the jak2 inhibitor fedratinib inhibits thiamine uptake – a ... · 7/25/2014 · published on...

DMD #58883

1

The JAK2 inhibitor fedratinib inhibits thiamine uptake – a putative

mechanism for the onset of Wernicke’s encephalopathy

Qiang Zhang, Yan Zhang, Sharon Diamond, Jason Boer, Jennifer J. Harris, Yu Li, Mark

Rupar, Elham Behshad, Christine Gardiner, Paul Collier, Phillip Liu, Timothy Burn,

Richard Wynn, Gregory Hollis, and Swamy Yeleswaram

Incyte Corporation, Wilmington, Delaware

This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on July 25, 2014 as DOI: 10.1124/dmd.114.058883

at ASPE

T Journals on M

arch 3, 2021dm

d.aspetjournals.orgD

ownloaded from

http://dmd.aspetjournals.org/

DMD #58883

2

Running title: Inhibition of thiamine uptake by fedratinib

Corresponding Author:

Qiang Zhang, Ph.D.

Incyte Corporation

Route 141 & Henry Clay Road

Wilmington, DE 19880

Email: [email protected]

Phone: 302-498-5827, Fax: 302-425-2759

Number of Text Pages: 16

Number of Figures: 11

Number of Tables: 0

Number of References: 22

The number of words of Abstract: 165

The number of words of Introduction: 319

The number of words of Discussion: 1005

Abbreviations:

WE, Wernicke’s encephalopathy; hTHTR1, human thiamine transporter-1; hTHTR2, human

thiamine transporter-2; TPK1, thiamine pyrophosphokinase 1; TEER, transepithelial electrical

resistance; HBSS, Hank's Balanced Salt Solution; MTPPT, mitochondrial thiamine

pyrophosphate transporter; TPP, thiamine pyrophosphate; IC50, half-maximal inhibitory

concentration; IV, intravenous.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

3

Abstract

The clinical development of fedratinib, a JAK2 inhibitor, was terminated following reports of

Wernicke's encephalopathy in myelofibrosis patients. Since Wernicke's encephalopathy is

induced by thiamine deficiency, investigations were conducted to probe possible mechanisms

through which fedratinib may lead to a thiamine deficient state. In vitro studies indicate that

fedratinib potently inhibits the carrier-mediated uptake and transcellular flux of thiamine in Caco-

2 cells suggesting that oral absorption of dietary thiamine is significantly compromised by

fedratinib dosing. Transport studies with recombinant human thiamine transporters identified the

individual transporter, hTHTR2, that is inhibited by fedratinib. Inhibition of thiamine uptake

appears unique to fedratinib and not shared by marketed JAK inhibitors, and this observation is

consistent with the known structure-activity relationship for the binding of thiamine to its

transporters. The results from these studies provide a molecular basis for the development of

Wernicke’s encephalopathy upon fedratinib treatment as well as highlight the need to evaluate

interactions of investigational drugs with nutrient transporters in addition to classic xenobiotic

transporters.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

4

Introduction

The role of activated JAK/STAT signaling in malignant and non-malignant diseases has been

well established. Ruxolitinib represents the first JAK1/2 inhibitor approved by the FDA and the

EMA for the treatment of myelofibrosis and tofacitinib, a pan-JAK inhibitor, has been approved

by the FDA for the treatment of rheumatoid arthritis. In addition, several inhibitors of the JAK

family of enzymes are in various stages of clinical development. Fedratinib (also referred to as

SAR302503 and TG101348) is a JAK2 inhibitor that has completed phase 3 clinical trials in

myelofibrosis. The clinical development of fedratinib was terminated when it was discovered

that some of the patients being treated with fedratinib developed Wernicke’s encephalopathy

(WE) (Sanofi, 2013), a neurological disorder linked to thiamine deficiency (Cook et al., 1998).

Thiamine supplementation was reported to lead to amelioration of symptoms in some of those

patients (Pardanani et al., 2013), suggesting that fedratinib treatment may lead to thiamine

deficiency. There are no reports of thiamine deficiency or WE caused by other JAK inhibitors,

including tofacitinib and ruxolitinib, and there is no known link between JAK/STAT signaling and

thiamine uptake and/or function, which raised the possibility of a mechanism unique to fedratinib.

Humans and other mammals must obtain thiamine from diet because they cannot synthesize

thiamine. Two human thiamine transporters, human thiamine transporter-1 and -2 (hTHTR1 and

hTHTR2), have been demonstrated to actively transport thiamine across the cell membrane and

are widely expressed in various tissues including the intestine, liver, brain, and kidney (Dutta et

al., 1999; Eudy et al., 2000; Said et al., 2004; Bukhari et al., 2011; Larkin et al., 2012). Based on

structural similarity between thiamine and a sub-structure of fedratinib, it was hypothesized that

fedratinib interferes with the oral absorption of thiamine via inhibition of thiamine transport. In

the present study, in vitro and in vivo experiments were conducted to test this hypothesis and

the results are presented in this publication.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

5

Materials and Methods

Materials

[3H]thiamine and [3H]thiamine pyrophosphate were purchased from American Radiolabeled

Chemicals Inc. (St. Louis, MO). Thiamine hydrochloride, amprolium, oxythiamine, amiloride, and

Hanks’ balanced salt solution (HBSS) were purchased from Sigma-Aldrich (St. Louis, MO).

Dulbecco’s modified Eagle’s medium, fetal bovine serum, non-essential amino acids, penicillin,

and streptomycin were purchased from Mediatech (Manassas, VA). Fedratinib was purchased

from Selleck Chemicals, LLC (Houston, TX). Ruxolitinib and tofacitinib were synthesized by

Incyte Corporation (Wilmington, DE). Rabbit anti-human THTR1 polyclonal antibody was

purchased from Abcam (Cambridge, MA), and rabbit anti-human THTR2 polyclonal antibody

was purchased from Pierce Biotechnology (Rockford, IL). Recombinant human thiamine

pyrophosphokinase 1 (TPK1) was purchased from Origene (Rockville, MD). Transcreener

AMP2/GMP2 kit was purchased from Life Technologies (Carlsbad, CA).

Cell and Culture Conditions

Caco-2 cells were purchased from American Type Culture Collection (Rochville, MD) while

GripTite™ HEK293 MSR cells were obtained from Life Technologies (Carlsbad, CA). Both cell

lines were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine

serum, 100 units/ml penicillin, and 100 mg/ml streptomycin. For GripTite™ HEK293 MSR cells,

both penicillin and streptomycin were not included, and 0.1 mM non-essential amino acids and

600 µg/ml Geneticin (Life Technologies) were also added in the culture medium. Cells were

maintained at 37°C in an atmosphere of 5% CO2. Caco-2 cells were seeded at a density of 4 x

104 cells/well in 24-well microplates for thiamine uptake studies and 4 x 103 cells/well in

Transwell™ 24-well plates on membrane filters (BD Biosciences) for transcellular transport

studies. In order to determine the uptake of thiamine in GripTite™ HEK293 MSR cells, these

cells were seeded at a density of 2 x 105 cells/well in 12-well microplates.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

6

Uptake Studies of [3H]Thiamine

The uptake experiments in Caco-2 cells were performed 11 to 17 days after seeding. Cells were

incubated with Henseleit-Krebs buffer (Taub et al., 2011) (142 mM NaCl, 23.8 mM NaHCO3,

4.83 mM KCl, 0.96 mM K2HPO4, 12.5 mM HEPES, 1.53 mM CaCl2, and 1.2 mM MgSO4, pH 7.4)

containing 15 nM [3H]thiamine at 37°C for 7 minutes in the absence or presence of inhibitors.

Unlabeled thiamine, amprolium and oxythiamine were employed as the positive control

inhibitors. The uptake was stopped by aspirating off the uptake solution and rapidly washing the

cells twice with 500 µl ice-cold phosphate buffered saline (PBS). Cells were then solubilized in

0.2 N NaOH, and all the lysate was transferred to a 24-well plate and then 350 µl Supermix

scintillation cocktail (PerkinElmer, Waltham, MA) was added to each well for liquid scintillation

counting in a MicroBeta scintillation counter (PerkinElmer, Waltham, MA). The uptake of

[3H]thiamine (15 nM) into Caco-2 cells was linear for up to 7 minutes of incubation and therefore

subsequent uptake experiments were conducted over 7 minutes.

In addition, HEK293 MSR cells were transiently transfected using TransIT®-293 transfection

reagent (Mirus Bio LLC, Madison, WI) with plasmids harboring either the SLC19A2 or SLC19A3

open reading frames for the expression of hTHTR1 or hTHTR2, respectively. Uptake

experiments were performed 48 hours post-transfection. Thiamine uptake assays were

conducted as described elsewhere (Ashokkumar et al., 2006).

Real-time PCR analysis

Real-time PCR analysis was performed using the total RNA isolated from Caco-2 cells to

assess expression levels of hTHTR1 and hTHTR2. cDNA synthesis was performed with the

Advantage RT-PCR kit (Clontech) according to the manufacturer's instructions using random

hexamers and DNase I-treated total RNA. hTHTR1 and hTHTR2 primers and probes were

synthesized and purified by Biosearch Technologies, Inc. (Novato, CA) with the 18S rRNA

probe/primers being obtained from Applied Biosystems (Foster City, CA). hTHTR1 was

analyzed using primers TGCACTCATCGCTGTGGTTT and


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

7

TGGATCTTCCAGCTTTCTACATTTC and probe FAM-

CTGGCCAGTGGTGCAGTCAGTGTTATGA-BHQ1. hTHTR2 was detected with primers

GAGGTGGCCTACTACGCCTACATA and CAGTAGCCGCTCACTCTCTGGTA and probe FAM-

ACAGCGTGGTCAGCCCCGAG-BHQ1. Real-Time PCR was performed on an Applied

Biosystems ABI 7900 (Foster City, CA) as recommended by the manufacturer. Reactions

performed in the absence of reverse transcriptase were used to confirm lack of genomic DNA

contamination. All expression measurements were performed in duplicate.

Western Blot

Protein samples (30 µg) from the Caco-2 cell lysate were resolved on a 4-12% SDS-

polyacrylamide gel and electroblotted onto nitrocellulose membranes. The blots were blocked

for 1 h with 5% nonfat dry milk in PBS-0.05% Tween, and incubated overnight at 4°C with rabbit

anti-human THTR1 polyclonal antibody (1:500 dilution), and rabbit anti-human THTR2

polyclonal antibody (1:500 dilution). The membranes were washed and then incubated with

horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology, Danvers,

MA) and signals were detected using a SuperSignal West Dura extended duration substrate kit

(Thermo Fisher Scientific, Waltham, MA). Images were captured by FluorChem™ M system

(ProteinSimple, Santa Clara, CA).

Transcellular Transport Studies of [3H]Thiamine in Caco-2 Cells

Cell membrane confluence was confirmed by measuring transepithelial electrical resistance

(TEER). Caco-2 cell monolayers with TEER values ≥ 300 Ω•cm2 were used for transport

experiments. In addition, nadolol, a low passive permeability bench mark, was also used to

confirm the integrity of the monolayers of Caco-2 cells. The permeability values of nadolol were

within the acceptable range of the in-house data (on file at Incyte Corporation) and were also

consistent with the values reported in the literature (Yang et al., 2007). All transport experiments

were conducted between 22 and 25 days after seeding. Using Hank's Balanced Salt Solution

(HBSS) containing 20 nM of [3H]thiamine in the absence or presence of inhibitors in the apical

side, Caco-2 cells were incubated for 120 minutes at 37°C. Unlabeled thiamine, amprolium and


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

8

oxythiamine were employed as the positive control inhibitors. After incubation, samples were

removed from the donor and the receiver side, respectively. Radioactivity was counted on a

MicroBeta scintillation counter (PerkinElmer, Waltham, MA).

Mitochondrial Transport of [3H]Thiamine Pyrophosphate

HEK-293T cells (Thermo Scientific, Waltham, MA) were transfected with a mitochondrial

thiamine pyrophosphate transporter (MTPPT) using the Maxcyte STX scalable transfection

system (Maxcyte, Gaithersburg, MD). Mitochondria were purified from HEK-293T and HEPG2

cells (American Type Culture Collection, Rochville, MD) following the protocol in the kit. The

freshly purified mitochondria were suspended in the storage buffer from the kit to achieve the

protein concentration of 10-12 µg/µl. The assay was carried out as reported elsewhere

(Subramanian et al., 2013; Hopfer et al., 1973). Briefly, mitochondria (5 µl) were added to the

uptake buffer (20 µl) containing 0.1 µM [3H]TPP and then incubated at 37˚C. The uptake

reaction was terminated at various time points by adding the ice-cold stop buffer followed by

rapid filtration. The membranes were washed two times with the stop buffer and the radioactivity

was counted in a TopCount NXT™ scintillation counter (PerkinElmer, Waltham, MA).

Thiamine Pyrophosphokinase 1 (TPK1) Activity

TPK1(0.1 µM) was incubated with 1 µM thiamine and 1 mM ATP at 37˚C for 30 min in 50 mM

HEPES, 10 mM MgCl2, 1 mM EGTA and 0.01% Tween 20. The reaction was stopped by

addition of 10 mM EDTA, AMP2/GMP2 Alexafluor tracer and AMP2/GMP2 antibody (Life

Technologies, Carlsbad, CA). The plates were read on a BMG Labtech PHERAstar microplate

reader (Ortenberg, Germany).

Brain Uptake Studies in Rats

Three groups of male Sprague Dawley rats (n = 4/group) were given either fedratinib, ruxolitinib

or tofacitinib via intravenous (IV) dosing to reach steady state plasma concentrations of ~ 1 µM.

Each compound was first given via an IV loading dose to reach steady state plasma

concentrations followed immediately by an IV infusion for 4 hours to maintain the steady-state.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

9

Infusion rates were selected based on the elimination rate constants of the three compounds.

The IV bolus and infusion doses for fedratinib, tofacitinib and ruxolitinib were 2 mg/kg and 2

mg/kg/h, 2 mg/kg and 1 mg/kg/h, and 3 mg/kg and 6 mg/kg/h, respectively. Blood samples

were collected at 2 and 4 h, and whole brains were collected at 4 h postdose. All animal

procedures were in accordance with the facility’s animal welfare committee. Blood samples

were centrifuged to obtain the plasma while the brain tissue was homogenized in 0.05% formic

acid in 5% acetonitrile in water. The plasma and brain homogenates were precipitated with

acetonitrile and/or methanol prior to analysis. Total plasma and brain drug concentrations were

determined by LC-MS/MS using a positive APCI interface on a Sciex API-3000 mass

spectrometer (Applied Biosystems/MDS SCIEX, Concord, Canada) and multiple reaction

monitoring (MRM). Chromatographic separation of ruxolitinib, fedratinib and tofacitinib were

achieved using a Phenomenex reverse phase, 5 µ (50 x 2 mm) column with mobile phase A

comprised of water and mobile phase B comprised of acetonitrile, both containing 0.1 % formic

acid. All samples were injected onto the LC with a flow rate of 0.3 ml/min starting at 5% mobile

phase B followed by a linear gradient to 65% mobile phase B at 3.1 min for ruxolitinib, and

starting at 10 to 15% mobile phase B followed by a linear gradient to 90% mobile phase B at 2.5

min for fedratinib and tofacitinib.

Equilibrium Dialysis Experiments

The unbound fractions of fedratinib, ruxolitinib and tofacitinib in rat plasma and brain

homogenates were determined in vitro using the Multi-Equilibrium Dialyzer System™ and

membranes from Harvard Apparatus (Holliston, MA). Brain tissue was weighed, diluted 3-fold

with phosphate buffer and homogenized. The drug of interest was added to the plasma or the

brain homogenates to achieve final concentrations equal to the total brain concentrations

measured from rats in vivo. Plasma or homogenized brain samples were then loaded into the

dialysis cells and dialyzed against 1ml of 133 mM potassium phosphate buffer (pH 7.4). After a

2 h incubation at 37°C samples were harvested and then analyzed by LC-MS/MS using a

positive ESI interface on an Applied Biosystems API-4000 mass spectrometer (AB Sciex LLC,


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

10

Foster City, CA) and MRM. Chromatographic separation was achieved using a Phenomenex

reverse phase, 4 µ (50 x 2 mm) column with mobile phase A comprised of water and mobile

phase B comprised of methanol, both containing 0.1 % formic acid. All samples were injected

onto the LC with a flow rate of 0.6 ml/min starting at 10% B for 1.0 min followed by a linear

gradient to 90% B at 3.5 min and held for 0.5 min. The unbound fractions of the three

compounds determined from the diluted brain tissue homogenates were corrected to estimate

unbound fractions in undiluted tissue as described elsewhere (Kalvass and Maurer, 2002).

Data Analysis

The kinetic parameters for uptake, Km, Vmax, and Kdiff, were estimated according to the following

equation (Greenwood et al., 1982; Izumi et al., 2013) :

v = Vmax*C/( Km + C) + Kdiff*C,

where v, C, Km, Vmax, and Kdiff represent the uptake velocity, the substrate concentration, the

Michaelis constant, the maximum uptake velocity, and the transfer constant for diffusion,

respectively. GraphPad Prism 6.0 (GraphPad Software Inc., San Diego, CA) was used for the

statistical analysis and estimation of the kinetic parameters and the apparent half-maximal

inhibitory concentration (IC50) values. Permeability coefficient (Papp) was determined as

described elsewhere (Yee, 1997). Statistical analysis was conducted using a Student t test for

comparing two treatments. A P value < 0.05 was considered significant.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

11

Results

Studies of Thiamine Uptake by Caco-2 Cells

The human-derived intestinal epithelial cell line, Caco-2, is commonly used as an in vitro model

for oral absorption and has been demonstrated to have functional transporter-mediated thiamine

uptake with expression of both human thiamine transporters, hTHTR1 and hTHTR2 (Said et al.,

2004). Real-Time PCR analysis was performed to assess expression of hTHTR1 and hTHTR2

in Caco-2 cells. Consistent with data by Said et al (Said et al., 2004), the expression of both

transporters at the mRNA level in Caco-2 cells was observed. The mean Cycle Thresholds (Ct)

were 26.4 and 26.0 for hTHTR1 and hTHTR2, respectively, suggesting moderate expression of

these transporters at the mRNA level (Fig. 2). The efficiencies of the two reactions were nearly

identical (data not shown). The results from Western blot analysis confirmed the protein

expression of hTHTR1 and hTHTR2 in Caco-2 cells used in this study (Fig. 3). The predicted

molecular masses of native hTHTR1 and hTHTR2 protein are approximately 55 kDa (Larkin et

al., 2012). hTHTR1 and hTHTR2 protein bands were detected at ~55 and ~60 kDa, respectively,

which are similar to the predicted molecular masses of these transporters. A band

corresponding to a molecular mass of ~ 75 kDa displayed in the blot of hTHTR1 may be a form

of glycosylated hTHTR1 protein.

Figure 4 shows the concentration dependency of [3H]thiamine uptake by Caco-2 cells. The

uptake of thiamine consisted of both active and passive transport of thiamine, and the apparent

Km and Vmax of the active uptake as well as the transfer constant for diffusion Kdiff were 3.06 ±

0.76 µM, 10.7 ± 1.41 pmol/mg protein/min, and 0.156 ± 0.040 µl/mg protein/min, respectively.

The observed Km is consistent with that reported (3.18 µM) (Said et al., 1999).

To confirm the specificity of thiamine uptake by Caco-2 cells, two thiamine analogs, amprolium

and oxythiamine (Casirola et al., 1988), were used. As indicated in Figure 5, amprolium was a

potent inhibitor of thiamine uptake with an IC50 value of 0.80 µM, while oxythiamine at 200 µM,

the highest concentration studied, inhibited thiamine uptake by 44%, indicating weak inhibition


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

12

of thiamine transport. Figure 6 indicates that fedratinib potently inhibited thiamine uptake with an

IC50 of 2.1 µM, while the marketed JAK inhibitors, ruxolitinib and tofacitinib, did not exhibit any

significant inhibition.

Studies of Transcellular Transport of Thiamine in Caco-2 cells

To extend the observations regarding inhibition of thiamine uptake by fedratinib, transcellular

transport of thiamine, which captures both uptake and passive diffusion, was evaluated in Caco-

2 cells. As shown in Figure 7, the transcellular transport of [3H]thiamine decreased with

increasing concentrations of unlabeled thiamine, consistent with the presence of active transport.

As shown in Figure 8, unlabeled thiamine and the thiamine analog, amprolium, inhibited the

transcellular transport of [3H]thiamine with maximal inhibitions observed at 30 µM and 100 µM,

respectively. The other thiamine analog, oxythiamine, was less effective in inhibiting the

transcellular transport of thiamine. A concentration-dependent decrease of the flux of

[3H]thiamine across the monolayer of Caco-2 cells was observed with fedratinib with an

apparent IC50 value of 6.5 μM, comparable to the inhibitory potency of fedratinib for the uptake

of thiamine as discussed above. No significant inhibitory effects were observed with ruxolitinib

(100 μM) or tofacitinib (100 μM), consistent with the results from the uptake studies described

above. The maximum inhibition of transcellular transport of [3H]thiamine by unlabeled thiamine,

amprolium, or fedratinib plateaued at approximately 50%.

Effects of Fedratinib on Recombinant Proteins Involved in Thiamine Transport and

Metabolism

To further understand the mechanistic basis of the effect of fedratinib, each of the four proteins

that play a key role in the uptake and metabolism of thiamine including hTHTR1, hTHTR2, TPK1

and MTPPT, were evaluated. The time course and kinetics of thiamine uptake in the hTHTR1-

and hTHTR2-transfected HEK293 MSR cells are shown in Figure 9. The apparent Km and Vmax

values of the thiamine uptake in the hTHTR1and hTHTR2-transfected cells were 1.85 µM and

7.29 pmol/mg protein/min, and 3.28 µM and 35.0 pmol/mg protein/min, respectively. Fedratinib

potently inhibited hTHTR2 with an IC50 of 1.2 µM but did not inhibit hTHTR1 (Fig.10), indicating


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

13

that fedratinib specifically affected uptake of thiamine by inhibiting hTHTR2. In contrast, both

ruxolitinib and tofacitinib did not inhibit the function of hTHTR1 or hTHTR2 (Fig.10). The effects

of the three JAK inhibitors at various concentrations (up to 30 µM) on the activity of TPK1 were

determined. In the presence of fedratnib, ruxolitinib or tofacitinib at 30 µM, the percent TPK1

activity compared to DMSO treated control were 97.3 ± 1.06, 93.8 ± 3.37, and 102.8 ± 1.31,

respectively. The effects of these JAK inhibitors at 10 µM on the mitochondrial transport of

[3H]thiamine pyrophosphate ([3H]TPP) were also determined. The percent mitochondrial

transport of [3H]TPP compared to DMSO treated control in the presence of fedratnib, ruxolitinib

or tofacitinib at 10 µM were 91.1 ± 12.4, 90.2 ± 5.14, and 106.3 ± 9.77, respectively. These

results demonstrate that the three JAK inhibitors did not inhibit the function of TPK1 and MTPPT

under current study conditions.

Brain Exposure of JAK Inhibitors in Rats

The brain uptake of JAK inhibitors was evaluated in rats to identify any differences in brain

exposure among the three compounds. Following IV administration of fedratinib, tofacitinib or

ruxolitinib in rats to achieve steady state, the unbound brain to unbound plasma ratio of

fedratinib was 0.26, while that of ruxolitinib and tofacitinib were only 0.035 and 0.026,

respectively, demonstrating a 7- to 10-fold higher brain uptake for fedratinib compared to

ruxolitinib or tofacitinib (Fig.11). The unbound fractions of fedratinib, tofacitinib and ruxolitinib in

the plasma were 0.11, 0.65, and 0.18, and the corresponding unbound fractions in the brain

were 0.02, 0.22, and 0.08, respectively. A 2 h plasma sample was also collected during the

infusion, and for each compound the 2 h plasma concentration (data not shown) was similar to

the 4 h plasma concentration confirming that steady state was achieved.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

14

Discussion

The chemical structure of fedratinib includes a 4-aminopyrimidine group and it is this structural

similarity to thiamine that prompted this investigation. It has been reported that this sub-

structure is important in the recognition of thiamine by thiamine transporters such that

oxythiamine, a close structural analog of thiamine whose 4-amino group is replaced by a

hydroxyl group, is not a good substrate or potent inhibitor of thiamine transporter at the blood-

brain barrier (Greenwood and Pratt, 1985). Because the Caco-2 cell line is widely used as a cell

model to evaluate transport of molecules across human intestinal epithelium, this cell system

was chosen to study the uptake and transport of thiamine and the effect of fedratinib on that

process. The expression and subcellular localization of hTHTR1 and hTHTR2 have been

reported in Caco-2 cells, with hTHTR1 protein expressed on both the apical and basolateral

sides and hTHTR2 protein exclusively expressed on the apical side (Said et al., 2004). The

expression of these two thiamine transporters in Caco-2 cells was also confirmed in our

laboratories at both mRNA and protein levels (Fig. 2 and Fig. 3).

Thiamine uptake by Caco-2 cells follows typical Michaelis-Menton kinetics, consistent with

saturable carrier-mediated transport, with a Km of 3.06 µM (Fig. 4). This uptake process was

potently inhibited by amprolium (IC50 = 0.8 µM), a structural analog of thiamine, but not by

oxythiamine (Fig. 5), in agreement with the published literature as mentioned above. Next, the

effects of fedratinib and two other JAK inhibitors (ruxolitinib and tofacitinib) on thiamine uptake

were evaluated. As shown in Figure 6, only fedratinib potently inhibited thiamine uptake with an

inhibitory activity (IC50 = 2.1 µM) comparable to that of amprolium while ruxolitinib and tofacitinib

did not. This striking difference in the inhibitory activity of thiamine uptake is consistent with the

acknowledged criticality of the 4-aminopyrimidine sub-structure, absent in ruxolitinib and

tofacitinib (Fig. 1). The intestinal concentrations of fedratinib (calculated using a default

intestinal volume of 250 ml) following an oral dose greater than 100 mg, are expected to exceed


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

15

the apparent IC50 for thiamine uptake determined in this study by a few orders of magnitude and

this in turn may inhibit transporter-mediated uptake of dietary thiamine in patients.

Fedratinib also inhibited the apical-to-basolateral transport of thiamine across Caco-2 cells with

inhibitory potency (IC50 = 6.5 µM) similar to that observed in the thiamine uptake assay.

However, the inhibition of transcellular transport of thiamine by unlabeled thiamine, amprolium

and fedratinib was incomplete (Fig. 8) and this may reflect the underlying contribution of passive

diffusion which is not expected to be impacted by inhibitors of thiamine uptake.

To further understand the mechanistic basis of interaction between fedratinib and thiamine,

each of the four proteins, viz, hTHTR1, hTHTR2, TPK1 and MTPPT, that play a key role in

thiamine uptake and metabolism were investigated and the interaction between thiamine and

fedratinib was evaluated. Fedratinib did not inhibit TPK1 or MTPPT activities, indicating that it

does not interfere with the function of thiamine in cellular metabolism. Fedratinib did not inhibit

hTHTR1 but potently inhibited the uptake of thiamine in HEK293 MSR cells transfected with

hTHTR2 in a concentration dependent manner with an IC50 of 1.2 µM (Fig. 10), indicating that

fedratinib directly affects the uptake of thiamine via hTHTR2, which is expressed at the intestinal

epithelium and other tissues including the brain (Eudy et al., 2000). Although both hTHTR1 and

hTHTR2 are expressed on the apical side of Caco-2 cells (Said et al., 2004), hTHTR2 appears

to play a more important role in thiamine uptake than hTHTR1 based on the report that the

intestinal thiamine uptake was significantly reduced in the THTR2-deficient mice but was

preserved in the THTR1-deficient mice (Reidling et al., 2010). Thus, fedratinib, by virtue of

potent inhibition of hTHTR2, can be expected to inhibit uptake of dietary thiamine.

The brain uptake of JAK inhibitors was evaluated in rats to look for any differences in profile

among the three compounds. Based on the unbound brain to unbound plasma ratio, the

distribution of fedratinib into the brain was high in rats, therefore the possibility that thiamine

uptake by neurons and astrocytes might be also inhibited by fedratinib after this compound

enters the brain may not be ruled out. This unbound brain to unbound plasma ratio is much


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

16

higher than expected based on the polar surface area of the molecule which would suggest low

passive diffusion, and the brain uptake of fedratinib was also much higher compared to that of

ruxolitinib and tofacitinib. While the higher than expected brain uptake of fedratinib in rats is

interesting and may suggest that this compound might undergo active uptake at the blood-brain

barrier, the mechanism is unknown. The mean steady-state maximum plasma concentration of

fedratinib in patients was 5-10 µM for a 400-500 mg daily dose (Pardanani et al., 2011) which

raises the possibility of fedratinib inhibiting thiamine transport into the brain via hTHTR2, in

addition to inhibition of thiamine uptake at the intestine. Further experiments are required to

quantify these effects.

In summary, the current study has been carried out to discern the mechanism underlying the

fedratinib-induced WE. The results clearly demonstrate that fedratinib is a potent inhibitor of

thiamine uptake and transport via specific inhibition of hTHTR2. It is important to note that

nausea, diarrhea, and vomiting are the major adverse events of fedratinib (Pardanani et al.,

2011) and these effects may also contribute to or exacerbate the direct inhibition of thiamine

uptake by fedratinib, leading to a more pronounced thiamine deficiency. Assessment of

interactions of a new molecular entity with drug metabolizing enzymes and xenobiotic

transporters are mandated during drug development by current regulatory guidance. However,

the inhibition of thiamine transporter by fedratinib points to the interaction of drugs with nutrient

transporters as another important area for investigation to ensure safety of new chemical

entities. Further, these investigations also serve to discern compound-specific vs. class-specific

effects in the pharmacology and toxicology of inhibitors of JAK enzymes which are being

studied in a wide array of oncological and inflammatory indications.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

17

Authorship Contributions

Participated in research design: Q. Zhang, Y. Zhang, Diamond, Boer, Behshad, Liu, Burn, Wynn,

Hollis, and Yeleswaram.

Conducted experiments: Q. Zhang, Y. Zhang, Boer, Harris, Li, Rupar, Gardiner, Behshad, and

Collier.

Performed data analysis: Q. Zhang, Y. Zhang, Diamond, Boer, Harris, Li, Behshad, Collier, Liu,

Burn, Wynn, and Hollis.

Wrote or contributed to the writing of the manuscript: Q. Zhang, Yeleswaram, Y. Zhang,

Diamond, Harris, Behshad, and Hollis.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

18

References

Ashokkumar B, Vaziri ND, and Said HM (2006) Thiamin uptake by the human-derived renal

epithelial (HEK-293) cells: cellular and molecular mechanisms. Am J Physiol Renal Physiol

291:F796-F805.

Bukhari FJ, Moradi H, Gollapudi P, Ju Kim H, Vaziri ND, and Said HM (2011) Effect of chronic

kidney disease on the expression of thiamin and folic acid transporters. Nephrol Dial

Transplant 26:2137-2144.

Casirola D, Ferrari G, Gastaldi G, Patrini C, and Rindi G (1988) Transport of thiamine by brush-

border membrane vesicles from rat small intestine. J Physiol 398:329-339.

Cook CC, Hallwood PM, and Thomson AD (1998) B-Vitamin deficiency and neuropsychiatric

syndromes in alcohol misuse. Alcohol Alcohol 33:317-336.

Dutta B, Huang W, Molero M, Kekuda R, Leibach FH, Devoe LD, Ganapathy V, and Prasad PD

(1999) Cloning of the human thiamine transporter, a member of the folate transporter family.

J Biol Chem 274:31925-31929.

Eudy JD, Spiegelstein O, Barber RC, Wlodarczyk BJ, Talbot J, and Finnell RH (2000)

Identification and characterization of the human and mouse SLC19A3 gene: a novel

member of the reduced folate family of micronutrient transporter genes. Mol Genet Metab

71:581-590.

Greenwood J, and Pratt OE (1985) Comparison of the effects of some thiamine analogues upon

thiamine transport across the blood-brain barrier of the rat. J Physiol 369:79-91.

Greenwood J, Love ER, and Pratt OE (1982) Kinetics of thiamine transport across the blood-

brain barrier in the rat. J Physiol 327:95-103.

Hopfer U, Nelson K, Perrotto J, and Isselbacher KJ (1973) Glucose transport in isolated brush

border membrane from rat small intestine. J Biol Chem 248:25-32.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

19

Izumi S, Nozaki Y, Komori T, Maeda K, Takenaka O, Kusano K, Yoshimura T, Kusuhara H, and

Sugiyama Y (2013) Substrate-dependent inhibition of organic anion transporting polypeptide

1B1: comparative analysis with prototypical probe substrates estradiol-17β-glucuronide,

estrone-3-sulfate, and sulfobromophthalein. Drug Metab Dispos 41:1859-1866.

Kalvass JC and Maurer TS (2002) Influence of nonspecific brain and plasma binding on CNS

exposure: implications for rational drug discovery. Biopharm Drug Dispos 23:327-338.

Larkin JR, Zhang F, Godfrey L, Molostvov G, Zehnder D, Rabbani N, and Thornalley PJ (2012)

Glucose-induced down regulation of thiamine transporters in the kidney proximal tubular

epithelium produces thiamine insufficiency in diabetes. PLoS One 7:e53175.

Pardanani A, Gotlib JR, Jamieson C, Cortes JE, Talpaz M, Stone RM, Silverman MH, Gilliland

DG, Shorr J, and Tefferi A (2011) Safety and efficacy of TG101348, a selective JAK2

inhibitor, in myelofibrosis. J Clin Oncol 29:789-796.

Pardanani A, Harrison CN, Cortes JE, Cervantes F, Mesa RA, Milligan D, Masszi T,

Mishchenko E, Jourdan E, Vannucchi AM, Drummond M, Jurgutis M, Kuliczkowski K,

Gheorghita E, Passamonti F, Neumann F, Gao G, and Tefferi A (2013) Results of a

randomized, double-blind, placebo-controlled phase III study (JAKARTA) of the JAK2-

selective inhibitor fedratinib (SAR302503) in patients with myelofibrosis (MF). Blood 122:393.

Reidling JC, Lambrecht N, Kassir M, and Said HM (2010) Impaired intestinal vitamin B1(thiamin)

uptake in thiamin transporter-2-deficient mice. Gastroenterology 138:1802-1809.

Said HM, Balamurugan K, Subramanian VS, and Marchant JS (2004) Expression and functional

contribution of hTHTR-2 in thiamin absorption in human intestine. Am J Physiol Gastrointest

Liver Physiol 286:G491-G498.

Said HM, Ortiz A, Kumar CK, Chatterjee N, Dudeja PK, and Rubin S (1999) Transport of

thiamine in human intestine: mechanism and regulation in intestinal epithelial cell model

Caco-2. Am J Physiol 277:C645-C651.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

20

Sanofi press release (2013). Sanofi discontinues clinical development of investigational JAK2

agent fedratinib (SAR302503). http://en.sanofi.com/Images/34935_20131118_JAK-2-

FEDRATINIB_en.pdf

Subramanian VS, Nabokina SM, Lin-Moshier Y, Marchant JS, and Said HM (2013)

Mitochondrial uptake of thiamin pyrophosphate: physiological and cell biological aspects.

PLoS One 8:e73503.

Taub ME, Mease K, Sane RS, Watson CA, Chen L, Ellens H, Hirakawa B, Reyner EL, Jani M,

and Lee CA (2011) Digoxin is not a substrate for organic anion-transporting polypeptide

transporters OATP1A2, OATP1B1, OATP1B3, and OATP2B1 but is a substrate for a

sodium-dependent transporter expressed in HEK293 cells. Drug Metab Dispos 39:2093-

2102.

Yang Y, Faustino PJ, Volpe DA, Ellison CD, Lyon RC, and Yu LX (2007) Biopharmaceutics

classification of selected beta-blockers: solubility and permeability class membership. Mol

Pharm 4:608-614.

Yee S (1997) In vitro permeability across Caco-2 cells (colonic) can predict in vivo (small

intestinal) absorption in man--fact or myth. Pharm Res 14:763-766.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

21

Footnotes

Financial disclosure: All authors are employees and stock holders of Incyte Corporation.


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

22

Figure Legends

Figure 1. The chemical structures of thiamine, amprolium, oxythiamine, fedratinib,

ruxolitinib, and tofacitinib. A, thiamine; B, amprolium; C, oxythiamine; D, fedratinib; E,

ruxolitinib; F, tofacitinib.

Figure 2. mRNA expression of human thiamine transporters in Caco-2 cells. Real-time

PCR analysis was performed using the total RNA isolated from confluent Caco-2 cells to assess

expression levels of hTHTR1 and hTHTR2. cDNA synthesis was performed with the Advantage

RT-PCR kit using random hexamers and DNase I-treated total RNA. Transcripts for both

transporters were present with similar Cycle Threshold (Ct) values as shown by the inflection

point of the curves. Rn denotes normalized reporter.

Figure 3. Protein expression of human thiamine transporters in Caco-2 cells. Western blot

analysis was performed using the cell lysate of Caco-2 cells. Protein sample (30 µg) was

resolved on a 4-12% SDS-polyacrylamide gel and electroblotted onto nitrocellulose membranes.

The blots were blocked for 1 h with 5% nonfat dry milk in PBS-0.05% Tween, and incubated

overnight at 4°C with rabbit anti-hTHTR1 polyclonal antibody (1:500 dilution) and rabbit anti-

hTHTR2 polyclonal antibody (1:500 dilution). The membranes were then incubated with

horseradish peroxidase-conjugated secondary antibodies. Images were captured by

FluorChem™ M system.

Figure 4. Uptake of thiamine by Caco-2 cells as a function of concentration. Caco-2 cells

were seeded on 24-well plates. The uptake experiments were performed 11 to 17 days after

seeding. Cells were incubated at 37ºC for 7 min in the presence of different concentrations of

thiamine (0.2 to 30 µM). The kinetic parameters, Km, Vmax, and Kdiff, were estimated using

GraphPad Prism 6.0. Results are shown as the mean ± S.D. (n = 3).


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

23

Figure 5. The effects of structural analogs of thiamine on thiamine uptake by Caco-2 cells.

Caco-2 cells were incubated at 37ºC for 7 min in the presence of 15 nM [3H]thiamine and

different concentrations of amprolium (circle) or oxythiamine (triangle). Inhibitory effects are

reported as percent of DMSO treated controls. Results are shown as the mean ± S.D. (n = 3).

Figure 6. The effects of JAK inhibitors on thiamine uptake by Caco-2 cells. Caco-2 cells

were incubated at 37ºC for 7 min in the presence of 15 nM [3H]thiamine and different

concentrations of fedratinib (circle), ruxolitilib (square), or tofacitilib (triangle). Inhibitory effects

are reported as percent of DMSO treated controls. Results are shown as the mean ± S.D.

(n = 3).

Figure 7. Transcellular transport of thiamine as a function of time and concentration.

Caco-2 cells were seeded in 24-well plates on Transwell™ PET (Polyethylene Terephthalate)

membrane filters. Cell membrane confluence was confirmed by measuring transepithelial

electrical resistance (TEER). Caco-2 cells were incubated at 37°C in HBSS buffer (pH 7.4) for

various periods of time in the presence of 20 nM [3H]thiamine and various concentrations of

unlabeled thiamine (0.48 to 500 μM) in the apical side. Results are reported as the mean (n = 2

or 3).

Figure 8. Inhibitory effects of thiamine analogs and JAK inhibitors on the transcelluar

transport of [3H]thiamine in Caco-2 cells. Caco-2 cells were incubated at 37°C with 20 nM

[3H]thiamine in HBSS buffer (pH 7.4) for 120 minutes in the presence of various concentrations

of unlabeled thiamine (3, 30, 500 μM), amprolium (30, 100, 300 μM), oxythiamine (300 μM),

fedratinib (10, 50, 100 μM), ruxolitinib (100 μM), or tofacitinib (100 μM) in the apical side.

Results are shown as the mean ± S.D. (n = 3). Inhibitory effects are reported as percent of


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

24

DMSO treated controls. Significance was determined by a Student t test when an inhibitor

treatment was compared to DMSO treated control (* P < 0.05, ** P < 0.01).

Figure 9. Time- and concentration-dependence of thiamine uptake in hTHTR1- and

hTHTR2-transfected HEK293 MSR cells. A, C. Time-dependence of thiamine uptake in

transfected cells. Cells expressing recombinant hTHTR1 (A) or hTHTR2 (C) were incubated for

various periods of time in the presence of 20 nM [3H]thiamine. Results are shown as the mean

± S.D. (n = 3). As a control for background, uptake in mock transfected HEK293 MSR cells is

plotted. B, D. Concentration-dependence of thiamine uptake in transfected cells. HEK293-MSR

cells transiently transfected with hTHTR1 (B) or hTHTR2 (D) were incubated in the presence of

increasing concentrations of thiamine. Results are shown as the mean ± S.D. (n = 3). The

kinetic parameters, Km and Vmax, were estimated using GraphPad Prism 6.0.

Figure 10. Inhibition of thiamine uptake by JAK inhibitors in hTHTR1- and hTHTR2-

transfected HEK293 MSR cells. HEK293 MSR cells were transiently transfected with hTHTR1

(A) or hTHTR2 (B). Uptake experiments were performed 48 hours post-transfection. Cells were

incubated at 37ºC for 7 min in the presence of 20 nM [3H]thiamine and various concentrations of

three JAK inhibitors: fedratinib, ruxolitinib, or tofacitinib. Inhibitory effects are reported as

percent of DMSO treated controls. Results are shown as the mean ± S.D. (n = 3).

Figure 11. Unbound brain to unbound plasma ratios of fedratinib, ruxolitinib, and

tofacitinib in rats. Three groups of male Sprague Dawley rats were given either fedratinib,

ruxolitinib or tofacitinib via intravenous (IV) infusion after an IV loading dose to maintain steady

state plasma concentrations for 4 hours. The IV bolus and infusion doses for fedratinib,

tofacitinib and ruxolitinib were 2 mg/kg and 2 mg/kg/h, 2 mg/kg and 1 mg/kg/h, and 3 mg/kg and

6 mg/kg/h, respectively. At 4 h postdose, blood was collected in EDTA to prepare plasma, along

with the brains. The plasma and brain homogenates were precipitated with acetonitrile and/or


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


DMD #58883

25

methanol, and the resulting supernatants were analyzed by LC/MS/MS. Results are shown as

the mean ± S.D. (n = 4 for fedratinib and tofacitinib, n = 3 for ruxolitinib).


at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from



at ASPE

T Journals on M

arch 3, 2021dm


ownloaded from


the jak2 inhibitor fedratinib inhibits thiamine uptake – a ... · 7/25/2014 · published on...

Documents