The human genome of is found where in the human body?

A. NucleusB. RibosomeC. Smooth ERD. Cell membrane

The cellular structure where proteins are made is called the

A. NucleusB. Smooth ERC. RibosomeD. Cell membrane

DNA and Biotechnology

Announcements

• Ch 21- today• Ch 21, 17- Wednesday• Bone & muscle labs- Due Wednesday• Ch 21, 17 online quizzes- Due Friday• Quiz 10- Friday (chs 21, 17)• Lab today- pGLO (DNA transformation)

Lecture Outline

• DNA- Structure, function, and importance• How DNA works

– The central dogma– Transcription and Translation– The DNA code– DNA replication

The importance of DNA

The DNA double helix is the code of life

• The blueprint for all structures in your body which are made of protein

• DNA is comprised of nucleotides

Nulceotides are the monomers of nucleic acid polymers

• Consist of a sugar, a phosphate, and a nitrogen-containing base

• Sugar can be deoxygenated

• Bases contain the genetic information

There are 4 kinds of DNA bases

Adenine always matches with

Thymine, Cytosine always

matches with Guanine-

Hydrogen bonds hold bases together

Living things are extremely complex• Cellular machinery is

sophisticated and required for life

• Cellular machinery is made largely of proteins

• Blueprints for all cellular machinery are contained in genes

• Genes are inherited from parents

• Humans have ~30,000 genes

Proteins give living things the variety of their structures

Protein variety is generated by 1o structure- the sequence of amino acids

which make the protein

Figure 2.12

Amino Acids

• Proteins consist of subunits called amino acids

How DNA works

• Replication• Transcription• Translation

The sequence of DNA bases is the code for the primary structure of

proteins

All cells require a copy of the genome

• Genome- all the genes of the cell • Human genome is made of DNA• DNA is similar in all cells• Gene- 1 DNA Molecule (+

proteins the genetic information to produce a single product (protein)

• DNA replication copies all cellular DNA

Replication of DNA

Figure 21.2

In vivo, enzymes such as DNA polymerase make DNA replication happen

The DNA code

Computers use binary digital code

• 01100001 = A• 01100010 =B• 01000011 =c• 00100111 = apostrophe• Etc.

• http://www.geek-notes.com/tools/17/text-to-binary-translator/

01000011 01101000 01100101 01100101 01110011 01100101 01100010 01110101 01110010 01100111 01100101 01110010 00100000 01000100 01100101 01101100 01110101 01111000 01100101 = cheeseburger deluxe

How does the DNA code work?

• atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttc=GFP

The DNA code is (nearly)

universalIt uses groups of 3 bases (codon)

3 bases = 1 codon = 1 amino acid

And what are these U’s for?

RNA is ribonucleic acid

• Ribose sugar is not deoxygenated

• RNA is single-stranded

• RNA has Uracil, not Thymine

• There are many kinds: mRNA, rRNA, tRNA, siRNA, etc.

RNA can fold back on itself

• Single strand offers greater flexibility

Kinds of RNA

mRNA tRNA

The Central Dogma of Molecular Biology

• DNA RNA Protein • DNARNA :

Transcription• RNA Protein:

Translation

When one DNA molecule is copied to make two DNA molecules, the new DNA contains

1. A) 25% of the parent DNA. 2. B) 50% of the parent DNA. 3. C) 75% of the parent DNA. 4. D) 100% of the parent DNA. 5. E) none of the parent DNA.

DNA RNA Protein Trait

The Universality of the DNA code makes

this possible

Firefly gene (Luciferase) in a tobacco plant

Transcription and Translation

Transcription: DNA RNA

DNA Codes for RNA, Which Codes for Protein

Figure 21.3

DNA information is transcribed into mRNA

Note in DNA: sense strand vs. antisense strand

Translation: RNA Protein

tRNA’s carry an amino acid at one end, and have an anticodon at the other

Figure 21.6

Amino acid(phenylalanine)

mRNA

Anticodon

Amino acidattachment site:Binds to a specific amino acid.

Anticodon:Binds to codon on mRNA, following complementary base-pairing rules.

The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in

sequence

tRNA’s add amino acids one by one according to mRNA instructions until the protein is complete

We would expect that a 15-nucleotide mRNA sequence will direct the production of a polypeptide that consists of

1. A) 2 amino acids. 2. B) 3 amino acids. 3. C) 5 amino acids. 4. D) 7 amino acids. 5. E) 15 amino acids.

Viruses exploit the universality of the DNA code to take control of cells

Basic life cycle of Viruses

• Viruses are obligate intracellular parasites

• They inject their genetic material into their host

• Host machinery is commandeered to mass-produce virus

• Viruses burst host cell to infect other cells

Virus Structure

• Many viruses contain only:– Protein capsid– Genome (DNA or RNA)

• Some viruses have a phosopholipid bilayer envelope

Bacteria are infected by viruses, too

Bacteriophages attacking bacterial cell The lytic bacterial life cycle

Bacteriophages

• Infect bacteria• Cause formation of

plaques on a lawn of agar in bacteria

Bacteria use restriction enzymes to defend against viral DNA

Restriction enzymes cut very specific sequences of DNA

• Hundreds of different restriction enzymes have been found

• Named after bacteria in which they are found

Viruses such as T4 fight back with DNA ligase

• Ligase glues DNA back together

• Viral countermeasures against bacterial cell defenses

Scientists commandeer these enzymes to perform DNA manipulations

• Ligase and restriction enzymes allow any sequence of DNA to be cut and pasted at will

• Plasmids, small loops of bacterial DNA, can be modified with any DNA

• Because the genetic code is universal, DNA will be read in the same way

Plasmid DNA

manipula-tion is at the heart

of biotech-nology

Bacterium

Bacterialchromosome

Plasmid

Gene inserted intoplasmid

Cell containing geneof interest

Gene ofinterest DNA of

chromosome

RecombinantDNA (plasmid)

Plasmid put intobacterial cell

Recombinantbacterium

Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest

Protein expressedby gene of interest

Protein harvested

Gene ofinterest

Copies of gene

Basicresearchon gene

Basicresearchon protein

Basic research andvarious applications

Gene for pestresistance insertedinto plants

Gene used to alterbacteria for cleaningup toxic waste

Protein dissolvesblood clots in heartattack therapy

Human growth hor-mone treats stuntedgrowth

The pGLO plasmid has

• ori- origin of replication1. GFP- green fluorescent

protein2. bla- beta-lactamase

(confers ampicillin resistance)

3. araC- Arabinose regulator protein (regulates GFP expression)

1. GFP: Green Fluorescent Protein• discovered in 1960s by Dr. Frank

Johnson and colleagues

• closely related to jellyfish aequorin

• absorption max = 470nm

• emission max = 508nm

• 238 amino acids, 27kDa

• “beta can” conformation: 11 antiparallel beta sheets, 4 alpha helices, and a centered chromophore

• amino acid substitutions result in several variants, including YFP, BFP, and CFP

40 Å

30 Å

2008 Nobel Prize- GFP

• GFP mice

Using GFP as a biological tracer

http://www.conncoll.edu/ccacad/zimmer/GFP-ww/prasher.htmlWith permission from Marc Zimmer

GFP can be fused to cellular proteins

GFP fusions are useful in Biology and medicine

Nervous system of C. elegans worm illuminated by GFP

GFP fused to Huntingtin protein in monkey to study Huntington’s disease

2. bla: β-lactamase enzyme can destroy penicillin and other β-lactam antibiotics

Antibiotic resistance genes are found commonly on plasmids and can be shared between

bacteria by conjugation

Bacterial conjugation is sex without reproduction

Genes for making a sex pilus also are often found encoded on plasmids

3. araC: araC regulates pGLO expression through the presence of arabinose

Arabinose is a 5-carbon sugar, different from ribose

Gene Regulation

Q: What is “regulation”?*

"When I was warning about the danger ahead on Wall Street months ago because of the lack of oversight, Senator McCain was telling the Wall Street Journal -- and I quote -- 'I'm always for less regulation.' " – Sen. Barack Obama

“Senator Obama was silent on the regulation of Fannie Mae and Freddie Mac, and his Democratic allies in Congress opposed every effort to rein them in…last year he said that subprime loans had been, quote, “a good idea.””- Sen. John McCain

* Slide created, September 2008

Regulation means controlProkaryotic cells require efficiency

Eukaryotic cells must differentiate

Eukaryotic genes can be turned on and off

• Females only use a single X chromosome per cell• Genes from the other chromosome are not used in that

cell

Random inactivation of one X chromosome creates a tortoiseshell pattern in cat fur

Genes are regulated in eukaryotes in more complex ways

• Each step in the process of gene expression is a possible point of control

• The cell capitalizes on each one

The job of master control genes is to turn many genes on or off

The gene eyeless turns on many genes involved in formation of eyes

When eyeless is mutated, eyes do not form

Master control genes control formation of entire organs

-Drosophila eyeless gene can be artificially turned on in non-eye cells

Prokaryotes must also regulate genes

Example: β- Galactosidase can hydrolyze lactose

11

lactose

galactose

glucose

H2O

- galactosidase(aka lactase in humans)

-galactosidase

10

When lactose is present, transcription is activated

In the absence of lactose, the lac operon is repressed by the lac repressor protein

04/19/23 73

araC allows expression of arabinose-digesting genes in the presence of arabinose

In pGLO, arabinose-digesting genes are removed, and araC is fused to GFP

• How do you think this fusion was made?

• What are the structural sequences? The regulatory sequences?

• What happens when we add arabinose sugar to these bacteria?

• What do you think is meant by “reporter gene”?

Gene Regulation

RNA Polymerase

araC

ara GFP Operon

GFP Gene

araC GFP Gene

araC GFP Gene

Effector (Arabinose)

B A DaraC

B A DaraC

RNA Polymerase

Effector (Arabinose)

araC B A D

ara Operon

On pGLO, the regulatory regions of the Arabinose operon have been glued to the structural sequences for GFP

What will happen on the Ara (+) plates?What will happen on the Ara (-) plates?

04/19/23 76

Grow? Glow?

Follow protocol On which plates will

colonies grow? Which colonies will

glow?

Which colonies will glow?

Plasmids with novel structural and regulatory genes are now easily manipulated by undergraduates

iGEM is an annual undergrad bioengineering contest Engineering bacteria to smell better

Which strand carries the DNA's instructions for synthesizing a particular protein from the nucleus to

the cytoplasm?

• A) Transfer RNA • B) Messenger RNA • C) RNA transcriptase • D) Ribosomal RNA

Why are the complementary base pairing rules so important when a cell needs to copy its DNA?

• A) The cells need both strands to be accurate because each strand codes for one half of the gene.

• B) As long as there is one strand, a copy can be made by following the pairing rules.

• C) Unless the bases pair up correctly, the DNA strand can break apart.

• D) Transcription cannot proceed unless the pairs are in the proper sequence.