ORIGINAL PAPER

The Involvement of CXCL11 in Bone Marrow-DerivedMesenchymal Stem Cell Migration Through Human BrainMicrovascular Endothelial Cells

Yu Feng • Hong-Mei Yu • De-Shu Shang •

Wen-Gang Fang • Zhi-Yi He • Yu-Hua Chen

Received: 29 August 2013 / Revised: 4 February 2014 / Accepted: 7 February 2014

� Springer Science+Business Media New York 2014

Abstract Bone marrow-derived mesenchymal stem cells

(MSCs) transplant into the brain, where they play a

potential therapeutic role in neurological diseases. How-

ever, the blood–brain barrier (BBB) is a native obstacle for

MSCs entry into the brain. Little is known about the

mechanism behind MSCs migration across the BBB. In the

present study, we modeled the interactions between human

MSCs (hMSCs) and human brain microvascular endothe-

lial cells (HBMECs) to mimic the BBB microenvironment.

Real-time PCR analysis indicated that the chemokine

CXCL11 is produced by hMSCs and the chemokine

receptor CXCR3 is expressed on HBMECs. Further results

indicate that CXCL11 secreted by hMSCs may interact

with CXCR3 on HBMECs to induce the disassembly of

tight junctions through the activation of ERK1/2 signaling

in the endothelium, which promotes MSCs transendothelial

migration. These findings are relevant for understanding

the biological responses of MSCs in BBB environments

and helpful for the application of MSCs in neurological

diseases.

Keywords Bone marrow-derived mesenchymal stem

cell � Chemokine CXCL11 � CXCR3 � Brain microvascular

endothelial cell � Tight junction � Blood–brain barrier

Introduction

Mesenchymal stem cells (MSCs) have become a thera-

peutic option for several pathologies, such as myocardial

infarction and wound repair [1, 2]. Similar to immune cells,

MSCs can extravasate from the blood vessels into ische-

mic, apoptotic and inflammatory tissues, where the cells

survive and promote tissue regeneration [3–5]. Several

studies indicate that MSCs are a potential candidate to treat

neurological diseases [6–8]. Therefore, a better under-

standing of the mechanisms behind MSCs migration into

the brain is important to improve therapies for neurological

diseases.

The blood–brain barrier (BBB) is a specific vascular

system that separates the blood from the brain and main-

tains a highly stable brain microenvironment. The BBB

consists of a network of closely adjoining endothelial cells

in the brain’s capillaries that are characterized by the

presence of continuous tight junctions (TJ) [9, 10].

Therefore, the BBB is a native obstacle for MSCs entry

into the brain.

As has been previously discussed, MSCs have the ability

to migrate into tissues from circulation, possibly in response

to signals that are upregulated under injury conditions. It is

probable that chemokines and their receptors are involved,

as they are important factors known to control cell migration

[11–13]. CXCL11 is a member of a family of small proteins,

the chemokines (or chemoattractant cytokines). This che-

mokine plays a key role in immune and inflammatory

responses by promoting the recruitment and activation of

different subpopulations of leukocytes. A previous study

reported that IL1b increased the production of CXCL11 to

promote MSCs migration [14]. Chemotaxis assays indicated

that CXCL11 in human serum has significant chemotactic

effects on human MSCs [15]. Therefore, we wanted to

Y. Feng � H.-M. Yu � Z.-Y. He

Department of Neurology, The First Hospital of China Medical

University, 155 Nan Jing Northern Street,

Shenyang 110001, Liaoning, China

Y. Feng � D.-S. Shang � W.-G. Fang � Y.-H. Chen (&)

Department of Developmental Cell Biology, Key Laboratory of

Cell Biology, Ministry of Public Health and Key Laboratory of

Medical Cell Biology, Ministry of Education, China Medical

University, 92 Bei Er Road, Shenyang 110001, Liaoning, China

e-mail: yhchen@mail.cmu.edu.cn

123

Neurochem Res

DOI 10.1007/s11064-014-1257-7

determine whether CXCL11 was involved in MSCs trans-

endothelial migration.

In the present paper, we found that CXCL11 secreted by

MSCs may interact with CXCR3 (chemokine (C-X-C

motif) receptor 3) on human brain microvascular endo-

thelial cells (HBMEC) and activate downstream signaling

cascades in the endothelium to open tight junctions, which

promotes MSCs transendothelial migration.

Materials and Methods

Cells and Culture Conditions

Human bone marrow MSCs (hMSCs) were prepared as pre-

viously described [16]. The bone marrow samples were used

in accordance with the procedures approved by the human

experimentation and ethics committees of China Medical

University. Rat MSCs were prepared as described by Tropel

et al. [17]. Briefly, male Wistar rats were sacrificed, and the

femurs were aseptically dissected, repeatedly flushed with

MSCs medium, and plated in a culture flask (Corning Costar).

After 24 h, the adherent cells were cultured as passage 0. The

use of animals in this study was approved by the Animal Care

and Use Committee of China Medical University, and all

procedures were carried out in accordance with institutional

guidelines.

Human brain microvascular endothelial cells [18] were

cultured in completed RPMI 1640 medium containing

10 % FBS, 10 % Nu-serum (BD Biosciences), 2 mM

glutamine, 1 mM sodium pyruvate, 19 non-essential

amino acids and 19 MEM vitamins.

For the co-culturing experiments, 1 9 105 HBMECs

were seeded on the bottom of 24-well plate and grown in 5 %

CO2 at 37 �C. After 24 h, the transwell inserts with pore

sizes of 0.4 lm (Corning Costar Corp., Cambridge, MA)

were put into the 24-well plate cultured with HBMECs, and

2 9 105 hMSCs were seeded on the upper chambers of

transwell inserts. After 4, 8, and 12 h in co-culture, the

hMSCs were collected and analyzed.

Quantitative Real-Time PCR

Total RNA was isolated using the Trizol reagent according to

the manufacturer’s instructions, and the reverse transcriptase

reaction was carried out with 1 lg of total RNA using the

PrimeScript RT Master Mix Kit (Takara Bio, Tokyo, Japan)

with random primers. Relative real-time PCR was performed

using an ABI PRISM 7500HT Sequence Detection System

(Applied Biosystems) using the SYBR Premix Ex Taq kit

(Takara Bio, Tokyo, Japan) according to the manufacturer’s

protocols. The relative expression levels of the chemokines

were normalized to the expression level of GAPDH and

analyzed using the 2(-Delta Delta C (T)) method. The

primers used are listed in Table 1.

ELISA

1 9 105 HBMECs were seeded on the bottom of a 24-well

plate. After 24 h, 2 9 105 hMSCs were seeded on the

HBMECs monolayer. After 4, 8, and 12 h in co-culture, the

supernatants were collected and the levels of human

CXCL11 were quantified by ELISA according to the

manufacturer’s protocol (R&D Systems).

MSC Transendothelial Migration Assay

1 9 105 HBMECs were seeded on fibronectin-coated

24-well Transculture inserts with pore sizes of 8 lm

(Corning Costar Corp., Cambridge, MA) and grown for

4 days in 5 % CO2 at 37 �C. The medium was replaced

every day with fresh medium. The experiments were con-

ducted when the transendothelial electrical resistance

(TEER) was [200 ohm cm2. Prior to the assays, the

HBMECs monolayers were washed once with medium

without serum, and 1 9 105 MSCs in 100 ll medium was

added to the upper chamber. After incubation for 8 h, the

upper chambers were fixed with 3.7 % formaldehyde and

washed extensively with PBS. To remove the non-migrating

cells, the apical side of the upper chamber was scraped

gently with cotton wool. Only the migrating MSCs were

stained with hematoxylin and eosin (HE) and observed under

a fluorescent microscope. The migrating cells were counted

from 10 random fields of 2009 magnification. For the neu-

tralization test, the MSCs were suspended in serum-free

RPMI 1640 containing a CXCL11 neutralizing antibody and

then incubated with the HBMECs.

HRP Flux Measurement

The HBMECs monolayer in the Transwell inserts (0.4 lm

pore size, Costar, Cambridge, MA) were incubated with

100 ng/ml CXCL11 for the indicated time or with different

concentrations of CXCL11 containing 0.4 mg/ml HRP for

1 h. The media from the lower chamber were then col-

lected, and the HRP content of the samples was assayed

colorimetrically as previously described. The HRP flux was

expressed in nanograms passed per cm2 surface area per

hour.

Immunofluorescence

The HBMECs monolayers grown on glass coverslips were

fixed with 4 % paraformaldehyde and permeabilized with

0.1 % Triton X-100. After blocking with 5 % BSA in PBS,

the cells were incubated with mouse anti-ZO-1 or rabbit

Neurochem Res

123

anti-occludin antibodies to visualize the distribution of ZO-

1 and occludin. The glass slides were analyzed using

immunofluorescence microscopy (Olympus, Japan).

Cell Fractionation and Western Blot

The cell fractionation experiments were performed as

described previously (Li et al. 2006). In brief, confluent

HBMECs were washed, extracted in Triton X-100 lysis buffer

(25 mM HEPES, 150 mM NaCl, 4 mM EDTA, 1 % Triton

X-100) and centrifuged to collect the soluble fraction. The

pellets were dissolved in SDS lysis buffer (25 mM HEPES,

4 mM EDTA, 1 % SDS) to obtain the insoluble fraction.

Equal portions of the soluble and insoluble fractions were

analyzed by Western blot. For the Western blots, the cells

were lysed in RIPA buffer (50 mM Tris–HCL, 150 mM

NaCl, 1 % NP-40, 0.5 % deoxycholate, 0.1 % sodium

dodecylsulfate) supplemented with the Complete/Mini pro-

tease inhibitor cocktail (Roche, Indianapolis, IN). The protein

concentrations were determined using the BCA protein assay

reagent kit (Pierce, Indianapolis, IN). 20 lg proteins were

separated by 8 % SDS-PAGE, transferred electrophoretically

to polyvinylidene difluoride (PVDF) membranes (Millipore,

Billerica, MA), and processed for immunoblotting with anti-

occludin (1:1,000) polyclonal antibody (Santa Cruz Bio-

technology, CA), ERK (1:1,000) and phosphorylated ERK1/2

(1:1,000) polyclonal antibodies (Cell Signaling Technology,

MA) for 2 h at room temperature. Membranes were washed

with PBS and incubated with horseradish peroxidase-conju-

gated goat anti-rabbit secondary antibody (1:10,000, Santa

Cruz Biotechnology, CA) for 1 h at room temperature. The

protein bands were visualized using AmershamTM ECL Plus

Western Blotting Detection Reagents (GE Healthcare, Pis-

cataway, NJ).

Results

The Expression of CXCL11 is Increased in MSCs

Co-cultured with HBMECs

We first characterized the hMSCs by examining hMSC spe-

cific markers (data not shown). The levels of multiple che-

mokines in hMSCs from different passage numbers were then

measured using quantitative real-time PCR. The results

indicate that the mRNA levels of CXCL11 in the hMSCs and

rat MSCs significantly increased with passage number

(Fig. 1a, b). We co-cultured hMSCs with HBMECs to

investigate the response of the MSCs to the BBB environ-

ment. The levels of CXCL11 were measured using quantita-

tive real-time PCR. As shown in Fig. 1c, the expression level

of CXCL11 was significantly increased in hMSCs (passage 6)

that were incubated with the HBMECs. To verify this result,

the levels of CXCL11 in the supernatants were measured by

ELISA. The results indicate that CXCL11 expression was

highly up-regulated in hMSCs that were co-cultured with the

HBMECs (Fig. 1d). These data suggest that CXCL11 might

be involved in the MSCs response to the BBB environment.

CXCL11 is Involved in hMSC Transendothelial

Migration

To investigate whether CXCL11 is involved in hMSCs

transendothelial migration, a transwell system was used.

Table 1 The primer sequences for CXCL11 and GAPDH for real-time PCR

Target Amplicon length, bp 50-30 oligonucleotide sequences, forward, reverse Nucleotide position Genbank accession no.

Human CXCL11 120 AGCAGTGAAAGTGGCAGAT

TTGGGATTTAGGCATCGT

324-343

425-443

NM_005409

Human GAPDH 197 GAAGGTGAAGGTCGGAGTC

GAAGATGGTGATGGGATTTC

108-126

314-333

NM_002046.3

Fig. 1 The expression of CXCL11 is increased in MSCs co-cultured

with HBMECs. a The levels of CXCL11 in human MSCs at different

passage numbers were measured by quantitative real-time PCR. b The

levels of CXCL11 in rat MSCs at different passage numbers were

measured by quantitative real-time PCR. c The levels of CXCL11 in

human MSCs co-cultured with HBMECs were measured by quanti-

tative real-time PCR. d The levels of CXCL11 in the supernatants

derived from the co-culture experiments were detected by ELISA. All

data are the mean ± SD from three independent experiments.

*p \ 0.05

Neurochem Res

123

Treatment with a CXCL11 neutralizing antibody significantly

decreased the migratory activity of the hMSCs (Fig. 2a). In

contrast, treatment with 100 ng/ml of recombinant human

CXCL11 protein significantly increased the transendothelial

migration of the hMSCs (Fig. 2b). These results indicate that

CXCL11 is involved in hMSCs transendothelial migration.

CXCL11 Mediates hMSCs Transendothelial Migration

by Affecting the Integrity of Tight Junctions Between

HBMECs

It has been previously reported that the disassembly of the

tight junctions between HBMECs is the key step to

transendothelial migration. Therefore, the effect of

CXCL11 on the integrity of the tight junctions between

HBMECs was evaluated according to the previous work.

The results indicate that CXCL11 significantly increased

HRP flux in a time and dose-dependent manner (Fig. 3a,

b). There was also an obvious shift in occludin distribution

from the insoluble to soluble fractions prepared from

HBMECs treated with recombinant human CXCL11 pro-

tein (Fig. 3c). In addition, the distribution of ZO-1, a TJ

structural protein, was visualized by immunofluorescence.

Treatment with CXCL11 disrupted the continuous lines at

the cell–cell borders, making the ZO-1 staining discontin-

uous (Fig. 3d). Thus, these results indicate that CXCL11

induces the disassembly of the tight junctions between

HBMECs to promote hMSCs transendothelial migration.

CXCR3 in HBMECs Mediates CXCL11-Induced

hMSCs Transedothelial Migration

It well known that CXCL11 is a member of the ELR–CXC

family and the ligand for the chemokine receptor CXCR3.

Several studies have demonstrated a pathogenic role of

CXCL11 and CXCR3 in many human inflammatory diseases.

As shown in Fig. 4a, the expression of CXCR3 significantly

increased in HBMECs that interacted with hMSCs. To

determine whether CXCR3 expression in HBMECs is

involved in the transendothelial migration of the hMSCs

toward CXCL11, a CXCR3 neutralizing antibody was used to

block the effects of CXCR3. The results showed that treat-

ment with an anti-CXCR3 antibody significantly reduced

hMSCs transedothelial migration (Fig. 4b).

The ERK1/2 Signaling Pathway is Required

for the CXCL11-Induced Alteration of Tight Junctions

in HBMECs

Previous reports have indicated that the integrity of tight

junctions is regulated by several intracellular signaling

Fig. 2 CXCL11 is involved in hMSCs transendothelial migration.

a Treatment with a CXCL11 neutralizing antibody decreased hMSCs

transendothelial migration. b Treatment with 100 ng/ml of recombi-

nant human CXCL11 protein increased hMSCs transendothelial

migration. All data are the mean ± SD from three independent

experiments. *p \ 0.05

Fig. 3 The effects of CXCL11 on brain endothelial permeability. a A

dose-dependent change in HRP flux was induced by CXCL11. b A

time-dependent change in HRP flux was induced by CXCL11. c A

shift in endothelial occludin from the insoluble to soluble phase in

response to CXCL11 was detected by Western blot. d The changes in

ZO-1 distribution in HBMECs treated with CXCL11 were visualized

by immunofluorescence. All data are the mean ± SD from three

independent experiments. *p \ 0.05

Fig. 4 CXCR3 in HBMECs mediates CXCL11-induced hMSCs

transedothelial migration. a The levels of the chemokine receptor

CXCR3 in HBMECs after incubation with the hMSCs were measured

by quantitative real-time PCR. b Treatment with a CXCR3 neutral-

izing antibody decreased hMSCs transendothelial migration. All data

are the mean ± SD from three independent experiments. *p \ 0.05

Neurochem Res

123

pathways, such as Rho/ROCK, PI3K/Akt, protein kinase C,

and ERK1/2. To define the intracellular signaling pathways

downstream of CXCL11/CXCR3 in HBMECs, the

HBMECs monolayers were pretreated with specific inhib-

itors for the above signaling molecules, and the brain

endothelial barrier function was examined in the presence

of CXCL11. As shown in Fig. 5a, the ERK1/2 inhibitor

PD98059 blocked the CXCL11-induced increase in HRP

flux, whereas the ROCK (Y27632), PI3K (LY294002), and

PKC (Go 6976) inhibitors had no effects. PD98059 sig-

nificantly abolished the detergent solubility of occludin

(Fig. 5b) and ZO-1 redistribution (Fig. 5c). We detected

the activation of the ERK1/2 signaling pathway in

HBMECs treated with CXCL11 using a specific antibody

for phosphorylated ERK1/2. Western blot analysis revealed

that phosphorylated ERK1/2 were increased in HBMECs

after treatment with CXCL11 (Fig. 5d). These findings

suggest that the ERK1/2 signaling pathway is associated

with the CXCL11-induced alteration of TJ between

HBMECs.

Discussion

MSCs have been used to treat a wide variety of diseases.

Although the therapeutic potential of MSCs in various

pathological conditions of the CNS has been explored, the

delivery of MSCs into the brain is still limited due to the

existence of the BBB. Our previous findings indicated that

the PI3K and ROCK signaling pathways were involved in

the migration of bone marrow-derived mesenchymal stem

cells through HBMECs monolayers [18]. Here, we reveal

that CXCL11 produced from hMSCs binds to CXCR3 on

HBMECs, resulting in the opening of tight junctions, which

promotes MSCs transendothelial migration.

Because the successful application of stem cell approa-

ches will depend on the microenvironment of the recipient

tissue [19], we investigated the response of MSCs in the

BBB environment. It is known that members of the CC

family, such as CCL2, specifically increase vascular per-

meability in vivo [20]. Our previous studies indicated that

CC chemokines, such as macrophage inflammatory protein-

1 alpha, increased the permeability of the HBMEC mono-

layer [21]. Therefore, we focused on the secretion of che-

mokines by hMSCs that increased the permeability of the

HBMECs monolayer to facilitate the transendothelial

migration of hMSCs. We treated hMSCs with human brain

endothelial cells and used quantitative real-time PCR to

measure the biological response. Our results indicated that

the chemokine CXCL11 significantly increased in hMSCs,

and the levels of CXCR3 on the brain endothelial cells

increased after co-culturing with hMSCs. Therefore, we

determined whether CXCL11 was required in hMSCs

migration across the brain endothelial cell monolayers.

CXCL11 is a small chemokine belonging to the CXC

chemokine family and is mainly expressed in peripheral

blood leukocytes [22]. It has been reported that CXCL11

binds to CXCR3 to induce the migration of activated T cells

in vitro and in vivo during pathological inflammation [23].

Moreover, CXCL11 stimulates growth, migration and

invasion of various tumor cell lines. In the present study we

found a novel role of CXCL11 that CXCL11 was involved in

Fig. 5 The ERK1/2 signaling

pathway is required for the

CXCL11-induced alteration of

tight junctions in HBMECs.

a The effects of inhibitors for

ROCK, ERK1/2, PI3K, and

PKC on CXCL11-induced HRP

flux. The HBMECs were

pretreated with a specific

inhibitor for ERK1/2 and then

treated with CXCL11. The

different detergent solubilities

of endothelial occludin were

analyzed by Western blot (b).

The changes in ZO-1

distribution were visualized by

immunofluorescence (c). The

activation of ERK1/2 in

HBMECs treated with CXCL11

was detected by Western blot

using a specific antibody for

phosphorylated ERK1/2 (d). All

data are the mean ± SD from

three independent experiments.

*p \ 0.05

Neurochem Res

123

the transendothelial migration of hMSCs. Treatment with

CXCL11 increased hMSCs transendothelial migration,

whereas blockage of CXCL11 using a specific antibody for

CXCL11 significantly decreased hMSCs transendothelial

migration. Importantly, we found that CXCL11 altered tight

junctions to increase the permeability of brain endothelial

cells. This alteration required the activation of the ERK1/2

signaling pathway in brain endothelial cells.

We also found that CXCL11 bound to and activated the

receptor CXCR3 in brain endothelial cells. CXCR3 is

mainly expressed on activated T and natural killer (NK)

cells. In addition to CXCL11, CXCL10 and CXCL9 are

also the ligands for CXCR3 [24]. However, in our studies,

the expression of CXCL9 and CXCL10 did not increase

during hMSCs and HBMECs interactions (data not shown).

It is well known that different biological outcomes may

also be related to the differential activation of CXCR3 by

CXCL10, CXCL9, and CXCL11 [25, 26]. CXCL11 has a

number of functional differences from CXCL10 and

CXCL9; CXCL11 has a significantly higher receptor

binding affinity than CXCL10 or CXCL9 [27]. In our

present paper, we report that CXCL11 increases the per-

meability of the brain endothelial cells during hMSCs

migration by making the junctions between the brain

endothelial cells ‘porous,’ which allows for the infiltration

of hMSCs into the brain tissue.

In this paper, we modeled hMSCs interactions with

human brain endothelial cells to mimic the BBB micro-

environment. We revealed that the elevated levels of

CXCL11 in hMSCs facilitated transendothelial migration

by binding to CXCR3 and activating the ERK1/2 signaling

pathway in brain endothelial cells. These results shed light

on MSC behavior in the BBB microenvironment and

suggested that chemokines like CXCL11 could trigger

paracrine responses in vivo to modify the brain endothelial

cells and contribute to hMSC infiltration into the brain.

References

1. Dezawa M, Ishikawa H, Itokazu Y, Yoshihara T, Hoshino M,

Takeda S, Ide C, Nabeshima Y (2005) Bone marrow stromal cells

generate muscle cells and repair muscle degeneration. Science

309:314–317

2. McFarlin K, Gao X, Liu YB, Dulchavsky DS, Kwon D, Arbab

AS, Bansal M, Li Y, Chopp M, Dulchavsky SA, Gautam SC

(2006) Bone marrow-derived mesenchymal stromal cells accel-

erate wound healing in the rat. Wound Repair Regen 14:471–478

3. Ruster B, Gottig S, Ludwig RJ, Bistrian R, Muller S, Seifried E,

Gille J, Henschler R (2006) Mesenchymal stem cells display

coordinated rolling and adhesion behavior on endothelial cells.

Blood 108:3938–3944

4. Sordi V, Malosio ML, Marchesi F, Mercalli A, Melzi R, Giord-

ano T, Belmonte N, Ferrari G, Leone BE, Bertuzzi F, Zerbini G,

Allavena P, Bonifacio E, Piemonti L (2005) Bone marrow

mesenchymal stem cells express a restricted set of functionally

active chemokine receptors capable of promoting migration to

pancreatic islets. Blood 106:419–427

5. Son BR, Marquez-Curtis LA, Kucia M, Wysoczynski M, Turner

AR, Ratajczak J, Ratajczak MZ, Janowska-Wieczorek A (2006)

Migration of bone marrow and cord blood mesenchymal stem

cells in vitro is regulated by stromal-derived factor-1-CXCR4 and

hepatocyte growth factor-c-Met axes and involves matrix

metalloproteinases. Stem Cells 24:1254–1264

6. Lee JK, Jin HK, Endo S, Schuchman EH, Carter JE, Bae JS

(2010) Intracerebral transplantation of bone marrowderived

mesenchymal stem cells reduces amyloid-beta deposition and

rescues memory deficits in Alzheimer’s disease mice by modu-

lation of immune responses. Stem Cells 28:329–343

7. Danielyan L, Schafer R, von Ameln-Mayerhofer A, Buadze M,

Geisler J, Klopfer T, Burkhardt U, Proksch B, Verleysdonk S,

Ayturan M, Buniatian GH, Gleiter CH, Frey WH 2nd (2009)

Intranasal delivery of cells to the brain. Eur J Cell Biol

88:315–324

8. Dharmasaroja P (2009) Bone marrow-derived mesenchymal stem

cells for the treatment of ischemic stroke. J Clin Neurosci 16:12–20

9. Abbott NJ, Patabendige AA, Dolman DE, Yusof SR, Begley DJ

(2009) Structure and function of the blood–brain barrier. Neu-

robiol Dis 37:13–25

10. Liu WY, Wang ZB, Zhang LC, Wei X, Li L (2012) Tight

junction in blood–brain barrier: an overview of structure, regu-

lation, and regulator substances. CNS Neurosci Ther 18:609–615

11. Zhou SB, Wang J, Chiang CA, Sheng LL, Li QF (2013)

Mechanical stretch upregulates Sdf-1a in skin tissue and induces

migration of circulating bone marrow-derived stem cells into the

expanded skin. Stem Cells. doi:10.1002/stem.1479

12. Augello A, Kurth TB, De Bari C (2010) Mesenchymal stem cells:

a perspective from in vitro cultures to in vivo migration and

niches. Eur Cell Mate 20:121–133

13. Chamberlain G, Smith H, Rainger GE, Middleton J (2011)

Mesenchymal stem cells exhibit firm adhesion, crawling,

spreading and transmigration across aortic endothelial cells:

effects of chemokines and shear. PLoS ONE 6:e25663

14. Carrero R, Cerrada I, Lledo E, Dopazo J, Garcıa-Garcıa F, Rubio

MP, Trigueros C, Dorronsoro A, Ruiz-Sauri A, Montero JA,

Sepulveda P (2012) IL1b induces mesenchymal stem cells

migration and leucocyte chemotaxis through NF-jB. Stem Cell

Rev 8:905–916

15. Trotta T, Costantini S, Colonna G (2009) Modelling of the

membrane receptor CXCR3 and its complexes with CXCL9,

CXCL10 and CXCL11 chemokines: putative target for new drug

design. Mol Immunol 47:332–339

16. Sung HJ, Hong SC, Yoo JH, Oh JH, Shin HJ, Choi IY, Ahn KH,

Kim SH, Park Y, Kim BS (2010) Stemness evaluation of mes-

enchymal stem cells from placentas according to developmental

stage: comparison to those from adult bone marrow. J Korean

Med Sci 25:1418–1426

17. Tropel P, Noel D, Platet N, Legrand P, Benabid AL, Berger F

(2004) Isolation and characterisation of mesenchymal stem cells

from adult mouse bone marrow. Exp Cell Res 295:395–406

18. Lin MN, Shang DS, Sun W, Li B, Xu X, Fang WG, Zhao WD,

Cao L, Chen YH (2013) Involvement of PI3K and ROCK sig-

naling pathways in migration of bone marrow-derived mesen-

chymal stem cells through human brain microvascular

endothelial cell monolayers. Brain Res 1513:1–8

19. Greco SJ, Rameshwar P (2008) Microenvironmental consider-

ations in the application of human mesenchymal stem cells in

regenerative therapies. Biologics 2:699–705

20. Wolf MJ, Hoos A, Bauer J, Boettcher S, Knust M, Weber A, Si-

monavicius N, Schneider C, Lang M, Sturzl M, Croner RS, Konrad

A, Manz MG, Moch H, Aguzzi A, van Loo G, Pasparakis M, Prinz

Neurochem Res

123

M, Borsig L, Heikenwalder M (2012) Endothelial CCR2 signaling

induced by colon carcinoma cells enables extravasation via the

JAK2-Stat5 and p38MAPK pathway. Cancer Cell 22:91–105

21. Man SM, Ma YR, Shang DS, Zhao WD, Li B, Guo DW, Fang

WG, Zhu L, Chen YH (2007) Peripheral T cells overexpress

MIP-1 a to enhance its transendothelial migration in Alzheimer’s

disease. Neurobiol Aging 28:485–496

22. Lazzeri E, Romagnani P (2005) CXCR3-binding chemokines:

novel multifunctional therapeutic targets. Curr Drug Targets

Immune Endocr Metabol Disord 5:109–118

23. Zeremski M, Petrovic LM, Talal AH (2007) The role of che-

mokines as inflammatory mediators in chronic hepatitis C virus

infection. J Viral Hepat 14:675–687

24. Groom JR, Luster AD (2011) CXCR3 in T cell function. Exp Cell

Res 317:620–631

25. Groom JR, Luster AD (2011) CXCR3 ligands: redundant, collab-

orative and antagonistic functions. Immunol Cell Biol 89:207–215

26. Muller M, Carter S, Hofer MJ, Campbell IL (2010) Review: The

chemokine receptor CXCR3 and its ligands CXCL9, CXCL10

and CXCL11 in neuroimmunity—a tale of conflict and conun-

drum. Neuropathol Appl Neurobiol 36:368–387

27. Loetscher P, Clark-Lewis I (2001) Agonistic and antagonistic

activities of chemokines. J Leukoc Biol 69:881–884

Neurochem Res

123