (lane 5 ) after preincubation of the antibodies with each im- in Fig. 3C, the anti-GST-Mtal fusion protein antibodies cross- munogen. These data indicate that the Mtal protein is synthe- reacted with the human Mtal protein, and differences in the sized in the cells and that its molecular mass is -80 kDa. Next, expression of the Mtal protein were observed (-4-fold higher

22962 A Novel Candidate Metastasis-associated Gene, mtal

A M I 2 3 4 5 6

200 *

116 .’

97

66 I

B 1 2 3 4 5

. ._ ”..

200-

97 - 66 - 4

45 -

C 1 2 3 4 5 6 7

97-

66-

FIG. 3. Expression and Western blot analyses of Mtal protein. A, expression of GST-Mtal fusion protein in E. coli. The entire (SacII- BstEII fragment in Fig. 2 . 4 ) (lanes 1 3 ) or the NH,-terminal half(SacI1- SmaI fragment) (lanes 4-6) of the open reading frame of the Mtal protein was inserted into the prokaryotic expression vector pGEX-2TH and expressed in E. coli. Lanes 1 and 4 and lanes 2 and 5 represent the crude bacterial lysates before and after induction with isopropyl-l-thio- /3-u-galactopyranoside, respectively. Lanes 3 and 6 represent the purified fusion protein. The bands with the expected molecular masses are

the Mtal protein. Ninety pg of MTLn3 cell lysate was loaded on each indicated by arrowheads. B, Western blotting and competition study of

lane, and after electrophoresis, the proteins were transferred to a nitrocellulose filter. A negative control using normal rabbit serum is shown (lane I ) . The Mtal protein was detected with anti-peptide antibodies (lanes 2 and 3) and anti-GST-Mtal fusion protein antibodies (lanes 4 and 5 ) . In lanes 3 and 5, the antibodies were preincubated with 0.1 pg of the peptide or with 1 pg of purified GST-Mtal fusion protein, respectively. Molecular mass standards (in kilodaltons) are indicated to the left. The Mtal protein is indicated by arrowheads. C, Western blotting of the Mtal protein from mammary adenocarcinoma metastatic systems. Lane 1, MTC.4; lane 2, MTLn3; lune 3, MCF-7; lane 4, MCF7/ LCC1; lane 5, MCF7LCC2; lane 6, MDA-MB-468; lane 7, MDA-MB- 231. Ninety pg of each lysate was loaded, and Western blotting was performed with anti-GST-Mtal fusion protein antibodies. Molecular mass standards (in kilodaltons) are shown to the left. The Mtal protein is indicated by arrowheads.

in metastatic cells) that were similar to the differences found by Northern blot analyses.

DISCUSSION

During tumor progression to the metastatic phenotype, quantitative as well as a few qualitative changes in gene ex-

pression occur (3). Differential or subtraction cDNA library screening techniques have been used to identify the genes relevant to the metastatic phenotype. Some of these differentially expressed genes may be involved in the metastasis of specific cancers, while others may be generally involved in the common steps of metastasis (7-12,22). In almost every case, the differences in expression of these genes in nonmetastatic compared with metastatic cells are not large, indicating that the metastatic phenotype is determined by quantitative changes, not qualitative changes, in gene expression (3). We have used the 13762NF rat mammary adenocarcinoma cell lines with different spontaneous metastatic potentials (13) to obtain differentially expressed genes (14). In contrast to mouse models of breast cancer, our rat metastatic model is known to be similar to human metastatic breast carcinomas in several respects, including similar pathology and mode of spread (13) as well as similar biochemical, immunological, and enzymological properties and other properties associated with metastasis (reviewed in Ref. 23).

In this study, we described a novel gene, mtal. The expression of this gene correlated with the metastatic potential in a metastatic rat mammary adenocarcinoma system and also in metastatic human breast carcinoma cell systems. Although the difference in expression of the mtal gene in nonmetastatic compared with metastatic cells is not large, it is consistent with the findings of others that most of the differentially expressed genes in metastatic cells are not differentially expressed at large ratios. For example, Dear et al. (10) found that the WDNM-2 gene was differentially expressed between nonmetastatic and metastatic cells to a similar degree (-4-fold) compared with our findings with the mtal gene. Furthermore, the enzymatic activity of type IV collagenase, which is well known to be correlated with the metastatic potential in a number of metastatic systems (21, was also shown to be -4-fold higher in metastatic than in nonmetastatic cells (24, 25). The cell line MTLn2 was cloned from the lung metastasis cell line MTLn, but lost its metastatic potential; these cells expressed levels of mtal mRNA similar to MTLn3 cells. MTLn2 cells are known to have a defect in the production of autocrine motility factor and are noninvasive, probably due to their lack of stimulation of motility by tumor cell-produced autocrine motility factor (26). Thus, the overexpression of mtal mRNA in MTLn2 cells is not unexpected. Because the MDA cell lines were derived from different tumors, it is likely that other molecular changes be- sides mtal expression distinguish the metastatic from the nonmetastatic phenotype. The existence and expression of the mtal homologue gene in human cells should allow us to screen for expression of this gene in biopsy specimens from breast cancer patients as well as in normal mammary tissue and other types of tumors and benign lesions.

The mtal gene was expressed in normal rat organs at rela- tively low levels, except for the testis, suggesting that it has an essential normal function. In the testis, spermatogenesis is a highly controlled process of proliferation, mitosis, meiosis, and differentiation, and this complex process is probably stimu- lated and regulated by a number of growth factors and cyto- kines in an autocrine and a paracrine fashion (27). In fact, a number of growth factors have been identified in the testis, in its secretions, and in isolated testicular cell types. Further- more, spermatozoa are highly motile and contain specific pro- teolytic enzymes and adhesion molecules (28), properties that are relevant to metastasis. The motile tails of sperm have long flagella that are powered by the hydrolysis ofATP generated in highly specialized mitochondria. I t is interesting that the mi- tochondrial gene ND5 (NADH dehydrogenase subunit 51, which is related to cell respiration and energy production, is overex-

A Novel Candidate Metasta

pressed in highly metastatic murine large cell lymphoma cell lines (22).

The protein motifs of the Mtal protein suggested that there are two potential phosphorylation sites for tyrosine kinases (29, 30). Nine and seven potential phosphorylation sites for protein kinase C (31,32) and casein kinase 2 (33) were also found (Fig. B), respectively. That the Mtal protein is a phosphoprotein remains to be determined. Although this protein had no obvious secretion signal peptide, there were four putative N-glycosylation sites. Other motifs, such as a leucine zipper and nuclear signal, were not observed. Interestingly, a proline-rich stretch at the carboxyl-terminal extremity at residues 684-693 (LPL- RPPPPAP) completely matched the consensus sequences for the src homology 3 domain-binding site, XPXXPPP@XP (34) or Xp@PpXP (35) (where X is nonconserved residues, P is proline, p is residues that tend to be proline, and @ is hydrophobic residues). The src homology 3 domains are considered to be involved in protein-protein interactions in signal transduction pathways (36) and in association with cytoskeletal components (37, 38) as well as in some other protein-protein interactions (39). The possible phosphorylation sites and the src homology 3 domain-binding site suggest that the Mtal protein may be involved in interactions with other proteins that are essential to normal cellular functions, such as signal transduction. We an- ticipate that this novel gene, mtal, could provide us with new information on the mechanism of breast cancer metastasis as well as on protein-protein interactions.

Acknowledgments-We thank Drs. Hideyuki Saya (Department of Oncology, Kumamoto University School of Medicine) and David G. Menter (Department of Tumor Biology, University of Texas M. D. Anderson Cancer Center) for helpful suggestions and discussion. We also thank Dr. Hiroshi Maruta (Ludwig Institute for Cancer Research, Melbourne, Australia) for providing the pGEX-2TH vector and E. coli strain NM522.

REFERENCES

2. Liotta, L. A., Steeg, P. S., and Stetler-Stevenson, W. G. (1991) Cell 64,327-336 1. Nicolson, G. L. (1988) Biochim. Biophys. Acta 948, 175-224

3. Nicolson, G. L. (1991) J. Cell. Biochem. 46, 277-283 4. Muschel, R., and Liotta, L. A. (1988) Carcinogenesis 9, 705-710 5. Chambers, A. F. (1993) Crit. Reu. Oncog. 4, 95-114 6. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A

Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

7. Ebralidge, A,, Tulchinsky, E., Grigorian, M., Afanasyeva, A,, Senin, V., Re- vazova, E., and Lukanidin, E. (1989) Genes & Deu. 3, 1086-1093

8. Steeg, P. S., Bevilacqua, G., Kopper, L., Thorgeirsson, U. P., Talmadge, J. E., Liottn, L. A., and Sobel, M. E. (1988) J. Natl. Cancer Inst. 8 0 , 200-204

uis-associated Gene, mtal 22963 9. Dear, T. N., Ramshaw, I. A,, and Kefford, R. F. (1989) Cancer Res. 48, 5203-

5209 10. Dear, T. N., McDonald, D. A,, and Kefford, R. F. (1989) Cancer Res. 49,5323-

5328 11. Phillips, S. M., Bendall, A. J., and Ramshaw, I. A. (1990) J. Natl. Cancer Inst.

82, 199-203 12. Basset, P., Bellocq, J. P., Wolf, C., Stoll, I., Hutin, P., Limacher, J. M., Podha-

jcer, 0. L., Chenard, M. P., Rio, M. C., and Chambon, P. (1990) Nature 348,

13. Neri, A., Welch, D., Kawaguchi, T., and Nicolson, G. L. (1982) J. Natl. Cancer 699-704

14. Pencil, S. D., "oh, Y., and Nicolson, G. L. (1993) Breast Cancer Res. n e a t . 25, Inst. 68, 507-517

15. Nicolson, G. L., Gallick, G. E., Spohn, W. H., Lembo T. M., and Tainsky, M. A. 165-174

16. Zhang, R. D., Fidler, I. J., and Price, J. E. (1991) Znuasion & Metastasis 11, (1992) Oncogene 7, 1127-1135

204-215 17. Thompson, E. W., Briinner, N., Toni, J., Johnson, M. D., Boulay, V., Wright,A.,

Lippman, M. E., Steeg, P. S., and Clarke, R. (1993) Clin. Ezp. Metastasis 11, 15-26

18. Briinner, N., Frandsen, T. L., Holst-Hansen, C., Bei, M., Thompson, E. W., Wakeling, A. E., Lippman, M. E., and Clarke, R. (1993) Cancer Res. 53, 3229-3232

19. Smith, D. B., and Johnson, K. S. (1988) Gene (Amst.) 67, 3140 20. Frangioni, J. V., and Neel, B. G. (1993) Anal. Biochem. 210,179-187

22. LaBiche, R. A,, Demars, M., and Nicolson, G. L. (1992) In Viuo (Athens) 6, 21. Kozak, M. (1989) J. Cell Biol. 108, 229-241

23. Nicolson, G. L. (1988) Breast Cancer Res. neat . 12, 167-176 24. Liotta, L. A., Tryggvason, K., Garbisa, S., Hart, I., Foltz, C. M., and Shalfie, S.

25. Nakajima, M., Welch, D. R., Belloni, P. N., and Nicolson, G. L. (1987) Cancer (1980) Nature 284, 67-68

26. Atnip, K. D., Carter, L. M., Nicolson, G . L., and Dabbous, M. K. (1992) Bio- Res. 47, 4869-4876

27. Niederberger, C. S., Shubhada, S., Kim, S. J., and Lamb, D. J. (1993) World J . chem. Biophys. Res. Commun. 146, 996-1002

28. Alberts, B., Bray, D., Lewis, J., Raf€, M. K., Roberts, K., and Watson, J. D. Urol. 11, 120-128

(1989) Molecular Biology ofthe Cell, 2nd Ed., Garland Publishing Inc., New York

317-324

29. Hunter, T. (1982) J. Biol. Chem. 267,4843-4848 30. Cooper, J. A., Esch, F. S., Taylor, S. S., and Hunter, T. (1984) J. Biol. Chem. 259,

31. Woodgett, J. R., Gould, K. L., and Hunter, T. (1986) Eur. J . Biochen. 161,

32. Kishimoto, A., Nishiyama, K., Nakanishi, H., Uratsuji, Y., Nomura, H.,

33. Pinna, L. A. (1990) Biochim. Biophys. Acta 1054, 267-284 34. Ren, R., Mayer, B. J., Cichetti, P., and Baltimore, D. (1993) Nature 259,1157-

35. Yu, H., Chen, J. K., Feng, S., Dalgarno, D. C., Brauer, A. W., and Schreiber, S.

36. Pawson, T., and Schlessinger, J. (1993) Cum Biol. 3, 434-442 37. Bar-Sagi, D., Rotin, D., Batzer, A., Mandiyan, V., and Schlessinger, J. (1993)

7835-7841

177-184

Takeyama, Y., and Nishizuka, Y. (1985) J. Biol. Chem. 260,12492-12499

1161

L. (1994) Cell 76,933-945

Cell 74. 83-91 38. Weng, Z., Taylor, J.A., Turner, C. E., Brugge, J. S., and Seidel-Dugan, C. (1993)

,~

J. Biol. Chem. 268. 14956-14963 39. Seidel-Dugan, C., Meyer, B. E., Thomas, S. M., and Brugge, J. S. (1992) Mol.

40. Toh, Y., Pencil, S. D., and Nicolson, G. L. (1994) Gene (Amst.), in press Cell. Biol. 12, 1835-1845

the jo~al of chemistry vol. 269, no. 37, issue of 16 ... · a novel candidate metastasis-associated...

Documents