INVESTIGATION

The Histone Acetyltransferase GcnE (GCN5) Playsa Central Role in the Regulation of Aspergillus

Asexual DevelopmentDavid Cánovas,*,†,1,2 Ana T. Marcos,*,1 Agnieszka Gacek,†,1 María S. Ramos,* Gabriel Gutiérrez,*

Yazmid Reyes-Domínguez,†,3 and Joseph Strauss†,‡

*Departmento de Genética, Facultad de Biología, Universidad de Sevilla, 41012, Spain, †Fungal Genetics and Genomics Unit,Department of Applied Genetics and Cell Biology, University of Natural Resources and Life Sciences, Vienna A-3430,

Austria, and ‡Department of Health and Environment, Bioresources, Austrian Institute of Technology, Tulln/Donau A-3430, Austria

ABSTRACT Acetylation of histones is a key regulatory mechanism of gene expression in eukaryotes. GcnE is an acetyltransferase ofAspergillus nidulans involved in the acetylation of histone H3 at lysine 9 and lysine 14. Previous works have demonstrated that deletionof gcnE results in defects in primary and secondary metabolism. Here we unveil the role of GcnE in development and show thata ΔgcnE mutant strain has minor growth defects but is impaired in normal conidiophore development. No signs of conidiation werefound after 3 days of incubation, and immature and aberrant conidiophores were found after 1 week of incubation. Centroid linkageclustering and principal component (PC) analysis of transcriptomic data suggest that GcnE occupies a central position in Aspergillusdevelopmental regulation and that it is essential for inducing conidiation genes. GcnE function was found to be required for theacetylation of histone H3K9/K14 at the promoter of the master regulator of conidiation, brlA, as well as at the promoters of theupstream developmental regulators of conidiation flbA, flbB, flbC, and flbD (fluffy genes). However, analysis of the gene expression ofbrlA and the fluffy genes revealed that the lack of conidiation originated in a complete absence of brlA expression in the ΔgcnE strain.Ectopic induction of brlA from a heterologous alcA promoter did not remediate the conidiation defects in the ΔgcnE strain, suggestingthat additional GcnE-mediated mechanisms must operate. Therefore, we conclude that GcnE is the only nonessential histone modifierwith a strong role in fungal development found so far.

CHROMATIN rearrangements are associated with thetranscriptional regulation of gene expression in eukar-

yotes. For example, facultative heterochromatin can be as-sociated with the transcriptionally active or silent states ofdevelopmentally regulated loci (Grewal and Jia 2007). Thisis achieved in part through histone post translational mod-ifications (PTM), which play a very important role in thecontrol of these active or silent chromatin states. Histonemodifications include acetylation, methylation, phosphory-

lation, and ubiquitination at different positions of the his-tone proteins. In particular, acetylation of lysine 9 or lysine14 in histone H3 has been associated with activation oftranscription. Acetylation of histones plays two roles in theregulation of transcription: it alters the physical propertiesof the histone–DNA interaction, and it also provides a framefor the binding of bromodomain proteins that remodel thechromatin and regulate gene expression (Spedale et al.2012). These modifications regulate the nucleosome posi-tioning at the gene promoters and the recruitment of theregulatory proteins. One of these modifiers, the SAGA com-plex, is responsible for the acetylation of several lysineresidues in the N-terminal region of histones, particularlyhistone H3 lysine 9 (H3K9) and histone H3 lysine 14(H3K14) (Kuo et al. 1996). The SAGA complex is a multi-meric protein association with several subunits includingAda2p, Ada3p, Spt3p, and Tra1p (Grant et al. 1997; Spedaleet al. 2012), where Gcn5p is the subunit with the histone

Copyright © 2014 by the Genetics Society of Americadoi: 10.1534/genetics.114.165688Manuscript received May 1, 2014; accepted for publication June 4, 2014; publishedEarly Online June 6, 2014.Supporting information is available online at http://www.genetics.org/lookup/suppl/doi:10.1534/genetics.114.165688/-/DC1.1These authors contributed equally to this work.2Corresponding author: Departamento de Genética, Facultad de Biología, Universidadde Sevilla, Reina Mercedes 6, 41012 Sevilla, Spain. E-mail: davidc@us.es

3Present address: Research Centre for Agriculture and Forestry Laimburg, Laimburg6, Auer/Ora, BZ, 39040, Italy.

Genetics, Vol. 197, 1175–1189 August 2014 1175

acetyltransferase (HAT) catalytic activity (Grant et al. 1997).The SAGA complex is implicated in several functions relatedto transcription, such as transcription initiation and elonga-tion, histone ubiquitination, and interactions of TATA-bindingproteins. In addition, SAGA has also been implicated inmessenger RNA (mRNA) export in yeasts and Drosophila(Rodriguez-Navarro et al. 2004; Kurshakova et al. 2007).In Saccharomyces cerevisiae, the SAGA complex is involved inthe transcriptional regulation of 12% of the yeast genome.Approximately, a third of that 12% of the yeast genome isdownregulated and two-thirds are upregulated in DGCN5cells (Lee et al. 2000), implying a direct or indirect negativerole of Gcn5p. Interestingly, a high proportion of genes regu-lated by SAGA are upregulated during the responses to envi-ronmental stresses (such as heat, oxidation, and starvation)(Huisinga and Pugh 2004). The SAGA complex is also presentin metazoans, where it has diverged and evolved into fourdifferent complexes (two SAGA and two ATAC complexes),while lower eukaryotes, such as yeasts and other fungi, con-tain one single SAGA complex. It was hypothesized that thisevolution into a diverse set of complexes is involved in cellu-lar specialization during development and homeostasis inmetazoans (Spedale et al. 2012). The SAGA and ATAC com-plexes participate in the regulation of genes in response tointracellular and extracellular signals: protein kinase C sig-naling, response to osmotic stress, UV-induced DNA damage,arsenite-induced signaling, endoplasmic reticulum stress, andnuclear receptor signaling (Spedale et al. 2012). Likewise,plants also have multiple HATs. In Arabidopsis, AtGCN5 isinvolved in many developmental processes (Servet et al.2010).

Although elegant experimental approaches using Neuros-pora crassa as a model system have significantly contributedto general concepts of DNA methylation, genome defense,and heterochromatin formation (Tamaru and Selker 2001;Freitag et al. 2002, 2004; Honda et al. 2010; Rountree andSelker 2010), studies on transcriptionally related chromatinrearrangements and histone modifications are still scarce infilamentous fungi, a broad group of ecologically, industrially,and clinically important organisms. In N. crassa, the tran-scriptional activation of the light-inducible gene al-3requires the acetylation of histone H3K14 by a homolog ofGcn5p, NGF-1 (Grimaldi et al. 2006), and in Aspergillusnidulans the SAGA/ADA complex is involved in the acetyla-tion of H3K9/K14 at the prnD-prnB bidirectional promoterduring inducing conditions, but increased levels of H3K9ac/K14ac are not required for transcription (Reyes-Dominguezet al. 2008). Georgakopoulos et al. (2013) reported the de-lineation of the A. nidulans SAGA complex with a combinedproteomics and bioinformatics approach revealing a highconservation with the yeast SAGA complex except for thedeubiquitination–H2B–Ub complex. Only recently, the rele-vance of chromatin-based silencing of secondary metabolitegene clusters was recognized in several Aspergillus and Fusa-rium species (Shwab et al. 2007; Bok et al. 2009; Lee et al.2009; Reyes-Dominguez et al. 2010; Strauss and Reyes-

Dominguez 2011). For example, it has been demonstratedthat acetylation of histone H3 is required for the synthesis ofsecondary metabolites in A. nidulans (Reyes-Dominguezet al. 2010; Nützmann et al. 2011; Bok et al. 2013; Nützmannet al. 2013). Reduction of heterochromatin marks leads tohigher secondary metabolite production in Aspergillus andFusarium species (Reyes-Dominguez et al. 2010, 2012), andit has also been found that it de-represses silent clusters,leading to the production of novel metabolites (Bok et al.2009). In addition, adverse metabolic and morphologiceffects are also observed in histone modifier mutants, forexample, deletion of the histone H3K9 methyltransferaseclrD in Aspergillus fumigatus resulted in reduced radialgrowth and also delayed transcriptional activation of brlAand conidiation (Palmer et al. 2008).

Asexual reproduction, also called conidiation, results inthe formation of mitotic propagules (conidia), which are theinfectious particles for pathogenic filamentous fungi. Con-idiation is the most common and proliferative reproductivemode in filamentous fungi. For this reason, conidiation hasbeen extensively studied in A. nidulans for several decades(for recent reviews see Etxebeste et al. 2010; Park and Yu2012; Krijgsheld et al. 2013). Conidiation is controlled bya central regulatory pathway (Figure 1), encompassingthree transcriptional activators: BrlA, AbaA, and WetA (seereviews by Adams et al. 1998; Yu et al. 2006). The firstcomponent in this regulatory cascade, BrlA, is essential todrive conidiation (Adams et al. 1988). brlA expression issilent during vegetative growth, and its expression duringconidiation is controlled by a number of genes, including thefluffy genes. Deletion of any of the fluffy genes gives a typicalfluffy phenotype with cotton-like colonies, lack of normalconidia, and reduced levels of brlA expression (Adamset al. 1998; Yu et al. 2006). There are six fluffy genes: fluGand flbA–E. fluG encodes a protein similar to bacterialglutamine synthetases (Lee and Adams 1994), and theFluG protein is responsible for the synthesis of the extracel-lular factor dehydroaustinol that, in conjunction with theorsellinic acid derivative diorcinol, induces conidiation(Rodriguez-Urra et al. 2012). FluG works upstream of theflbA-E genes (Yu et al. 2006). Flb genes operate in threeparallel routes in A. nidulans to regulate the expression ofbrlA upon induction of conidiation. FlbA is a repressor of theG-protein signaling, which participates in a protein kinase A-dependent pathway to promote filamentous growth and toinhibit conidiation (Yu et al. 1996). FlbE interacts with FlbBat the fungal tip and is required for proper activation of FlbB(Garzia et al. 2009). FlbB is a bZip transcription factor thatactivates the transcription of flbD, a cMyb-type regulator.Then, both FlbB and FlbD jointly activate the transcriptionof brlA (Garzia et al. 2010). FlbC is a putative C2H2 Zn fingerprotein that constitutes a third route for the regulation ofbrlA expression (Kwon et al. 2010). These fluffy genes areexpressed in vegetative mycelium and are able to respond tointracellular stimuli to induce a coordinated activation of themaster regulator brlA (Etxebeste et al. 2010).

1176 D. Cánovas et al.

Previous work noted that deletion of the SAGA subunitsgcnE or adaB in A. nidulans resulted in strongly reducedconidiation, while not affecting the activation (but repress-ibility) of the proline utilization genes prnD-prnB, whichare transcribed divergently from a bidirectional promoter(Reyes-Dominguez et al. 2008). Interestingly, Georgakopouloset al. (2012) also found a lack of acetate repressibility ina SAGA-defective mutant. Here, we clarify the role of GcnEin the control of fungal development.

Materials and Methods

Strains, media, and culture conditions

The A. nidulans strains used in this study are listed inSupporting Information, File S1, and Table S1. Strains weregrown in complete or minimal media containing the appro-priate supplements (Cove 1966). Glucose was used as thecarbon source and ammonium nitrate was used as the nitro-gen source. In the brlA-overexpressing experiments, threonineand fructose were used as carbon sources to overexpress thebrlA gene, and glucose was used to repress the brlA geneunder the control of the promoter of the alcA gene. Ammo-nium tartrate was used as nitrogen source. Strains wereobtained following standard procedures (Pontecorvo et al.1953). Trichostatin A, butyric acid, and valproic acid werepurchased from Sigma and used as histone deacetylase(HDAC) inhibitors at a concentration of 5 mM.

RNA isolation and real-time RT-PCR

Isolation of RNA and quantification of mRNAwere performedas previously described (Ruger-Herreros et al. 2011). Briefly,mycelia (100–200 mg) were disrupted in 1 ml of TRI reagent(Sigma) with 1.5 g of zirconium beads by using a cell homo-geneizer (FastPrep-24, MP Biomedicals). Cell debris was

removed by centrifugation, and RNA samples were furtherpurified using the NucleoSpin RNA II Kit (Macherey-Nagel).

The primers employed for real-time RT-PCR are detailedin Table S2. Real-time RT-PCR experiments were performedin triplicates (technical replicates) in a LightCycler 480 II(Roche) by using the One Step SYBR PrimeScript RT-PCRKit (Takara Bio Inc.). The fluorescent signal obtained foreach gene was normalized to the corresponding fluorescentsignal obtained with the b-tubulin gene benA to correct forsampling errors. Expression data are the average of at leastthree independent biological replicates.

Microarray experiment

Strains were grown in complete liquid medium for 18 hr at37�, and then conidiation was induced by transferring thevegetative cultures to complete solid media. Strains werefurther grown for 10 hr at 37�. Samples were immediatelyfrozen in liquid nitrogen upon harvesting and stored at –80�until processing. RNA was isolated from strains grown inliquid or solid media as previously reported (Schinko et al.2010). RNA samples were quality controlled with the Agi-lent 2100 Bioanalyzer using the RNA 6000 Nano Kit.For each array, 1 mg of total RNA was labeled with Message-AmpTMII-Biotin Enhanced RNA Kit (Ambion) according tothe manufacturer’s instructions. Hybridizations were doneautomatically for 16 hr at 45� using the GeniomRT Analyzer.The array underwent a stringent wash. Following the label-ing procedure, a microfluidic-based primer extension assaywas performed. This assay utilized the bound mRNAs asa primer for an enzymatic elongation with labeled nucleo-tides. The elongation was done with Klenow Fragment andbiotinylated nucleotides at 37� for 15 min. Finally, the arraywas washed automatically and detection was achieved withstreptavidin–phycoerythrin using a Cy3 filter set in a GeniomRTAnalyzer. Three independent biological replicates wereobtained for each sample.

Analysis of microarray data

The experimental dataset is deposited in the Gene Expres-sion Omnibus database (accession no. GSE48426). For thefour conditions, further data analysis was performed in theBioconductor R (http://www.bioconductor.org/). Raw in-tensity values were imported into R for statistical analysisusing the Limma package (Smyth 2005). First, we carriedout a global background subtraction; i.e., for each array, theglobal background was computed and subtracted fromthe measured intensity. To account for variations betweenthe hybridized arrays, variance stabilizing normalization (VSN)was used. The normalized data were thereby transformed toa so-called generalized log scale. Thus, the fold quotients werealso calculated on a log scale (qmedian). To provide estimatesof the fold quotients, we utilized the exponential function. Thiswas roughly equivalent to using the natural logarithm insteadof log2 (log-qmedian).

For the detection of differentially regulated genes betweenvegetative growth and conidiation in the wild-type or the

Figure 1 Simplified model of the genetic regulation of conidiation. Onlysome of the regulators studied in this work are shown for clarity. FluG isresponsible for the synthesis of an extracellular factor that induces the rest ofthe fluffy genes in the three parallel routes. FlbE (not shown) interacts andactivates FlbB. FlbB and FlbD are transcription factors that jointly bind to thepromoter of brlA, activating its transcription. FlbC is another transcriptionfactor activating the expression of brlA. FlbA is a regulator of G-proteinactivity that positively regulates the transcription of brlA. Activation of brlAis necessary and sufficient to induce conidiation. Ovals indicate the promoterregions, and in front of brlA correspond to the two sites analyzed by ChIP.

GcnE is Essential for Fungal Conidiation 1177

mutant strain, the Empirical Bayes test statistics (Smyth 2005)was used. The raw P-values were adjusted for multiple testingto control the false discovery rate by using the Benjamini–Hochberg (BH) method (Benjamini and Hochberg 1995) witha cutoff of adjusted P-value of ,0.05. Under this criterion, allselected genes showed a minimum log-qmedian , 20.7 or.0.7 (where a log-qmedian of 0.7 was roughly equivalent toa twofold change).

To study the effect of the different factors (mutant, wildtype, vegetative growth, and conidiation) on gene expression,we performed the ANOVA test of the normalized intensitiesusing the Babelomics 4 suite (Medina et al. 2010). Differen-tially expressed genes were selected using a cutoff of adjustedP-values (BH method) of 0.05. The normalized intensities ofthe genes selected by the ANOVA test were used for PC anal-ysis and clustering of the 12 samples (under four differentconditions with 3 replicate samples each). The PC analysiswas performed with PAST (Hammer et al. 2001). Cluster anal-ysis was performed by centroid linkage clustering of the eu-clidean distances in Eisen’s modified Cluster 3.0 (de Hoon et al.2004). Gene Ontology (GO) analysis was performed with theGO Term Finder tool at the Aspergillus Genome Database site(http://www.aspergillusgenome.org) (Arnaud et al. 2010).

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) assays were carriedout as previously described (Reyes-Dominguez et al. 2008)with primers listed in Table S2. DNA was immunoprecipi-tated with antibodies recognizing acetylated K9 and K14 ofhistone H3 (Millipore ab 06-599) or the C terminus of his-tone H3 (Abcam ab1791). For each sample, the absoluteamount of the specific DNA fragment in the immunopreci-pitated sample was divided by the amount of this fragmentin the sample before precipitation (normalizing to inputDNA). The values shown are the averages of at least threebiological repetitions. Standard errors are indicated.

Scanning electron microscopy

Strains were grown on complete solid medium for 7 days at37�. Samples were prepared for electron microscopy as pre-viously reported (Canovas et al. 2011) with some modifica-tions. Briefly, excised cubes of agar containing fungal matswere fixed with 2.5% glutaraldehyde in cacodylate bufferfor 2 hr at 4� and then treated with 1% OsO4 in cacodylatebuffer for 2 hr at 4�. Samples were slowly dehydrated byfirst using increasing concentrations of ethanol from 10 to70% and then using increasing concentrations of acetonefrom 70 to 100%. Samples were dried in a Balzers CPD030 Critical Point Dryer and gold-coated. Samples were ex-amined with a JEOL 6460LV Scanning Electron Microscope.

Results

ΔgcnE strain does not undergo asexual development

Reyes-Dominguez et al. (2008) noted that deletion of theSAGA/ADA components gcnE or adaB resulted in strongly

reduced conidiation. Here, we followed the developmentalprocess in complete medium in a time-course experiment. Asshown in Figure 2A, conidiophore heads were already evi-dent after 10 hr of induction in a wild-type strain. After72 hr of induction, conidiophores were completely maturewith heads displaying the regular cylindric morphology.However, the ΔgcnE mutant strain did not show any evi-dence of conidiophore formation even after 72 hr of induc-tion. Complementation of the ΔgcnE deletion restored theconidiation defects (Figure S1).

The phenotype of the deletion strain was compared toa set of strains harboring deletions in genes of the centralregulatory pathway (brlA, abaA, or wetA) to search for thestep at which conidiation was blocked. As shown in Figure2B, the brlA mutant produced the stalk cells and then con-tinued growing rather than developing the conidiophorevesicles, metulae, phialides, and conidia, which gave it a bris-tly appearance under the stereo microscope. Mutations inabaA and wetA interfered in later stages of the conidiophoredevelopment, and white structures corresponding to thevesicles, metulae, and phialides could be observed underthe stereo microscope. The phenotypic differences betweenabaA and wetA mutants with regards to the formation ofconidia could not be observed at this magnification. Never-theless, the phenotype of ΔgcnE did not resemble ΔabaA orΔwetA strains, suggesting that developmental defects prob-ably originate in genes upstream of abaA. Indeed, the ΔgcnEmutant looked more like a ΔbrlA strain. When the ΔgcnEstrain was allowed to grow for 1 week, some conidiophorescould be observed (Figure 2C). The colony showed a verylow density of conidiphores as compared to a wild-typestrain. In addition, higher SEM magnifications revealed thatthe conidiophores were not completely developed, harbor-ing rows of four conidia at most, even after 1 week ofgrowth. Most remarkably, these conidiophores displayed ab-errant morphologies, for example, a conidium arising froma hyphal tip, rama growing out of stalk cells, or sterimagtacells budding off what could be stalk or hyphal cells(Figure 2D).

We reasoned that the conidiation defects could be due tothe growth reduction previously reported (Reyes-Dominguezet al. 2008). To test this, we quantified the linear growthrate of both the wild-type and an isogenic ΔgcnE mutantstrain on complete and minimal solid media (Figure 3A).Consistent with the previous report, the wild-type straingrew faster than the ΔgcnE strain on both completeand minimal media. However, the growth reduction ob-served in the mutant strain was not strong enough to ex-plain the conidiation defects. When both the wild-type andthe ΔgcnE strains were point-inoculated on plates andallowed to grow until they reached the same colony size(diameter), the wild type showed strong conidia develope-ment whereas the mutant strain did not show any signs ofconidiation (Figure 3B). This suggests that the growth re-duction in the mutant strain is not responsible for the con-idiation defects.

1178 D. Cánovas et al.

Transcriptome analysis of conidiation

The fact that the gcnE-deletion mutant phenotype was mostsimilar to the ΔbrlA mutant suggested that conidiation isblocked at an early stage of development, and no or veryfew conidiophore heads are produced. Thus, the mutantcells are most likely defective in the expression of the up-stream developmental regulators or genes in the centralregulatory pathway. As chromatin modifyers impact on theexpression of a large set of genes, we globally comparedgene expression in the wild type and in the ΔgcnE duringvegetative growth and development. In a first approach, thetranscriptomes of wild-type cells grown vegetatively inliquid medium (time 0, non-induced) and at 10 hr afterinduction of conidiation on solid medium (time 10 hr,inducing conditions) were compared using two colors ex-pression microarray. At this time, genes in the central regu-latory pathway are already activated. The analysis of thedata by Empirical Bayes Test statistics revealed that 1225genes were differentially regulated (i.e., 13.6% of the totalnumber of genes in the chip) between these two conditions.

Of these 1225 differentially regulated genes, 600 weredownregulated and 625 were upregulated (Figure S2; TableS3 and Table S4 list the Top 25 up- and downregulatedgenes). This suggests that after 10 hr of induction a majorreprogramming of the gene expression profile occurred inthe conidiating cultures. Some of the upregulated genes arerelevant for the regulation of conidiation (see Table 1 fora list of genes), for example, the fluffy gene flbC, and thecentral regulatory cascade of transcriptional activators (brlA,abaA, and wetA) involved in the temporal and spatial regu-lation of the conidiation genes (Mirabito et al. 1989). Othergenes involved in conidiation were also found to be upregu-lated, such as vosA, medA, ivoB, yA, rodA, and dewA. Geneontology (GO) term analysis of the significant genes upre-gulated during conidiation revealed that some terms wereenriched (see Figure S3), e.g., carbohydrate metabolism, inwhich 60 genes of the 584 upregulated genes having GOdescriptions were induced, including polysaccharide (25),pectin (7), alcohol (31), xylan (6), and pentose (9) metab-olism genes. Another GO term was found to be involved in

Figure 2 The ΔgcnE mutant is impaired in conidiation. (A) Wild type (WT) and ΔgcnE strains were grown vegetatively for 18 hr, and then conidiationwas induced in complete medium. Progression of the developmental program was followed under the stereo microscope at the indicated time points.Conidiophore heads were evident after 10 hr of induction in the wild-type strain. Yellow conidia were evident 24 hr after induction. No such structureswere seen in the ΔgcnE strain even after 72 hr of induction. (B) Comparision of the conidiation phenotype of wild-type and ΔgcnE strain with thephenotypes of the mutants in the central regulatory pathway (ΔbrlA, ΔabaA, or ΔwetA) after 4 days of growth. The brlAmutant produced the stalk cellsand then continued growing rather than developing the conidiophore vesicles, metulae, phialides, and conidia. Mutations in abaA and wetA interferedin later stages of conidiophore development and were capable of producing white structures corresponding to the vesicles, metulae, and phialides. TheΔgcnE strain resembles a ΔbrlA phenotype. (C) SEM images of the wild-type and ΔgcnE strains grown for 1 week. A very low density of immatureconidiophores can be observed in the ΔgcnE strain, compared to the complete development of the wild-type conidiophores. Bar, 50 mm. (D) Details ofSEM images comparing the wild-type conidiophores with the aberrant ΔgcnE conidiophore morphologies (indicated by arrows). Arrows indicate detailsof aberrant conidiophores. The double-line arrow points to a severe example where sterigmata cells seem to bud off from a hyphal or stalk cell. A highermagnification of this example is shown as a separate image at the top right. Bar, 10 mm, except for the top right image where the bar corresponds to5 mm.

GcnE is Essential for Fungal Conidiation 1179

secondary metabolism and toxin synthesis corresponding to20 genes of the 584 upregulated genes having GO descrip-tions (e.g., 8 genes of the sterigmatocystin biosynthesis clus-ter and the regulator aflR). Another GO group that wasenriched is related to cell-wall biogenesis (18 of 584), whichincludes conidiation genes involved in the synthesis of thespores layers (dewA, rodA, wetA). sdeA and sdeB, which arerequired for development in A. nidulans (Wilson et al.2004), belong to another enriched GO.

GO term analysis of the significant genes downregulatedduring conidiation (i.e., vegetative genes) identified smallmolecule metabolism (89 genes of the 579 downregulatedgenes having GO descriptions), which included metabolismof ketone (52), carboxilic acids (51), and cellular nitrogen(39) and biosynthesis of heterocycle (cofactor and coenzyme)(25) and nucleotides (17) (see Figure S3). This suggests thatgenes involved in primary metabolism were expressed morestrongly during vegetative growth, while genes related todevelopment or secondary metabolite production wereexpressed at a higher level during the conidiation program.

Transcriptome analysis of gcnE-dependent andindependent control of gene expressionduring development

In contrast to the 1225 genes differentially regulated in thewild-type strain, only 319 genes were differentially regu-lated in the ΔgcnE strain when vegetative and conidiation

conditions were compared (Figure S2). This corresponds toonly 26% of the number of genes (319 in the ΔgcnE strain vs.1225 in the wild type) differentially regulated in the wild-type strain. Therefore, deletion of gcnE appeared to affectthe expression of a large number of genes regulated duringdevelopment. Of these differentially expressed genes, 181genes were upregulated and 138 genes were downregulatedin the ΔgcnE mutant (Figure S2; Table S5 and Table S6 listthe Top 25 up- and downregulated genes). In agreementwith the phenotype of the mutant, some regulators of con-idiation were not upregulated during conidiation in theΔgcnE strain, for example, brlA, abaA, wetA, vosA, and medA(Table 1). In addition, genes required for the synthesis ofsecondary metabolites (such as laeA or the sterigmatocystingene cluster) were not upregulated either.

Several GO groups mainly related to primary metabolismshowed a higher expression level during vegetative growth inthe mutant, but only one GO group, namely xylan metabo-lism, was more strongly expressed in the gcnE mutant underconidiation conditions (Figure S4). Therefore, wild-type andΔgcnE strains shared most of the GO terms of genes upregu-lated during vegetative growth but not during conidiation,suggesting that deletion of gcnE affected mainly the regula-tion of genes during development. Of the 625 genes upregu-lated during development in the wild type, 41 were alsoupregulated in the ΔgcnE, which suggests that these genesare gcnE-independent. Seventy-four genes appeared to begcnE-independent in the downregulated genes (Figure S2).

Transcriptome analysis reveals that GcnE is involved inthe regulation of conidiation and secondarymetabolism genes

The transcriptome data of the wild-type and ΔgcnE cells wasfurther analyzed by ANOVA to allow the comparision of allfour conditions at the same time, i.e., wild-type vegetative,wild-type conidiation, ΔgcnE vegetative, and ΔgcnE conidia-tion. Using this type of analysis, 1162 genes were found tobe differentially expressed in at least one of the conditions.This corresponds to 10.9% of the total number of predictedA. nidulans genes. The expression pattern of these 1162differentially expressed genes was grouped by using cen-troid linkage clustering of the euclidean distances. Theresulting dendrogram shows that the ΔgcnE strain grownunder conidiation conditions clustered together with vege-tative cultures of both the wild-type and the mutantstrain (Figure 4A). We further analyzed the differentiallyexpressed gene set by PC analysis to assess the contributionof the genetic background or the growth mode to the geneexpression pattern. PC analysis assigns coordinates (compo-nents) to the variation in gene expression, representing thelargest, second largest, third largest, and so on variance inthe corresponding axis. As shown in Figure 4B, the majorvariation between vegetative growth and conidiation in thewild-type strain was depicted in the first PC (the x-axis),while the second PC (the y-axis) showed small differencesbetween these two conditions in comparison (�50 and 11

Figure 3 Differences in growth rate do not explain the conidiationdefects in ΔgcnE. (A) Growth of wild-type and ΔgcnE strains was followedon complete and minimal solid media over a period of 5 days. The lineargrowth rate of the mutant was only slightly lower in comparison with thewild type on both media. The growth rate is shown as the increment inthe colony diameter on solid media per day. Error bars show the standarderror of at least three independent experiments performed in duplicates.(B) Wild type and ΔgcnE strains were point-inoculated on complete mediaplates and allowed to grow at 37 �C. Plates were photographed after thecolonies reached the same size.

1180 D. Cánovas et al.

Table 1 Differentially regulated genes involved in development (sexual or asexual) and secondary metabolism inA. nidulans

WT vegetativevs. conidiation

ΔgcnE vegetative vs.conidiation

Genename

Genecode qmediana

Logqmedian qmedian

Logqmedian

Description ofgene function

dewA AN8006 160.8 5.1 — — Hydrophobin, protein of the conidiumwall responsible for hydrophobicityof conidium surface

yA AN6635 28.2 3.3 — — Conidial laccase (p-diphenol oxidase)involved in dark-green pigmentproduction of conidium wall

pclA AN0453 11.6 2.4 5.4 1.7 G1/S cyclin: mutants produce abnormalconidiophores with extra layers ofphialides.

ivoB AN0231 11.1 2.4 3.7 1.3 Conidiophore-specific phenol oxidasewetA AN1937 11.0 2.4 — — Regulatory protein involved in conidial

developmentaflR AN7820 10.0 2.3 — — Transcriptional activator of the

sterigmatocystin biosynthesis gene clusterabaA AN0422 8.9 2.2 — — TEA/ATTS domain transcriptional activator

involved in regulation of conidiation;required for phialide differentiation.

brlA AN0973 5.9 1.8 — — C2H2 zinc-finger transcription factor,master regulator of conidiophoredevelopment

rodA AN8803 5.5 1.7 — — HydrophobinmedA AN6230 5.3 1.7 — — Protein involved in regulation of

conidiophore development; requiredfor normal temporal expression of brlA.

hogA AN1017 4.2 1.4 — — MAPK involved in osmotic stress response;required for sexual developmentand conidiation.

flbC AN2421 3.7 1.3 — — C2H2 zinc-finger transcription factor;involved in regulation of conidiophoredevelopment.

vosA AN1959 3.6 1.3 — — Nuclear protein involved in spore formationand trehalose accumulation

imeB AN6243 0.4 20.9 — — Serine/threonine protein kinase involved inlight-mediated regulation of sexualdevelopment and sterigmatocystinproduction

nsdC AN4263 0.3 21.2 — — C2H2 zinc-finger transcription factor;required for sexual development.

laeA AN0807 0.2 21.9 — — Methyltransferase-domain protein:velvet complex component composedof VelB, VeA and LaeA; coordinatesasexual development in response tolight; regulates secondary metabolism;and is required for Hülle cell formation

pipA AN2513 0.1 21.9 — — Serine/threonine protein kinase involved inhyphal growth and asexual development

sskA AN7697 — — 0.2 21.6 Response regulator, part of a two-component signal transducer involvedin the HOG-signaling pathway thatregulates osmotic stress response; nullspores are heat labile and loseviability at 4�

rosA AN5170 — — 13.6 2.6 Zn(II)2Cys6 transcription factor; negativeregulator of sexual development

—, not differentially regulated under those conditions in that strain.a qmedian values .1 (or positive log qmedian values) indicate that the gene is expressed during conidiation, while qmedian values ,1 (or negativelog qmedian values) indicate that the gene is expressed during vegetative growth. An absence of value indicates that gene is not differentiallyexpressed in that strain.

GcnE is Essential for Fungal Conidiation 1181

units, respectively). On the other hand, differences betweenthe wild-type strain and the ΔgcnE mutant appeared mainlyin the second PC (y-axis) and not in the x-axis, when thestrains were grown vegetatively (�4 units in the x-axis vs.16 units in the y-axis). This difference between the wild typeand mutant strains in the y-axis strongly increased whenconidation was induced (�31 units). PC analysis assigned49% of the variation to the mode of growth (vegetative vs.conidiation) and 26% to the genetic variation (wild type vs.ΔgcnE). These results mean that the gene expression profile

of the vegetative wild-type strain was similar to the ΔgcnEstrain under both vegetative and conidiation conditions inthe x-axis/first PC (�4 and 13 units, respectively; Figure4B). In other words, the gcnE mutant under conidiationconditions was more similar to the wild-type strain growingvegetatively than conidiating (the gene expression profile ofthe gcnE mutant was similar to the vegetatively growingwild type regardless of the growth mode of the mutant).The results of this statistical analysis enforces the view thatGcnE plays a more important role in regulation of develop-ment and seems to be less involved in the regulation oftranscription under the conditions of vegetative growth usedin this set of experiments. Among the top 20 genes differ-entially expressed during conidiation in the wild-type strain(positive side of the first PC), 9 genes are known to havea role in conidiation or secondary metabolism (Table S7).The negative side of the first PC includes genes involved inoxidoreduction or other metabolic activities, such as hydro-lases and peptidases (Table S8). Using this approach, wethus identified a group of genes that were specificallyexpressed in the wild-type strain during conidiation butwere not expressed in the gcnE mutant under any condition.

Two interesting genes appearing in this list were nkuAand nkuB. Knockout strains of nkuA have become widelyused in Aspergillus and Neurospora laboratories after thediscovery that deletion of the KU80 or KU70 homologsresults in a high rate of homologous integration but does notaffect development (Ninomiya et al. 2004; da Silva Ferreiraet al. 2006; Krappmann et al. 2006; Nayak et al. 2006). How-ever, both genes were found to be upregulated during conidia-tion, and their induction seems to be GcnE-independent(upregulated also in the ΔgcnE mutant). A more completeanalysis of the GO terms of genes found to be differentiallyregulated by ANOVA is shown in Figure S5, Figure S6, TableS7, Table S8, Table S9, and Table S10.

brlA is a major target of GcnE

Analysis of the transcriptomes revealed that conidiationgenes and their regulators were induced in the wild-typestrain after 10 hr of induction, but most of these genesremained unchanged in the ΔgcnE strain (Table 1). Asexpected, we found brlA as an induced gene in the wildtype, but this central regulator was not upregulated in theΔgcnE strain. To get further details and to confirm transcrip-tome data, we studied the expression of brlA by RT-qPCR inthe wild-type and the gcnE mutant strain grown under thesame conditions as employed for the microarray experimentand, in addition, in cultures harvested 72 hr after inductionof conidiation (Figure 5A). In the wild-type strain, brlA ex-pression was high at both time points whereas the ΔgcnEstrain did not show any accumulation of brlA mRNA after10 hr. Interestingly, brlAmRNA can be detected in this strainat 72 hr post-induction (still �30-fold lower than in thewild-type strain), which is in agreement with microarraydata and with the DgcnE phenotype, in which some conidiaare produced upon prolongued incubation on solid media.

Figure 4 Global expression analysis of wild-type and ΔgcnE strains grow-ing under vegetative or conidiation conditions. Both strains were grownvegetatively for 18 hr, and then conidiation was induced for 10 hr. Theglobal expression of genes under the four conditions (wild-type vegeta-tive, WT-VEG; wild type-conidiation, WT-CON; ΔgcnE vegetative, GCN-VEG; ΔgcnE conidiation, GCN-CON) was compared by using microarrayhibridization. A total of 1162 differentially expressed genes were identi-fied by ANOVA. (A) A dendogram was obtained by centroid linkageclustering using euclidean distances of the 1162 differentially regulatedgenes in the 12 samples (four conditions with three biological replicateseach). The ΔgcnE strain grown under conidiation conditions was moresimilar to vegetative growth than to the conidiating wild type. (B) PCanalysis of the genes differentially regulated under at least one of thefour different conditions. The x-axis shows the first PC with a variation of49% due to the growth mode (vegetative vs. conidiation). The y-axisshows the second PC with a variation of 26% due to the genetic back-ground (wild type vs ΔgcnE). The results obtained by clustering (A) and PC(B) analysis are in agreement.

1182 D. Cánovas et al.

To find out whether the effect of gcnE deletion on brlA isdirect or indirect, we determined the acetylation pattern ofhistone H3K9 and H3K14 at the brlA promoter by ChIP.Because the promoter of brlA covers .2 kb from the ATGof brlAa (Garzia et al. 2010; Kwon et al. 2010), weemployed two different primer pairs. Primers brlAp1 werelocated at a distal position from the ATG of brlAa (–2303 to22483 bp), spanning the FlbB-binding site, while primersbrlAp3 were located at a proximal position to the ATG (260to 2245 bps). The acetylation levels of H3K9 and H3K14increased after induction of conidiation in both regions ofthe promoter in the wild-type strain (Figure 5B). The levelsof acetylation were higher at 10 than at 72 hr after inductionof conidiation. The overall acetylation pattern was similar inboth regions of the promoter although the levels werehigher in the proximal region to the ATG than in the distalregion. This can be explained by the fact that highly acety-lated nucleosomes +1 in the open reading frames are notevicted during transcriptional activation (in contrast topromoter nucleosomes) (Workman 2006), and the DNA

fragments encompassing nucleosome +1 are captured bythe proximal PCR primers. On the contrary, in the ΔgcnEstrain the acetylation levels at the promoter of brlA werelower than in the wild-type strain and did not increase overthe basal levels of the wild-type strain growing vegetatively.This was consistent with the lack of brlA expression and,consequently, with the absence of conidiophore formationin the mutant. Analysis of the total amount of histone H3at the brlA promoter by ChIP revealed that the total amountof histone H3 decreased in the wild type after induction ofconidiation and reached a minimum at 72 hr (Figure S7). Incontrast to the wild-type strain, the total levels of histone H3did not decrease, but even increased in the ΔgcnE strainupon induction of conidiation, consistent with an inactivepromoter (Figure S7).

Inhibitors of histone deacetylation do not recoverconidiation in DgcnE

Surprisingly, although the histone H3K9 and H3K14 acety-lation levels were below the wild-type basal levels in theΔgcnE strain, there was a slight increase in acetylation afterthe induction of conidiation. We reasoned that alternativehistone H3 acetyltransferases may be operating at thesegenes under induction conditions as �40 putative acetyltrans-ferases are present in the genome of A. nidulans (Nützmannet al. 2011). To test this possibility, we employed HDACinhibitors to block deacetylation. This presumably wouldlead to increased acetylation levels of histone H3 and mayrecover conidiation in the ΔgcnE mutant. Trichostatin A wasalready shown to be an effective HDAC inhibitor in A. nidu-lans in previous studies (Shwab et al. 2007). Addition oftrichostatin A or a cocktail of inhibitors (trichostatin A +butyric acid + valproate) did not result in restoration of con-idiation, not even partially (Figure S8). Therefore, the mostplausible explanation is that the histone H3 acetylation levelsin the ΔgcnE strain corresponded to background levelsand that a functional SAGA complex is necessary for brlAexpression.

Expression of the upstream regulatory genescontrolling conidiation in the ΔgcnE strainis deregulated

There are three parallel routes for the activation of coni-diation, consisting of FlbA, FlbB/D, and FlbC (Adams et al.1998; Etxebeste et al. 2010). The transcriptome studiesrevealed a slight upregulation of flbC, one of the upstreamfactors for conidiation genes, and that this pattern was af-fected by the gcnE deletion (Table 1). To get further detailsand to confirm transcriptome data, we tested the expressionof flbC and four of the other upstream regulators in the wild-type and gcnE mutant strain grown under the conditionsdescribed above in Figure 5. As shown in Figure 6, noneof these genes were upregulated in the wild-type strain after10 hr of induction (the conditions used for the microarrayexperiment). However, after a longer period of induction(72 hr), four of these genes (flbA, flbB, flbC, and flbD) showed

Figure 5 brlA is not expressed and acetylation of histone H3K9/K14 atthe brlA promoter is reduced in the ΔgcnE strain. (A) Both wild-type andΔgcnE strains were grown vegetatively for 18 hr, and then conidiationwas induced for 10 or 72 hr. RNA was isolated and gene expression wasquantified by RT-qPCR. Data are shown normalized to the tubulin gene(benA) as an internal standard. (B) ChIP was carried out by immunopre-cipitation of cross-linked DNA with an antibody recognizing acetylatedhistone H3K9ac and H3K14ac, followed by qPCR analysis of the promoterregions. brlA showed an increase in the immunoprecipitated DNA in bothdistal (brlAp1) and proximal (brlAp3) regions of the promoter in the wildtype. In the ΔgcnE strain, acetylation levels were grossly reduced andconidiation-specific increases were not observed. Values were normalizedto input DNA (before immunoprecipitation) and are shown as the meanwith standard errors of the mean of at least three biologically indepen-dent experiments.

GcnE is Essential for Fungal Conidiation 1183

higher steady-state mRNA levels compared to vegetative my-celia or after 10 hr of induction in the wild-type strain. WhenmRNA levels of these five genes were compared betweenboth strains in vegetative mycelia, flbA showed a threefoldhigher expression in the ΔgcnE strain than in the wild type,whereas the other genes were basically identical. There wasno significant difference between wild type and ΔgcnE inexpression of the upstream regulators at time point 10 hr ofinduction with the exception of flbC, but interestingly, at72 hr, flbA expression is reduced whereas flbB expression isaround twofold higher in the gcnE mutant compared to thewild-type strain. In the case of fluG, there was a big variationfrom sample to sample at the 72-hr time point, so no conclu-sion could be drawn from these results. These slight differ-ences in mRNA levels suggest that the lack of conidiation inΔgcnE probably did not originate from defects in fluffy gene

expression. This is also consistent with the fact that expres-sion of the fluffy genes was already detected in vegetativemycelia and that their transcriptional upregulation is notthe critical regulatory point for their function in the transcrip-tional activation of brlA.

Consistent with the moderate transcriptional activationof flbA, flbB, flbC, and flbD genes, their promoters showedhigher levels of H3 acetylation during induction of conidia-tion (data not shown). This increase was associated witha decrease in the amount of total histone H3 present at thesepromoters probably due to partial eviction of nucleosomesfrom these regions. This difference was not observed in themutant strain that showed very low H3 occupancy at allfluffy gene promoters before and after conidial induction(data not shown).

Are there additional targets mediating the GcnE effectson development?

During the analysis of the microarray data, we observed thatthe orcinol/orsellinic acid cluster was not expressed in theΔgcnE strain. This is in agreement with a previous report byNützmann et al. (2011). Diorcinol is a derivative of orsellinicacid and functions together with dehydroaustinol, one of thesignals required for the induction of conidiation (Rodriguez-Urra et al. 2012). One possibility is that the absence of theexpression of this cluster contributes to the conidiationdefects. However, addition of different concentrations oforcinol ranging from 50 mg to 50 mg did not recover theconidiation defects of the ΔgcnE strain (Figure 7A). Further-more, the deletion of the polyketide synthase orsA, respon-sible for the biosynthesis of orsellinic acid (Schroeckh et al.2009), a precurssor of diorcinol, did not show any conidia-tion defects (data not shown).

Therefore, this result further implied that the conidiationdefects of the ΔgcnE strain could be directly related to SAGAfunction at the brlA promoter. We tested this by expressingthe brlA gene under the control of the heterologous induc-ible promoter of the alcA gene at an ectopic location (Adamset al. 1988). ΔgcnE alcA(p)::brlA strains were constructed bycrossing. The parentals and two strains from the progenywere grown in liquid medium for 24 hr and then transferredto inducing (threonine) or repressing (glucose) liquid me-dium and grown for another 24 hr. Inspection of the fungalpellets by light microscopy (Figure 7B) revealed that thewild-type strain harboring the alcA(p)::brlA construct pro-duced primitive conidiophores and conidia under inducingconditions as previously reported (Adams et al. 1988). How-ever, none of the ΔgcnE alcA(p)::brlA strains produced any ofthese primitive conidiophores or conidia. The experimentwas repeated twice with two independent strains from theprogeny. Next, we transferred the strains grown for 24 hr inglucose liquid media (repressing conditions) to solid mediacontaining threonine (inducing) or glucose (repressing)conditions. The ΔgcnE alcA(p)::brlA could not conidiate evenunder these conditions (Figure 7C). However, it is interest-ing that growth restriction upon induction of alcA(p)::brlA

Figure 6 Expression of the fluffy genes during conidiation is deregulatedin the ΔgcnE strain. Both wild-type and ΔgcnE strains were grown vege-tatively for 18 hr, and then conidiation was induced for 10 or 72 hr. RNAwas isolated and gene expression was quantified by RT-qPCR. Data areshown normalized to the tubulin gene (benA) as an internal standard.Values are the mean and standard error of the mean of at least threeindependent experiments.

1184 D. Cánovas et al.

on threonine was observed in both the wild-type and theΔgcnE strains overexpressing brlA (Figure 7D). This effectwas already observed by Adams et al. (1988) and may besuggestive of a BrlA role in halting vegetative growth, per-haps through crosstalk with the FlbA/G-protein-signalingpathway regulating vegetative growth.

Discussion

The data obtained during this work revealed that GcnE isthe only nonessential histone modifier found so far with anessential function in fungal development. In previous work,

we and others have established that histone acetylationplays only a minor role in the regulation of some selectedprimary metabolic systems (Reyes-Dominguez et al. 2008;Georgakopoulos et al. 2012) but significantly regulates sec-ondary metabolism (Shwab et al. 2007; Nützmann et al.2011, 2013; Bok et al. 2013). Data presented here enlargeour picture of GcnE function to a genome-wide scale, andfrom these experiments it is becoming clear that GcnE isa minor regulator of primary metabolism but an essentialcomponent in driving A. nidulans developmental processes.In the diverse set of reversible histone modifications, acety-lation and methylation have been the most extensively

Figure 7 GcnE has additionalas-yet-unidentified targets medi-ating the developmental effects.(A) Wild-type and ΔgcnE strainswere pregrown for 24 hr beforeaddition of different concentra-tions of orcinol (50 mg to 50mg) on top of the colony. Plateswere incubated for 3 additionaldays and photographed. Thehighest concentration of orcinolhad some slightly negative effectson colony development in bothstrains. (B) Strains indicated atthe left were pregrown for 24 hrin liquid media under repressingconditions (glucose) and thentransferred to fresh liquid me-dium containing inducing threo-nine or repressing glucose, andincubation was continued for anadditional 24 hr. Fungal pelletswere photographed under thelight microscope. The parentalstrains harbored either a constructoverexpressing brlA from the alcApromoter (OE::brlA) or the gcnEdeletion (ΔgcnE). Two indepen-dent strains of the cross progeny(DKA234, DKA235) were used inthis experiment. Black arrows in-dicate conidiophore-like structures,black arrowheads point to individ-ual conidia produced in liquid cul-tures, and white dotted arrowspoint to vegetative hyphal tips.(C) Strains were pregrown as in Bfor 24 hr under repressing condin-tions but then transferred to solidmedium containing threonine orglucose, and incubation was con-tinued for 1 day. Fungal colonieswere photographed under a stereomicroscope at the same magnifica-tion. The OEbrlA strain (brlA+; alcA(p)::brlA) conidiated on glucoseplates due to brlA expression from

its native promoter. Two independent strains of the progeny were also used in this experiment. (D) Strains pregrown for 24 hr under repressing condintions(as in B) were transferred to solid medium containing threonine or glucose, and incubation was continued. Plates were photographed after 3 days of growth.Growth inhibition could be observed in the strains overexpressing brlA in both the wild-type and ΔgcnE background only under brlA-inducing conditions(threonine).

GcnE is Essential for Fungal Conidiation 1185

studied ones in filamentous fungi (Gacek and Strauss 2012).It has been shown that the histone H3K9 methyltransferaseClrD and the heterochromatin-protein 1 (HepA) are regula-tors of secondary metabolite gene clusters (Reyes-Dominguezet al. 2010; Gacek and Strauss 2012). Deletion of the his-tone H3K9 methyltransferase clrD or the histone H3K4methyltransferase cclA in A. nidulans has no growth orconidiation phenotype (Bok et al. 2009; Reyes-Dominguezet al. 2010). However, a decrease in radial growth anddelayed conidiation due to later brlA expression is observedin the equivalent A. fumigatus clrD deletion mutant (Palmeret al. 2008). The histone deacetylase RpdA is essential forgrowth in A. nidulans, and, consequently, a direct and un-equivocal effect on development has not been tested yet(Tribus et al. 2010). The histone H4K12 acetyltransferaseEsaA is also essential for growth and cooperates with thegeneral secondary metabolite regulator LaeA to mediate his-tone H4 acetylation and transcriptional activation of selectedsecondary metabolite clusters (Soukup et al. 2012), but dueto its essential nature the involvement in conidiation remainselusive. Similarly, deletion of the histone deacetylase hdaAwas reported to have effects on secondary metabolism butnot on development (Shwab et al. 2007; Bok et al. 2009).Therefore, other histone modifiers either have shown a minorrole during development or are essential for growth, whileGcnE is required for conidiation but not essential for growth.The SAGA complex is also involved in the regulation of de-velopment in higher eukaryotes, such as plants (Servet et al.2010), and metazoans (Spedale et al. 2012). In Arabidopsis,AtGCN5 plays an essential role in the development of rootand shoot and flower meristems, leaf-cell differentiation, andresponses to light. AtGCN5 also appears to regulate the ex-pression of a large number of genes, likely mediated by director indirect interactions with DNA-binding transcription fac-tors (Servet et al. 2010). In metazoans, it was suggested thatGcn5 may be required to maintain pluripotent states and isimportant for the differentiation of rat mesenchymal stemcells into cardiomyocytes. Indeed, loss of Gcn5 resulted ina hard-pack chromatin structure at the cardiomyocyte-specificgenes GATA4 and NKx2.5 and elevated levels of apoptosisduring embrionic development (Lin et al. 2007; Li et al.2010). It is intriguing that, while metazoans have evolvedfour HAT complexes acetylating histone H3 specialized indifferent cellular processes (Spedale et al. 2012), A. nidulanshas only one.

The SAGA complex plays a general role in transcriptionalactivation in yeasts. TAFII145 and Gcn5 are apparently func-tionally redudant in yeast (Lee et al. 2000), although thereis some specialization of the SAGA complex in stress-relatedgenes (Huisinga and Pugh 2004). Although the SAGA com-plex is very similar in A. nidulans to the yeast counterpart,the role of GcnE seems to be significantly different from therole of its orthologs in yeasts. Thus, according to genome-wide expression analysis and the observation of mutant phe-notypes, it appears that the main role of GcnE is to regulatedevelopment and some specific secondary metabolism gene

clusters in A. nidulans. Some of the secondary metabolitescan be considered as “weapons” utilized only under stressingconditions in nature as a defense mechanism. For example,it was found that GcnE played a major role during the in-duction of biosynthetic gene clusters of sterigmatocystin,terrequinone, and penicillin (Nützmann et al. 2011). An in-teresting case is polyketide orsellinic acid, which is producedby A. nidulans in response to the interaction with a strepto-mycete species in a GcnE-dependent manner (Nützmannet al. 2011). Synthesis of orsellinic acid derivativesF9775A and -B, which is induced in a ΔveA strain, is lostin the double-mutant ΔgcnE ΔveA (Bok et al. 2013). Thus,the reported role of GcnE in the regulation of secondarymetabolism is consistent with our microarray expressionanalysis. Orsellinic acid is also the precursor of diorcinol, whichmakes an adduct with the bioactive compound dehydroausti-nol, produced by FluG, to induce conidiation (Rodriguez-Urraet al. 2012). Although the absence of GcnE activity could leadto a lack of this conidiation inducer adduct, addition ofexternal orcinol did not restore conidiation. In support ofthis, the deletion of the polyketide synthase orsA responsiblefor the biosynthesis of orsellinic acid (Schroeckh et al. 2009)did not show any conidiation defects either. Therefore, a sce-nario in which brlA expression is not turned on in the gcnEmutant after induction due to the lack of the inducer adductseems unlikely. Instead, GcnE appears to be responsible forhistone H3K9/K14 acetylation at the brlA promoter, whichin turn is a prerequisite for brlA expression. Consequently,deletion of gcnE blunts brlA expression under inducing con-ditions. However, this is only a part of the whole picturebecause forced expression of brlA from the inducible alcApromoter could not restore conidiation in a ΔgcnE back-ground. As expression of upstream regulators of the fluffyfamily of genes (flbA, flbB, flbC, flbD, and fluG) was also notsignificantly affected by gcnE deletion and the phenotypedoes not conform to the mutants of the central regulatorypathway abaA-wetA either, we have to assume that otherregulators of conidiation may be “hidden” targets of thisSAGA complex component. One such target may be thevelvet complex members veA, velB, or velC (Bayram et al.2008b) or the light receptors fphA, lreA/B, or cryA (Bayramet al. 2008a; Purschwitz et al. 2008). However, we did notobserve any significant change in expression of these regu-lators and photoreceptors comparing the wild type and thegcnE mutant, and these genes are not even responsive toinduction of conidiation in the wild type. Thus it is unlikelythat some of these known genes involved in developmentalregulation are targets of the SAGA complex. At the momentit remains elusive which of the differentially regulated genes(apart form brlA) may be responsible for the strong conidia-tion-deficient phenotype of the gcnE deletion strain. Inaddition, the SAGA complex participates in more cellularfunctions as it is necessary not only for the activation of geneexpression but also for transcriptional elongation, splicing,nuclear mRNA export, and as a general platform for therecruitment of regulatory factors (Millar and Grunstein

1186 D. Cánovas et al.

2006; Baker and Grant 2007; Gunderson and Johnson 2009;Gunderson et al. 2011). Therefore, the conidiation defects inthe ΔgcnE strain could be mediated through a combinationof several targets and diverse molecular activities, whichdeserve further investigation.

In this study, we compared vegetative cells grown inliquid cultures immediately before and after 10 hr of shift toconidiation conditions and found 1225 genes differentiallyregulated, of which 625 were upregulated. Garzia et al.(2013) analyzed the conidiation-specific transcriptome after5 hr of induction and found 2222 genes differentially regu-lated (corresponding to 20.3% of the genes present in thegenome), of which only 187 were upregulated. These num-bers are much higher than the 533 genes found to be dif-ferentially regulated in response to light in A. nidulans(Ruger-Herreros et al. 2011). It suggests that induction ofasexual development actually results in a major cellularreprogramming over time. For example, master regulatorsof carbon (creA) and nitrogen (areA) metabolism did notappear to be differentially regulated at 10 hr after the in-duction of conidiation in our analysis, but they were down-regulated after 5 hr. The comparison of both transcriptomicexperiments at different time points suggests that in a firststage there is a major downregulation of genes expressed inthe vegetative phase to produce a growth arrest. In a nextstage, many genes are upregulated to accommodate allmorphogenetic requirements for asexual reproduction. Tenhours after the transition from vegetative growth to conidia-tion, the number of upregulated genes approximates to theprediction of 1200 unique mRNAs postulated by Timberlake(1980). However, Martinelli and Clutterbuck (1971) esti-mated that only between 45 and 150 genes are specificallyrequired for conidiation. This difference could be explainedwith genes that are not specifically required for conidiation,but rather play additional roles or simply indirectly respondto the changing environmental conditions (exposure to ox-ygen, light, solid interphase, different nutrient signaling,etc.). For example, the osmotic stress MAPK hogA is stillupregulated after 10 hr (as it is after 5 hr) of induction ofconidiation, but some of its targets or downstream regula-tors are not (atfA, srrA, tcsA). None of the chromatin regu-lators known in A. nidulans appear to be regulated at thetranscriptional level upon induction of conidiation (gcnE,adaB, clrD, hepA, cclA, rpdA, dmtA, and laeA), and they donot require GcnE for their constitutive expression (they arenot affected by the ΔgcnE deletion). Notably, one of the mostheavily affected GO categories found in the list of genesupregulated in the ΔgcnE mutant during conidiation wasrelated to responses to stress and, in particular, to DNAdamage (nkuA, nkuB, uvsC, and other putative genes). Itcan be argued that GcnE is required for genome stabilitymaintenance and/or DNA repair during conidiation, and,consequently, the absence of GcnE may generate DNA dam-age stress. The function of the spores is not only dispersionin the environment but also protection of the genome (Parkand Yu 2012). Indeed, isolation of yeast mutants affected in

components of the SAGA/ADA complex showed a phenotypeof increased Rad52 foci and sister-chromatid recombination(Munoz-Galvan et al. 2013). Whether GcnE and the SAGAcomplex play similar roles in filamentous fungi is not knownyet, but the importance of GcnE in conidiospore productionmay justify speculations of a similar role in these organisms.

In conclusion, GcnE plays an essential role in asexualdevelopment and is required for the expression of the masterregulator of conidiation brlA and some yet-unidentified con-idiation-specific genes. It is, to the best of our knowledge, sofar the only nonessential histone modifier with such a role.One of the questions to be followed up is to identify the otherGcnE-dependent mechanisms required for initiation of devel-opment and to elucidate the factors that recruit the SAGAcomplex to the promoter of brlA.

Acknowledgments

We thank Jae-Hyuk Yu, Nancy Keller, Axel Brakhage, and theFungal Genetics Stock Center for sharing strains and Juan LuisRibas and Cristina Vaquero (Servicio de Microscopía, Centro deInvestigación Tecnología e Innovación, Universidad de Sevilla)for help with SEM. D.C. thanks the University of Sevilla forsupporting his stay at BOKU–University of Natural Resourcesand Life Sciences, Vienna. Work was funded by grant SFB-F37-3 from the Austrian Science Fund (Fonds zur Förderung derwissenschaftlichen Forschung) and grant LS12-009 (EpiMed)of the NÖ-Forschung und Bildung Fund (to J.S.).

Literature Cited

Adams, T. H., M. T. Boylan, and W. E. Timberlake, 1988 brlA isnecessary and sufficient to direct conidiophore development inAspergillus nidulans. Cell 54: 353–362.

Adams, T. H., J. K. Wieser, and J. H. Yu, 1998 Asexual sporulationin Aspergillus nidulans. Microbiol. Mol. Biol. Rev. 62: 35–54.

Arnaud, M. B., M. C. Chibucos, M. C. Costanzo, J. Crabtree, D. O.Inglis et al., 2010 The Aspergillus Genome Database, a curatedcomparative genomics resource for gene, protein and sequenceinformation for the Aspergillus research community. NucleicAcids Res. 38: D420–D427.

Baker, S. P., and P. A. Grant, 2007 The SAGA continues: expand-ing the cellular role of a transcriptional co-activator complex.Oncogene 26: 5329–5340.

Bayram, O., C. Biesemann, S. Krappmann, P. Galland, and G. H.Braus, 2008a More than a repair enzyme: Aspergillus nidulansphotolyase-like CryA is a regulator of sexual development. Mol.Biol. Cell 19: 3254–3262.

Bayram, O., S. Krappmann, M. Ni, J. W. Bok, K. Helmstaedt et al.,2008b VelB/VeA/LaeA complex coordinates light signal withfungal development and secondary metabolism. Science 320:1504–1506.

Benjamini, Y., and Y. Hochberg, 1995 Controlling the false dis-covery rate: a practical and powerful approach to multiple test-ing. J. R. Stat. Soc. B 57: 289–300.

Bok, J. W., Y. M. Chiang, E. Szewczyk, Y. Reyes-Dominguez, A. D.Davidson et al., 2009 Chromatin-level regulation of biosyn-thetic gene clusters. Nat. Chem. Biol. 5: 462–464.

Bok, J. W., A. A. Soukup, E. Chadwick, Y. M. Chiang, C. C. Wanget al., 2013 VeA and MvlA repression of the cryptic orsellinic

GcnE is Essential for Fungal Conidiation 1187

acid gene cluster in Aspergillus nidulans involves histone 3 acet-ylation. Mol. Microbiol. 89: 963–974.

Canovas, D., K. J. Boyce, and A. Andrianopoulos, 2011 The fungaltype II myosin in Penicillium marneffei, MyoB, is essential forchitin deposition at nascent septation sites but not actin locali-zation. Eukaryot. Cell 10: 302–312.

Cove, D. J., 1966 The induction and repression of nitrate reduc-tase in the fungus Aspergillus nidulans. Biochim. Biophys. Acta113: 51–56.

da Silva Ferreira, M. E., M. R. Kress, M. Savoldi, M. H. Goldman, A.Hartl et al., 2006 The akuB(KU80) mutant deficient for non-homologous end joining is a powerful tool for analyzing patho-genicity in Aspergillus fumigatus. Eukaryot. Cell 5: 207–211.

de Hoon, M. J., S. Imoto, J. Nolan, and S. Miyano, 2004 Opensource clustering software. Bioinformatics 20: 1453–1454.

Etxebeste, O., A. Garzia, E. A. Espeso, and U. Ugalde,2010 Aspergillus nidulans asexual development: making themost of cellular modules. Trends Microbiol. 18: 569–576.

Freitag, M., R. L. Williams, G. O. Kothe, and E. U. Selker, 2002 Acytosine methyltransferase homologue is essential for repeat-induced point mutation in Neurospora crassa. Proc. Natl. Acad.Sci. USA 99: 8802–8807.

Freitag, M., P. C. Hickey, T. K. Khlafallah, N. D. Read, and E. U.Selker, 2004 HP1 is essential for DNA methylation in Neuros-pora. Mol. Cell 13: 427–434.

Gacek, A., and J. Strauss, 2012 The chromatin code of fungalsecondary metabolite gene clusters. Appl. Microbiol. Biotechnol.95: 1389–1404.

Garzia, A., O. Etxebeste, E. Herrero-Garcia, R. Fischer, E. A. Espesoet al., 2009 Aspergillus nidulans FlbE is an upstream develop-mental activator of conidiation functionally associated with theputative transcription factor FlbB. Mol. Microbiol. 71: 172–184.

Garzia, A., O. Etxebeste, E. Herrero-Garcia, U. Ugalde, and E. A.Espeso, 2010 The concerted action of bZip and cMyb tran-scription factors FlbB and FlbD induces brlA expression andasexual development in Aspergillus nidulans. Mol. Microbiol.75: 1314–1324.

Garzia, A., O. Etxebeste, J. Rodriguez-Romero, R. Fischer, E. A.Espeso et al., 2013 Transcriptional changes in the transitionfrom vegetative cells to asexual development in the model fun-gus Aspergillus nidulans. Eukaryot. Cell 12: 311–321.

Georgakopoulos, P., R. A. Lockington, and J. M. Kelly, 2012 SAGAcomplex components and acetate repression in Aspergillus nidu-lans. G3 2: 1357–1367.

Georgakopoulos, P., R. A. Lockington, and J. M. Kelly, 2013 TheSpt-Ada-Gcn5 Acetyltransferase (SAGA) complex in Aspergillusnidulans. PLoS ONE 8: e65221.

Grant, P. A., L. Duggan, J. Cote, S. M. Roberts, J. E. Brownell et al.,1997 Yeast Gcn5 functions in two multisubunit complexes toacetylate nucleosomal histones: characterization of an Ada complexand the SAGA (Spt/Ada) complex. Genes Dev. 11: 1640–1650.

Grewal, S. I., and S. Jia, 2007 Heterochromatin revisited. Nat.Rev. Genet. 8: 35–46.

Grimaldi, B., P. Coiro, P. Filetici, E. Berge, J. R. Dobosy et al.,2006 The Neurospora crassa White Collar-1 dependent bluelight response requires acetylation of histone H3 lysine 14 byNGF-1. Mol. Biol. Cell 17: 4576–4583.

Gunderson, F. Q., and T. L. Johnson, 2009 Acetylation by thetranscriptional coactivator Gcn5 plays a novel role in co-transcriptional spliceosome assembly. PLoS Genet. 5: e1000682.

Gunderson, F. Q., E. C. Merkhofer, and T. L. Johnson, 2011 Dynamichistone acetylation is critical for cotranscriptional spliceosome as-sembly and spliceosomal rearrangements. Proc. Natl. Acad. Sci.USA 108: 2004–2009.

Hammer, Ø., D. Harper, and P. D. Ryan, 2001 PAST: Paleontolog-ical Statistics Software Package for Education and Data Analy-sis. Palaeontologia Electronica 4: 1–9.

Honda, S., Z. A. Lewis, M. Huarte, L. Y. Cho, L. L. David et al.,2010 The DMM complex prevents spreading of DNA methyl-ation from transposons to nearby genes in Neurospora crassa.Genes Dev. 24: 443–454.

Huisinga, K. L., and B. F. Pugh, 2004 A genome-wide housekeep-ing role for TFIID and a highly regulated stress-related role forSAGA in Saccharomyces cerevisiae. Mol. Cell 13: 573–585.

Krappmann, S., C. Sasse, and G. H. Braus, 2006 Gene targeting inAspergillus fumigatus by homologous recombination is facili-tated in a nonhomologous end- joining-deficient genetic back-ground. Eukaryot. Cell 5: 212–215.

Krijgsheld, P., R. Bleichrodt, G. J. van Veluw, F. Wang, W. H.Muller et al., 2013 Development in Aspergillus. Stud. Mycol.74: 1–29.

Kuo, M. H., J. E. Brownell, R. E. Sobel, T. A. Ranalli, R. G. Cooket al., 1996 Transcription-linked acetylation by Gcn5p of his-tones H3 and H4 at specific lysines. Nature 383: 269–272.

Kurshakova, M. M., A. N. Krasnov, D. V. Kopytova, Y. V. Shidlovskii,J. V. Nikolenko et al., 2007 SAGA and a novel Drosophila ex-port complex anchor efficient transcription and mRNA export toNPC. EMBO J. 26: 4956–4965.

Kwon, N. J., A. Garzia, E. A. Espeso, U. Ugalde, and J. H. Yu,2010 FlbC is a putative nuclear C(2)H(2) transcription factorregulating development in Aspergillus nidulans. Mol. Microbiol.77: 1203–1219.

Lee, B. N., and T. H. Adams, 1994 The Aspergillus nidulans fluGgene is required for production of an extracellular developmen-tal signal and is related to prokaryotic glutamine synthetase I.Genes Dev. 8: 641–651.

Lee, I., J. H. Oh, E. K. Shwab, T. R. Dagenais, D. Andes et al.,2009 HdaA, a class 2 histone deacetylase of Aspergillus fumi-gatus, affects germination and secondary metabolite produc-tion. Fungal Genet. Biol. 46: 782–790.

Lee, T. I., H. C. Causton, F. C. Holstege, W. C. Shen, N. Hannettet al., 2000 Redundant roles for the TFIID and SAGA com-plexes in global transcription. Nature 405: 701–704.

Li, L., J. Zhu, J. Tian, X. Liu, and C. Feng, 2010 A role for Gcn5 incardiomyocyte differentiation of rat mesenchymal stem cells.Mol. Cell. Biochem. 345: 309–316.

Lin, W., G. Srajer, Y. A. Evrard, H. M. Phan, Y. Furuta et al.,2007 Developmental potential of Gcn5(2/2) embryonic stemcells in vivo and in vitro. Dev. Dyn. 236: 1547–1557.

Martinelli, S. D., and A. J. Clutterbuck, 1971 A quantitative sur-vey of conidiation mutants in Aspergillus nidulans. J. Gen. Micro-biol. 69: 261–268.

Medina, I., J. Carbonell, L. Pulido, S. C. Madeira, S. Goetz et al.,2010 Babelomics: an integrative platform for the analysis oftranscriptomics, proteomics and genomic data with advancedfunctional profiling. Nucleic Acids Res. 38: W210–W213.

Millar, C. B., and M. Grunstein, 2006 Genome-wide patterns ofhistone modifications in yeast. Nat. Rev. Mol. Cell Biol. 7: 657–666.

Mirabito, P. M., T. H. Adams, and W. E. Timberlake,1989 Interactions of three sequentially expressed genes con-trol temporal and spatial specificity in Aspergillus development.Cell 57: 859–868.

Munoz-Galvan, S., S. Jimeno, R. Rothstein, and A. Aguilera,2013 Histone H3K56 acetylation, Rad52, and non-DNA repairfactors control double-strand break repair choice with the sisterchromatid. PLoS Genet. 9: e1003237.

Nayak, T., E. Szewczyk, C. E. Oakley, A. Osmani, L. Ukil et al.,2006 A versatile and efficient gene targeting system for Asper-gillus nidulans. Genetics 172: 1557–1566.

Ninomiya, Y., K. Suzuki, C. Ishii, and H. Inoue, 2004 Highly effi-cient gene replacements in Neurospora strains deficient for non-homologous end-joining. Proc. Natl. Acad. Sci. USA 101:12248–12253.

1188 D. Cánovas et al.

Nützmann, H. W., Y. Reyes-Dominguez, K. Scherlach, V. Schroeckh,F. Horn et al., 2011 Bacteria-induced natural product forma-tion in the fungus Aspergillus nidulans requires Saga/Ada-medi-ated histone acetylation. Proc. Natl. Acad. Sci. USA 108:14282–14287.

Nützmann, H. W., J. Fischer, K. Scherlach, C. Hertweck, and A. A.Brakhage, 2013 Distinct amino acids of histone H3 controlsecondary metabolism in Aspergillus nidulans. Appl. Environ.Microbiol. 79: 6102–6109.

Palmer, J. M., R. M. Perrin, T. R. Dagenais, and N. P. Keller,2008 H3K9 methylation regulates growth and developmentin Aspergillus fumigatus. Eukaryot. Cell 7: 2052–2060.

Park, H. S., and J. H. Yu, 2012 Genetic control of asexual spor-ulation in filamentous fungi. Curr. Opin. Microbiol. 15: 669–677.

Pontecorvo, G., J. A. Roper, L. M. Hemmons, K. D. Macdonald, andA. W. Bufton, 1953 The genetics of Aspergillus nidulans. Adv.Genet. 5: 141–238.

Purschwitz, J., S. Muller, C. Kastner, M. Schoser, H. Haas et al.,2008 Functional and physical interaction of blue- and red-lightsensors in Aspergillus nidulans. Curr. Biol. 18: 255–259.

Reyes-Dominguez, Y., F. Narendja, H. Berger, A. Gallmetzer, R.Fernandez-Martin et al., 2008 Nucleosome positioning andhistone H3 acetylation are independent processes in the Asper-gillus nidulans prnD-prnB bidirectional promoter. Eukaryot. Cell7: 656–663.

Reyes-Dominguez, Y., J. W. Bok, H. Berger, E. K. Shwab, A. Basheeret al., 2010 Heterochromatic marks are associated with therepression of secondary metabolism clusters in Aspergillus nidu-lans. Mol. Microbiol. 76: 1376–1386.

Reyes-Dominguez, Y., S. Boedi, M. Sulyok, G. Wiesenberger, N.Stoppacher et al., 2012 Heterochromatin influences the sec-ondary metabolite profile in the plant pathogen Fusarium gra-minearum. Fungal Genet. Biol. 49: 39–47.

Rodriguez-Navarro, S., T. Fischer, M. J. Luo, O. Antunez, S. Brettsch-neider et al., 2004 Sus1, a functional component of the SAGAhistone acetylase complex and the nuclear pore-associated mRNAexport machinery. Cell 116: 75–86.

Rodriguez-Urra, A. B., C. Jimenez, M. I. Nieto, J. Rodriguez, H.Hayashi et al., 2012 Signaling the induction of sporulationinvolves the interaction of two secondary metabolites in Asper-gillus nidulans. ACS Chem. Biol. 7: 599–606.

Rountree, M. R., and E. U. Selker, 2010 DNA methylation and theformation of heterochromatin in Neurospora crassa. Heredity(Edinb) 105: 38–44.

Ruger-Herreros, C., J. Rodriguez-Romero, R. Fernandez-Barranco,M. Olmedo, R. Fischer et al., 2011 Regulation of conidiationby light in Aspergillus nidulans. Genetics 188: 809–822.

Schinko, T., H. Berger, W. Lee, A. Gallmetzer, K. Pirker et al.,2010 Transcriptome analysis of nitrate assimilation in Aspergillus

nidulans reveals connections to nitric oxide metabolism. Mol. Mi-crobiol. 78: 720–738.

Schroeckh, V., K. Scherlach, H. W. Nutzmann, E. Shelest, W.Schmidt-Heck et al., 2009 Intimate bacterial-fungal interac-tion triggers biosynthesis of archetypal polyketides in Aspergillusnidulans. Proc. Natl. Acad. Sci. USA 106: 14558–14563.

Servet, C., N. Conde e Silva, and D. X. Zhou, 2010 Histone ace-tyltransferase AtGCN5/HAG1 is a versatile regulator of devel-opmental and inducible gene expression in Arabidopsis. Mol.Plant 3: 670–677.

Shwab, E. K., J. W. Bok, M. Tribus, J. Galehr, S. Graessle et al.,2007 Histone deacetylase activity regulates chemical diversityin Aspergillus. Eukaryot. Cell 6: 1656–1664.

Smyth, G. K., 2005 Limma: linear models for microarray data, pp.397–420 in Computational Biology Solutions Using R and Biocon-ductor, edited by V. C. R. Gentleman, S. Dudoit, R. Irizarry, andW. Huber. Springer, New York.

Soukup, A. A., Y. M. Chiang, J. W. Bok, Y. Reyes-Dominguez, B. R.Oakley et al., 2012 Overexpression of the Aspergillus nidulanshistone 4 acetyltransferase EsaA increases activation of second-ary metabolite production. Mol. Microbiol. 86: 314–330.

Spedale, G., H. T. Timmers, and W. W. Pijnappel, 2012 ATAC-king the complexity of SAGA during evolution. Genes Dev. 26:527–541.

Strauss, J., and Y. Reyes-Dominguez, 2011 Regulation of second-ary metabolism by chromatin structure and epigenetic codes.Fungal Genet. Biol. 48: 62–69.

Tamaru, H., and E. U. Selker, 2001 A histone H3 methyltransfer-ase controls DNA methylation in Neurospora crassa. Nature 414:277–283.

Timberlake, W. E., 1980 Developmental gene regulation in Asper-gillus nidulans. Dev. Biol. 78: 497–510.

Tribus, M., I. Bauer, J. Galehr, G. Rieser, P. Trojer et al., 2010 Anovel motif in fungal class 1 histone deacetylases is essential forgrowth and development of Aspergillus. Mol. Biol. Cell 21: 345–353.

Wilson, R. A., P. K. Chang, A. Dobrzyn, J. M. Ntambi, R. Zarnowskiet al., 2004 Two Delta9-stearic acid desaturases are requiredfor Aspergillus nidulans growth and development. Fungal Genet.Biol. 41: 501–509.

Workman, J. L., 2006 Nucleosome displacement in transcription.Genes Dev. 20: 2009–2017.

Yu, J. H., J. Wieser, and T. H. Adams, 1996 The Aspergillus FlbARGS domain protein antagonizes G protein signaling to blockproliferation and allow development. EMBO J. 15: 5184–5190.

Yu, J. H., J. H. Mah, and J. A. Seo, 2006 Growth and develop-mental control in the model and pathogenic aspergilli. Eukar-yot. Cell 5: 1577–1584.

Communicating editor: A. P. Mitchell

GcnE is Essential for Fungal Conidiation 1189

GENETICSSupporting Information

http://www.genetics.org/lookup/suppl/doi:10.1534/genetics.114.165688/-/DC1

The Histone Acetyltransferase GcnE (GCN5) Playsa Central Role in the Regulation of Aspergillus

Asexual DevelopmentDavid Cánovas, Ana T. Marcos, Agnieszka Gacek, María S. Ramos, Gabriel Gutiérrez,

Yazmid Reyes-Domínguez, and Joseph Strauss

Copyright © 2014 by the Genetics Society of AmericaDOI: 10.1534/genetics.114.165688

2 SI D. Cánovas et al.

Table S1 A. nidulans strains used in this study

Strain Relevant genotype Source

biA1; veA1

biA1; yA2; veA1 (REYES-DOMINGUEZ et al.

2008)

biA1; ∆gcnE::pyrG; veA1 (REYES-DOMINGUEZ et al.

2008)

TU85 biA1 pabaA1; argB2; pyroA4 ;∆brlA::argB veA+ Nancy Keller

TNJ37.2 pyrG89 ∆abaA::AfpyrG; pyroA4; veA+ (KWON et al. 2010)

TMY1 ∆wetA::AfpyrG; pyrG89 pyroA4 veA+ Jae-Hyuk Yu

A1153gcnE-3xflag yA1; pabaA1; gcnE::gcnEp-gcnE-3x-flag-pabaA; pyroA4;

∆nkuA::bar

(NÜTZMANN et al. 2011)

FGSC A1078 yA2; pabaA1; biA1; methG1; alcA(p)::brlA; veA1 FGSC

DKA106 argB2; ∆gcnE::pyrG; veA1 This study

DKA234 ∆gcnE::pyrG; alcA(p)::brlA; veA1 This study

DKA235 ∆gcnE::pyrG; alcA(p)::brlA; veA1 This study

D. Cánovas et al. 3 SI

Table S2 Primers used in this study

Primer name Sequence

brlA-F TACCGCGACGGGTTTCAG

brlA-R GAGGTCTGTCGTCGGAGCAT

fluG-F CTCGAAGAAATCGCCGAAAC

fluG-R CTCGGCATGGAATTGTTGAA

flbA-F CTGGCTGATGGACTGTTCGA

flbA-R CAAAAAGTTCCGCGATCAGAA

flbB-F CGCTTACGGCGCATACTTACA

flbB-R TCGGGCTCATTCCTGATGA

flbC-F GAGAAGCGTCATTCGCTTGTG

flbC-R CGGAGGTTAGAGACAACGGAAA

benA-F CCAGTGTGGTAACCAGGTTGGT

benA-R GGCGTCGAGGCCATGTT

brlAp1-2483 GAGATGTGCAGCCGGGTACT

brlAp1-2303 TTCCCACTGCCTGTCATTCC

brlAp3-245 CAGTCTTTTACTGCTGTCGAGATTAGC

brlAp3-60 CAGAGCACCGTTCAGTTTACGT

flbAp-227 AGGTTTCATTTCCCTACCTATCCA

flbAp-30 AGGCTAGGGCAGACTAAGTAAAATGAG

flbBp-244 TGCGTATACCCATCATTTCCAA

flbBp-60 GCGTGAAGCGAGGAAAGG

flbCp-208 CCTCTACTCTCGACCAGCTTCCT

flbCp-26 CTGGAAGATCGTGTTGATGTTCTC

fluGp-220 CGATCGTCGCTGGTCCTACT

fluGp-40 AAAATAAACCCCCCCAGAAAAC

4 SI D. Cánovas et al.

Table S3 Top 25 genes induced during conidiation in the wild type strain

NAMES

log

qmedian Description

AN0602 4.57 Ortholog of A. niger CBS 513.88: An15g02350, A. oryzae RIB40: AO090023000525, A. niger

ATCC 1015: 48700-mRNA, A. versicolor: Aspve1_0146150 and A. sydowii: Aspsy1_0055411

AN1837 5.36 Putative hydrophobin; predicted glycosyl phosphatidylinositol (GPI)-anchor

AN1837 4.95 Putative hydrophobin; predicted glycosyl phosphatidylinositol (GPI)-anchor

AN4641 4.48 Hypothetical protein

AN5650 4.72 Ortholog(s) have Golgi apparatus, cell division site, cell tip, endoplasmic reticulum

localization

AN7804 4.87 Putative FAD-containing monooxygenase with a predicted role in sterigmatocystin/aflatoxin

biosynthesis; member of the sterigmatocystin biosynthesis gene cluster; expression

upregulated after exposure to farnesol

AN7806 4.79 Putative versicolorin reductase with a predicted role in sterigmatocystin/aflatoxin

biosynthesis; member of the sterigmatocystin biosynthesis gene cluster

AN7809 5.15 Ortholog of A. versicolor : Aspve1_0126175 and A. terreus NIH2624 : ATET_01291

AN7813 5.35 Hypothetical protein

AN7821 4.99 Putative norsolorinic acid reductase with a predicted role in sterigmatocystin/aflatoxin

biosynthesis; member of the sterigmatocystin biosynthesis gene cluster

AN7824 4.73 Putative sterigmatocystin biosynthesis P450 monooxygenase with a predicted role in

sterigmatocystin/aflatoxin biosynthesis; member of the sterigmatocystin biosynthesis gene

cluster

AN8006 5.99 Hydrophobin, protein of the conidium wall responsible for hydrophobicity of conidium

surface; recombinant DewA spontaneously assembles at air:water interfaces and forms

functional amyloids

AN8375 6.04 Hypothetical protein

AN8379 4.81 Predicted oxidoreductase; required for austinol and dehydroaustinol biosynthesis

AN8384 4.99 Protein of unknown function; required for austinol and dehydroaustinol biosynthesis; aus

secondary metabolism gene cluster member

AN8803 4.99 Hydrophobin; protein involved in conidium development; required for the formation of

outer hydrophobic layer (rodlet layer) of the conidium wall; transcriptionally regulated by

BrlA; predicted glycosylphosphatidylinositol (GPI)-anchor

AN9247 5.14 Protein required for normal levels of austinol and dehydroaustinol production

AN9253 4.59 Putative cytochrome P450; required for austinol and dehydroaustinol biosynthesis

AN7825 4.47 Putative polyketide synthase with a predicted role in sterigmatocystin/aflatoxin

biosynthesis; member of the sterigmatocystin biosynthesis gene cluster

AN8439 4.45 Protein of unknown function; transcript is induced by nitrate; predicted NirA binding site

AN0499 4.43 Has domain(s) with predicted chitin binding activity, role in chitin metabolic process and

extracellular region localization

AN9248 4.42 Putative cytochrome P450; required for austinol and dehydroaustinol biosynthesis

AN1818 4.41 Protein with endo-1,4-beta-xylanase activity, involved in degradation of xylans

AN9246 4.39 Predicted dioxygenase; required for austinol and dehydroaustinol biosynthesis

AN3722 4.38 Has domain(s) with predicted role in transmembrane transport and integral to membrane

localization

D. Cánovas et al. 5 SI

Table S4 Top 25 genes induced during vegetative growth in the wild type strain

NAMES

log

qmedian Description

AN1826 -4.98 Has domain(s) with predicted hydrolase activity

AN1825 -4.51 Putative sulfide:quinone oxidoreductase; transcript repressed by nitrogen limitation

AN9295 -4.38 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in

transmembrane transport and integral to membrane localization

AN5943 -4.30 Ortholog of A. nidulans FGSC A4 : AN8548, AN8661, AN4642, A. fumigatus Af293 :

Afu3g00850, Afu4g08850 and A. niger CBS 513.88 : An02g13470, An11g00090, An03g01430,

An12g09260

AN6754 -4.03 Predicted glycosylphosphatidylinositol (GPI)-anchored protein

AN2623 -3.77 Isopenicillin-N N-acyltransferase; null produces reduced levels of penicillin; partially

redundant with aatB

AN5945 -3.74 Ortholog of A. fumigatus Af293 : Afu6g14630, N. fischeri NRRL 181 : NFIA_060670 and A.

terreus NIH2624 : ATET_10017

AN7233 -3.72 Putative epoxide hydrolase; expression reduced after exposure to farnesol

AN1541 -3.70 Has domain(s) with predicted oxidoreductase activity, acting on the aldehyde or oxo group

of donors, NAD or NADP as acceptor activity and role in oxidation-reduction process

AN2571 -3.69 Hypothetical protein

AN5228 -3.65 Putative NADH:flavin oxidoreductase/NADH oxidase; intracellular, menadione stress-induced

protein

AN2622 -3.61 Isopenicillin-N synthase with a role in penicillin biosynthesis; expression is negatively

regulated by glucose and acidic pH

AN9001 -3.57 Hypothetical protein

AN6095 -3.57 Has domain(s) with predicted role in transmembrane transport and integral to membrane

localization

AN6075 -3.51 Has domain(s) with predicted ammonia-lyase activity, role in L-phenylalanine catabolic

process, biosynthetic process and cytoplasm localization

AN1304 -3.49 Hypothetical protein

AN9108 -3.48 Has domain(s) with predicted heme binding activity

AN3866 -3.48 Putative dehydratase with a predicted role in glycine, serine, and threonine metabolism

AN0620 -3.45 Ortholog of A. versicolor : Aspve1_0023747 and Aspergillus sydowii : Aspsy1_0086329

AN6424 -3.43 Has domain(s) with predicted oxidoreductase activity, acting on paired donors, with

incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and

incorporation of one atom each of oxygen into both donors activity

AN4845 -3.37 Hypothetical protein

AN5444 -3.30 Putative tryptophan synthase with a predicted role in aromatic amino acid biosynthesis

AN3030 -3.21 Alcohol dehydrogenase, class V; upregulated in A. oryzae and A. nidulans under hypoxic

growth conditions

AN8972 -3.18 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in

transmembrane transport and integral to membrane localization

AN6249 -3.17 Putative calcineurin binding protein, calcipressin

6 SI D. Cánovas et al.

Table S5 Top 25 genes induced during conidiation in the ∆gcnE strain.

NAMES

log

qmedian Description

AN0482 3.13 Putative ubiquitin-conjugating enzyme; transcript repressed by nitrate

AN0546 3.12 Hypothetical protein

AN1604 3.84 Putative alpha-1,3-glucanase; predicted glycosyl phosphatidylinositol (GPI)-anchor

AN1818 4.10 Protein with endo-1,4-beta-xylanase activity, involved in degradation of xylans

AN3613 3.29 Protein with endo-1,4-beta-xylanase activity, involved in degradation of xylans; transcription

is controlled by the carbon catabolite repression system

AN3860 2.94 Putative beta-1,4-endoglucanase

AN5037 3.10 Has domain(s) with predicted electron carrier activity, flavin adenine dinucleotide binding,

oxidoreductase activity, acting on CH-OH group of donors activity and role in oxidation-

reduction process

AN5267 2.94 Protein with ferulic acid esterase activity, involved in degradation of xylans

AN5290 3.09 Predicted glycosylphosphatidylinositol (GPI)-anchored protein

AN5408 4.25 Has domain(s) with predicted RNA binding, ribonuclease III activity and role in RNA

processing

AN5942 3.29 Ortholog of A. versicolor : Aspve1_0148858 and Aspergillus sydowii : Aspsy1_0029071

AN6401 3.94 Putative hydrophobin

AN6718 3.06 Has domain(s) with predicted ATP binding, nucleoside-triphosphatase activity

AN7549 3.33 Transcript induced in response to calcium dichloride in a CrzA-dependent manner

AN7580 3.71 Ortholog of A. fumigatus Af293 : Afu2g15110, A. niger CBS 513.88 : An15g02960, A. oryzae

RIB40 : AO090012000329, A. versicolor : Aspve1_0030832 and Aspergillus sydowii :

Aspsy1_0046014

AN8154 3.06 Hypothetical protein

AN8479 3.16 Has domain(s) with predicted RNA binding, RNA-directed DNA polymerase activity and role

in RNA-dependent DNA replication

AN8611 3.79 Has domain(s) with predicted catalytic activity and role in nucleoside metabolic process

AN9380 3.78 Putative chitin deacetylase; catalyzes the conversion of chitin to chitosan by the

deacetylation of N-acetyl-D-glucosamine residues

AN7594 2.89 DUF636 domain-containing protein; intracellular, menadione stress-induced protein; protein

levels decrease in response to farnesol

AN0635 2.89 Ortholog(s) have intracellular localization

AN2029 2.85 Putative F-box protein

AN1813 2.83 Ortholog of A. niger CBS 513.88 : An06g00160, A. oryzae RIB40 : AO090038000504,

AO090138000042, AO090103000093, A. niger ATCC 1015 : 37735-mRNA and A. versicolor :

Aspve1_0125259

AN6530 2.79 Ortholog(s) have 1-acylglycerol-3-phosphate O-acyltransferase activity, 1-

acylglycerophosphocholine O-acyltransferase activity, role in glycerophospholipid

biosynthetic process and endoplasmic reticulum, ribosome localization

AN8483 2.75 Ortholog of A. niger CBS 513.88 : An13g02730, Aspergillus brasiliensis : Aspbr1_0180212, N.

fischeri NRRL 181 : NFIA_001870, Aspergillus flavus NRRL 3357 : AFL2T_10566 and A.

clavatus NRRL 1 : ACLA_063590

D. Cánovas et al. 7 SI

Table S6 Top 25 genes induced during vegetative growth in the ∆gcnE strain.

NAMES

log

qmedian Description

AN1726 -5.09 Putative 3-methyl-2-oxobutanoate dehydrogenase

AN1825 -5.27 Putative sulfide:quinone oxidoreductase; transcript repressed by nitrogen limitation

AN1826 -5.47 Has domain(s) with predicted hydrolase activity

AN1895 -4.54 Maleyl-acetoacetate isomerase, enzyme involved in phenylalanine catabolism

AN1896 -3.96 Fumarylacetoacetate hydrolase, catalyzes the last step in the phenylalanine catabolic

pathway; intracellular; protein abundance decreased by menadione stress; mutation in

human ortholog causes type I hereditary tyrosinaemia

AN1897 -5.64 Homogentisate 1,2-dioxygenase, enzyme in phenylalanine catabolism; required for growth

on phenylalanine or phenylacetate as the sole carbon source; mutation in human ortholog

results in alkaptonuria

AN1899 -5.54 Putative 4-hydroxyphenylpyruvate dioxygenase with a predicted role in aromatic amino acid

biosynthesis; expression induced by phenylalanine and repressed by glucose; mutants

unable to use phenylalanine as a sole carbon source

AN3555 -3.74 Small heat-shock protein; Hsp30p ortholog/paralog; expression upregulated after exposure

to farnesol; palA-dependent expression independent of pH

AN3639 -4.80 Putative dihydrolipoamide transacylase; alpha keto acid dehydrogenase E2 subunit

AN3866 -4.07 Putative dehydratase with a predicted role in glycine, serine, and threonine metabolism

AN4688 -4.12 Putative acyl-coA dehydrogenase

AN7324 -4.09 Has domain(s) with predicted oxidoreductase activity and role in oxidation-reduction process

AN8559 -4.08 Putative branched chain alpha-keto acid dehydrogenase E1, beta subunit

AN9007 -5.81 Putative cytochrome P450; predicted secondary metabolism gene cluster member

AN9108 -5.01 Has domain(s) with predicted heme binding activity

AN1858 -3.69 Putative tryptophan 2,3-dioxygenase with a predicted role in aromatic amino acid

biosynthesis

AN2623 -3.50 Isopenicillin-N N-acyltransferase; null produces reduced levels of penicillin; partially

redundant with aatB

AN5957 -3.36 Putative branched chain amino acid aminotransferase with a predicted role in valine,

leucine, and isoleucine metabolism

AN8559 -3.23 Putative branched chain alpha-keto acid dehydrogenase E1, beta subunit

AN4690 -3.22 Alpha subunit of 3-methylcrotonyl-CoA carboxylase, involved in leucine degradation

AN6940 -3.22 Has domain(s) with predicted metal ion transmembrane transporter activity, role in metal

ion transport, transmembrane transport and membrane localization

AN6476 -3.17 Hypothetical protein

AN2571 -3.11 Hypothetical protein

AN6476 -3.11 Hypothetical protein

AN1898 -3.11 Ortholog(s) have role in melanin biosynthetic process from tyrosine, tyrosine catabolic

process and cytoplasm localization

8 SI D. Cánovas et al.

File S1

GO term analysis of the genes found by ANOVA to be differentially regulated.

A gene ontology (GO) analysis of the genes that define each component revealed that the genes located in the positive values of

1st PC are mainly involved in oxidation-reduction processes, secondary metabolism and polysaccharide metabolism, which includes

cell wall biogenesis (Table S6 and Figure S1), while genes located in the negative values of 1st PC are principally involved in general

primary metabolism, in particular metabolism of carboxilic and organic acids, ketones, small molecules, amino acids and

coenzymes, and oxidation-reduction processes (Table S7 and Figure S1). The positive values of the 2nd PC are characterized by

genes involved in secondary and primary metabolism (in particular, metabolism of carbohydrates, cellular nitrogen, carboxilic acids,

ketones, small molecules, amino acids and coenzymes, and oxidation-reduction processes) (Table S8 and Figure S2). The genes that

group at the negative values of the 2nd PC are involved in the metabolism of xylan and glucan carbohydrates, and cell wall

polysaccharide metabolism (Table S9 and Figure S2). Interestingly, there was a major contribution of unknown genes (aproximately

50%) in this category (negative values of the second PC). The expression of most of the genes in the GO categories of response to

stress, cellular response to stress, DNA metabolic process, response to DNA damage stimulus and DNA repair was higher in the

gcnE mutant grown under conidiation conditions (Figure S2). Two strange cases are ppoA and phiA. ppoA is responsible for the

synthesis of an oxylipin that regulates the balance between conidiation and sexual development (TSITSIGIANNIS et al. 2004). The

expression of ppoA is also higher in the gcnE mutant growing under conidiation conditions. phiA, a gene required for phialide

formation (MELIN et al. 2003), was up-regulated in the gcnE mutant even growing vegetatively.

D. Cánovas et al. 9 SI

Table S7 Top 20 genes in the first PC (positive values)

Gene code PC value X-

axis

Gene description

AN5650 0.11 Has domain(s) with predicted role in transmembrane transport and integral to membrane

localization

AN9247 0.1027 Protein required for normal levels of austinol and dehydroaustinol production

AN7809 0.09632 Ortholog of A. terreus NIH2624 : ATEG_01291

AN8384 0.09609 Protein of unknown function; required for austinol and dehydroaustinol biosynthesis

AN9253 0.09568 Putative cytochrome P450; required for austinol and dehydroaustinol biosynthesis

AN8006 0.0955 Hydrophobin, protein of the conidium wall responsible for hydrophobicity of conidium

surface; recombinant DewA spontaneously assembles at air:water interfaces and forms

functional amyloids

AN1837 0.09346 Putative hydrophobin; predicted glycosyl phosphatidylinositol (GPI)-anchor

AN7806 0.09198 Putative versicolorin reductase with a predicted role in sterigmatocystin/aflatoxin

biosynthesis; member of the sterigmatocystin biosynthesis gene cluster

AN4641 0.08857 Hypothetical protein

AN8375 0.08841 Hypothetical protein

AN9246 0.08729 Predicted dioxygenase; required for austinol and dehydroaustinol biosynthesis

AN9258 0.08666 Hypothetical protein

AN0499 0.08614 Has domain(s) with predicted chitin binding activity, role in chitin metabolic process and

extracellular region localization

AN2665 0.08514 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in

transmembrane transport and integral to membrane localization

AN8908 0.08013 Ortholog of A. fumigatus Af293 : Afu8g00630, A. niger CBS 513.88 : An07g00510, A. oryzae

RIB40 : AO090009000111, A. flavus NRRL 3357 : AFL2G_10541 and A. niger ATCC 1015 :

180382-mRNA

AN8979 0.07799 Alcohol dehydrogenase with a role in two-carbon compound metabolism; expression is

negatively regulated by glucose; transcript upregulated by exposure to ethanol

AN7810 0.07611 Putative aflatoxin biosynthesis protein with a role in aflatoxin/sterigmatocystin biosynthesis;

member of the sterigmatocystin biosynthesis gene cluster

AN9248 0.07526 Putative cytochrome P450; required for austinol and dehydroaustinol biosynthesis

AN7821 0.07496 Putative norsolorinic acid reductase with a predicted role in sterigmatocystin/aflatoxin

biosynthesis; member of the sterigmatocystin biosynthesis gene cluster

AN8624 0.07415 Hypothetical protein

10 SI D. Cánovas et al.

Table S8 Top 20 genes in the first PC (negative values)

Gene code PC value X-

axis

Gene description

AN0824 0.0513 Putative mitochondrial acyl-coA dehydrogenase involved in short-chain fatty acid beta-

oxidation; required for growth on short-chain fatty acids

AN5944 0.0514 Ortholog of A. nidulans FGSC A4 : AN10908, A. niger CBS 513.88 : An06g00460, An16g08070,

An11g00100, An07g04470, A. oryzae RIB40 : AO090038000122 and A. flavus NRRL 3357 :

AFL2G_08946, AFL2G_10172

AN6095 0.05162 Has domain(s) with predicted role in transmembrane transport and integral to membrane

localization

AN9295 0.05317 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in

transmembrane transport and integral to membrane localization

AN8963 0.05358 Hypothetical protein

AN1899 0.05361 Putative 4-hydroxyphenylpyruvate dioxygenase with a predicted role in aromatic amino acid

biosynthesis; expression induced by phenylalanine and repressed by glucose; mutants unable

to use phenylalanine as a sole carbon source

AN3639 0.0542 Putative dihydrolipoamide transacylase; alpha keto acid dehydrogenase E2 subunit

AN0620 0.05424 Hypothetical protein

AN7324 0.05544 Has domain(s) with predicted oxidoreductase activity and role in oxidation-reduction process

AN6438 0.05656 Ortholog(s) have exopeptidase activity

AN9007 0.05743 Putative cytochrome P450

AN6249 0.05796 Putative calcineurin binding protein, calcipressin

AN6754 0.05936 Predicted glycosylphosphatidylinositol (GPI)-anchored protein

AN3866 0.06007 Putative dehydratase with a predicted role in glycine, serine, and threonine metabolism

AN7233 0.06644 Putative epoxide hydrolase; expression reduced after exposure to farnesol

AN6424 0.06821 Has domain(s) with predicted oxidoreductase activity, acting on paired donors, with

incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and

incorporation of one atom each of oxygen into both donors activity

AN2572 0.07122 Putative dipeptidyl-peptidase; transcript upregulated by nitrate limitation

AN1826 0.07172 Has domain(s) with predicted hydrolase activity

AN9108 0.08742 Has domain(s) with predicted heme binding activity

AN1825 0.08933 Putative sulfide:quinone oxidoreductase; transcript repressed by nitrogen limitation

D. Cánovas et al. 11 SI

Table S9 Top 20 genes in the second PC (positive values)

Gene code PC value X-

axis

Gene description

AN3675 0.1177 Transcription factor of the Gcn4p c-Jun-like transcriptional activator family; involved in cross-

pathway control of amino acid biosynthesis in response to amino acid starvation; role in

sexual development; contains two 5' uORFs

AN1825 0.1007 Putative sulfide:quinone oxidoreductase; transcript repressed by nitrogen limitation

AN2571 0.09414 Hypothetical protein

AN3992 0.09197 Ortholog of A. nidulans FGSC A4 : AN8424, AN7089, A. fumigatus Af293 : Afu7g05085, A.

oryzae RIB40 : AO090005000321, A. flavus NRRL 3357 : AFL2G_00322, AFL2G_06467 and N.

fischeri NRRL 181 : NFIA_026200

AN7793 0.0898 Hypothetical protein

AN1304 0.0861 Hypothetical protein

AN1826 0.08586 Has domain(s) with predicted hydrolase activity

AN2319 0.08414 Ortholog of A. niger CBS 513.88 : An14g04210, A. oryzae RIB40 : AO090010000485, A. flavus

NRRL 3357 : AFL2G_11647, A. niger ATCC 1015 : 49373-mRNA and A. terreus NIH2624 :

ATEG_07606

AN9184 0.08085 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in

transmembrane transport and integral to membrane localization

AN8148 0.07651 Hypothetical protein

AN3396 0.07358 Putative non-ribosomal peptide synthase (NRPS); transcript repressed by nitrogen limitation

AN6940 0.07249 Has domain(s) with predicted metal ion transmembrane transporter activity, role in metal

ion transport, transmembrane transport and membrane localization

AN3866 0.07062 Putative dehydratase with a predicted role in glycine, serine, and threonine metabolism

AN3555 0.06999 Small heat-shock protein; Hsp30p ortholog/paralog; expression upregulated after exposure

to farnesol; palA-dependent expression independent of pH

AN2585 0.06933 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in

transmembrane transport and integral to membrane localization

AN9304 0.06752 Glutathione S-transferase; upregulated in A. oryzae and A. nidulans under hypoxic growth

conditions

AN6104 0.0673 Ortholog of A. fumigatus Af293 : Afu2g09510, A. niger CBS 513.88 : An16g06890, A. oryzae

RIB40 : AO090011000722, A. flavus NRRL 3357 : AFL2G_05453 and A. niger ATCC 1015 :

205026-mRNA

AN6753 0.06548 Putative NADH-dependent flavin oxidoreductase; menadione stress-induced protein

AN7792 0.06529 Putative lysophosphoplipase A; predicted glycosylphosphatidylinositol (GPI)-anchored

protein

AN1726 0.06515 Putative 3-methyl-2-oxobutanoate dehydrogenase

12 SI D. Cánovas et al.

Table S10 Top 20 genes in the second PC (negative values)

Gene code PC value X-

axis

Gene description

AN1818 0.06743 Protein with endo-1,4-beta-xylanase activity, involved in degradation of xylans

AN3877 0.06905 Ortholog of A. fumigatus Af293 : Afu8g01510, A. niger CBS 513.88 : An09g00650, A. oryzae

RIB40 : AO090020000665, A. flavus NRRL 3357 : AFL2G_10687 and A. niger ATCC 1015 :

203168-mRNA

AN2029 0.06913 Putative F-box protein

AN5509 0.06925 Putative F-box protein

AN5408 0.06956 Has domain(s) with predicted RNA binding, ribonuclease III activity and role in RNA

processing

AN7087 0.07038 Ortholog of A. fumigatus Af293 : Afu8g07170, A. oryzae RIB40 : AO090005000253, A. flavus

NRRL 3357 : AFL2G_00260, N. fischeri NRRL 181 : NFIA_099960 and A. clavatus NRRL 1 :

ACLA_060210

AN7580 0.0705 Ortholog of A. fumigatus Af293 : Afu2g15110, A. niger CBS 513.88 : An15g02960, A. oryzae

RIB40 : AO090012000329, A. flavus NRRL 3357 : AFL2G_03238 and N. fischeri NRRL 181 :

NFIA_090370

AN1604 0.07053 Putative alpha-1,3-glucanase; predicted glycosyl phosphatidylinositol (GPI)-anchor

AN7908 0.07226 Protein with alpha-arabinofuranosidase activity, involved in degradation of pectin; member

of the F9775 secondary metabolite gene cluster

AN7876 0.07244 Putative branched chain amino acid aminotransferase with a predicted role in branched

chain amino acid biosynthesis

AN3520 0.07264 Ortholog of A. niger CBS 513.88 : An04g10140 and A. niger ATCC 1015 : 55208-mRNA

AN6936 0.07337 Putative 2-hydroxychromene-2-carboxylate isomerase

AN6273 0.07357 Ortholog(s) have intracellular localization

AN6151 0.07382 Has domain(s) with predicted catalytic activity and role in metabolic process

AN8154 0.0748 Hypothetical protein

AN0482 0.07696 Putative ubiquitin-conjugating enzyme; transcript repressed by nitrate

AN3882 0.08028 Has domain(s) with predicted cysteine-type endopeptidase activity and role in proteolysis

AN9273 0.08553 Ortholog of A. oryzae RIB40 : AO090005000176, A. flavus NRRL 3357 : AFL2G_00195 and A.

terreus NIH2624 : ATEG_04373

AN8479 0.08646 Has domain(s) with predicted RNA binding, RNA-directed DNA polymerase activity and role in

RNA-dependent DNA replication

AN5290 0.0919 Predicted glycosylphosphatidylinositol (GPI)-anchored protein

D. Cánovas et al. 13 SI

Figure S1 Genetic complementation of the gcnE deletion. Strains were grown in minimal medium containing the appropriate nutritional requirements and photographed under the stereo microscope after 4 days of growth.

14 SI D. Cánovas et al.

Figure S2 Comparision of the up- and down-regulated genes in the wild type and ∆gcnE strains. The Venn-diagram depicts the number of genes down-regulated (differentially expressed during vegetative growth) or up-regulated (differentially expressed during conidiation) in the wild type and ∆gcnE strains. The size of the circle is propotional to the number of differentially regulated genes. The number of genes differentially regulated is 3.8-fold lower in the ∆gcnE than in the wild type strain. Specifically there are 3.3- and 4.5-fold lower number of differentially expressed genes during vegetative growth and conidiation, respectively, showing a tendency of gcnE to regulate conidiation genes. Genes up- or down-regulated in both strains are shown in the overlapping region of the circles and the total number of differentially regulated genes in each condition is shown in brackets.

D. Cánovas et al. 15 SI

Figure S3 Analysis of GO terms of biological processes of the genes differentially up-regulated (conidiation) or down-regulated (vegetative) in the wild type strain. Data is shown as percentage of genes in the actual category with respect to the total number of genes used for the GO term analysis.

16 SI D. Cánovas et al.

Figure S4 Analysis of GO terms of biological processes of the genes differentially up-regulated (conidiation) or down-regulated (vegetative) in the ∆gcnE strain. Data is shown as percentage of genes in the actual category with respect to the total number of genes used for the GO term analysis.

D. Cánovas et al. 17 SI

Figure S5 Analysis of GO terms of biological processes of the genes in the X-axis of the PC analysis. Genes with PC values over 0.5 (positive values) or under -0.5 (negative values) were selected for further analysis by GO terms because these are the genes that provide a higher statistical weight for defining the characteristics of the axis. The upper diagram depicts the GO terms of biological processes that are enriched in the list of differentially regulated genes located in the positive values of the X-axis. The lower diagram depicts the GO terms that are enriched in the list of differentially regulated genes located in the negative values of the X-axis. One gene can appear in more than one category. Data is shown as percentage of genes in the actual category with respect to the total number of genes used for the GO term analysis.

18 SI D. Cánovas et al.

Figure S6 Analysis of GO terms of biological processes of the genes in the Y-axis of the PC analysis. Genes with PC values over 0.5 (positive values) or under -0.5 (negative values) were selected for further analysis by GO terms because these are the genes that provide a higher statistical weight for defining the characteristics of the axis. The upper diagram depicts the GO terms that are enriched in the list of differentially regulated genes located in the positive values of the Y-axis. The lower diagram depicts the GO terms that are enriched in the list of differentially regulated genes located in the negative values of the Y-axis. Please note that one gene can appear in more than one category. Data is shown as percentage of genes in the actual category with respect to the total number of genes used for the GO term analysis.

D. Cánovas et al. 19 SI

Figure S7 Total amount of histone H3 at the promoter of brlA. Wild type and ∆gcnE strains were grown vegetatively for 18h and then conidiation was induced for 10 or 72 h. ChIP was carried out by immunoprecipitation of crosslinked DNA with an antibody against the C-terminus of histone H3, followed by qPCR analysis of the promoter regions. Consistent with a loss of nucleosomes during gene activation brlA showed a decrease in the immunoprecipitated DNA in both distal (brlAp1) and proximal (brlAp3) regions of the promoter in the wild type after induction of conidiation (con 10h, con 72h). The ∆gcnE mutant showed lower amounts than the wild type strain during vegetative growth but had comparable amounts after induction of conidiation. These low amounts also provide an explanation of the very low H3K9ac/K14ac levels found in the ∆gcnE strain at vegetative conditions (compare with Figure 5B), however, when the values shown in Figure 5B are normalized to the H3 C-terminal values there are still significantly lower acetylation levels found in the gcnE mutant. Values are the mean and standard error of the mean of at least 3 independent experiments.

20 SI D. Cánovas et al.

Figure S8 Inhibitors of histone deacetylases do not rescue the aconidial gcnE deletion phenotype. Wild type and ∆gcnE strains were inoculated on complete medium plates containing trichostatin A, or a cocktail of inhibitors (trichostatin A, butyrate and valproate) at 5µM. Plates were grown at 37°C for 4 days and then photographed.