the effects of vitamin d deficiency on bone structure and ... 6.pdf · vitamin d deficiency results...

CHAPTER 6

The Effects of Vitamin D Deficiency on Bone Structure and Remodeling

in Adult Rats with a Normal Mineral Homeostasis

K. van der Meijden1

M.G. Vervloet2

A.W.D. Stavenuiter3

H.W. van Essen4

J. Buskermolen4

M. den Heijer1

P. Lips1

N. Bravenboer4

Submitted for publication

1. Department of Endocrinology/Internal Medicine, VU University Medical Center, MOVE Research Institute, Amsterdam, The Netherlands

2. Department of Nephrology, VU University Medical Center, Amsterdam, The Netherlands

3. Department of Molecular Cell Biology & Immunology, VU University Medical Center, Amsterdam, The Netherlands

4. Department of Clinical Chemistry, VU University Medical Center, MOVE Research Institute, Amsterdam, The Netherlands

126

Chapter 6

ABSTRACT

Skeletal health problems caused by vitamin D deficiency are mainly attributed to hypocalcemia, hypophosphatemia and hyperparathyroid-ism, but whether low serum 25(OH)D and 1,25(OH)2D concentrations directly affect bone cell activity remains subject of debate. Therefore, the aim was to investigate whether vitamin D deficiency accompanied by normal serum calcium and phosphate concentrations in adult rats affects bone remodeling and bone structure as well as genes involved in local vitamin D metabolism in bone. Three months old male Wistar rats were fed either a diet containing 1.5 IU vitamin D/gram, 1% calci-um and 0.7% phosphate (n=10) or a vitamin D deficient diet contain-ing 2% calcium, 1.25% phosphate and 20% lactose in combination with six injections of paricalcitol during the first two weeks (n=10) to deplete vitamin D stores. Within three weeks, vitamin D deficiency was induced in the rats receiving the paricalcitol injections in combination with the vitamin D deficient diet, while serum calcium and phosphate concentrations were kept within the normal range. After ten weeks, rats were sacrificed. Histomorphometric analysis revealed that vita-min D deficiency in adult rats accompanied by normal serum calcium and phosphate concentrations did not have negative effects on bone structure and remodeling. Bone cells did also not respond to low se-rum 25(OH)D and 1,25(OH)2D levels by altered expression levels of CYP27B1, CYP24 and VDR. These results suggest that vitamin D defi-cient adult rats receiving a diet high in calcium, phosphate and lactose do not develop a vitamin D deficient bone phenotype.

127

Vitamin D deficiency in rats with a normal mineral homeostasis

6

INTRODUCTION

An adequate vitamin D status is essential for the maintenance of the skeleton through-out life [27]. Vitamin D status is assessed by the measurement of serum 25-hydroxyvi-tamin D (25(OH)D) concentration which is the major circulating metabolite [28]. The metabolite 25(OH)D is hydroxylated to the active metabolite 1,25-dihydroxyvitamin D (1,25(OH)2D) at the 1α-position by the renal 1α-hydroxylase enzyme derived from the CYP27B1 gene [57]. The positive effects of 1,25(OH)2D on the skeleton are primarily achieved by increasing the intestinal absorption of calcium, which facilitates mineral deposition in bone matrix [27]. Additional effects of 1,25(OH)2D on the skeleton can be exerted by binding to the vitamin D receptor (VDR) found in bone cells [55;56]. In vitro, 1,25(OH)2D inhibits proliferation of osteoblasts [52;56], enhances osteoblast differentiation as well as matrix mineralization [4;52;54;56], and increases RANKL expression which subsequently stimulates osteoclastogenesis [16]. In osteocytes, 1,25(OH)2D stimulates the transcription and synthesis of fibroblast growth factor 23 (FGF23) [43].

An adequate vitamin D status is also important for the autocrine and paracrine ac-tivities of 1,25(OH)2D in bone tissue, for instance regulation of cell growth and func-tion [3;52]. Bone cells express the enzyme 1α-hydroxylase (gene CYP27B1) and are able to synthesize 1,25(OH)2D from 25(OH)D [4;52;54]. An excess of local 25(OH)D and 1,25(OH)2D concentrations is prevented by the activity of the enzyme 24-hy-droxylase (gene CYP24) which is responsible for the conversion to 24R,25(OH)2D and 1,24R,25(OH)3D, respectively [2-4;52;54]. In contrast to the renal synthesis of 1,25(OH)2D which is tightly regulated by hormones, the synthesis of 1,25(OH)2D by 1α-hydroxylase in bone cells may depend on the serum 25(OH)D concentration [52]. Therefore, an adequate serum 25(OH)D concentration may be essential for the local availability of 1,25(OH)2D in bone tissue [38].

Vitamin D deficiency is a highly prevalent condition in humans worldwide [29]. Vitamin D deficiency has been associated with a lower bone mineral density [23], an increased bone turnover [23] and an increased fracture risk [53]. Skeletal health problems caused by vitamin D deficiency are mainly attributed to changes in serum calcium and parathyroid hormone (PTH) concentrations [29]. On the one hand severe vitamin D deficiency results in a reduced intestinal calcium absorption leading to a defective bone mineralization in the long term; on the other hand vitamin D deficiency causes secondary hyperparathyroidism, which results in a high bone turnover and an increased bone resorption [26;27]. In addition to the indirect effects of vitamin D de-ficiency on bone health, the activity of bone cells may also directly be affected by low 25(OH)D and 1,25(OH)2D concentrations. To study the effects of both low 25(OH)D and low 1,25(OH)2D concentrations on bone remodeling and local vitamin D metab-olism in bone in more detail, the effects of vitamin D deficiency need to be separated from those of hypocalcaemia and hyperparathyroidism. Several normocalcemic mod-

128

Chapter 6

els such as VDR knock-out mouse have been developed [1;10;11;37;42], but these models have limited value to study the effects of acquired vitamin D deficiency on local vitamin D metabolism in bone. Normocalcemic animal models of dietary vitamin D deficiency have also been developed [24;41;49;59], but the induction of both low serum 25(OH)D and 1,25(OH)2D levels in adult rats requires a long period of time as it only occurs in case of severe vitamin D deficiency [36;45].

Recently, a novel rat model of acquired vitamin D deficiency was introduced for the investigation of vitamin D deficiency without concurrent changes in PTH, calcium and phosphate serum concentrations [45]. In this model, rats were fed a vitamin D deficient diet during the whole study and received six intraperitoneal injections of paricalcitol in the first two weeks [45]. These paricalcitol injections accelerated the catabolism of vitamin D stores by increasing the expression of CYP24. Within three weeks, serum 25(OH)D and 1,25(OH)2D concentrations were extremely low [45]. Due to high dietary concentrations of calcium and phosphate in combination with lactose, the serum concentrations of calcium, phosphate and PTH were kept in the normal range [45]. For this reason, this model is very suitable for studying the isolat-ed effects of deficiency of both 25(OH)D and 1,25(OH)2D serum concentrations on bone structure, bone remodeling, bone mineralization and local vitamin D metabolism in bone tissue.

The first aim of this study was to investigate whether vitamin D deficiency in the absence of abnormal serum calcium and phosphate concentrations affects bone re-modeling, bone mineralization and bone structure in adult rats. With the presence of normal calcium and phosphate serum concentrations in the rats, we hypothesize that bone mineralization is not affected by vitamin D deficiency. The second aim of this study was to investigate the isolated impact of vitamin D deficiency on the expression of CYP27B1, CYP24 and the gene encoding VDR in bone metabolism of adult rats.

MATERIALS AND METHODS

AnimalsTen male Wistar rats (Harlan CPB, Horst, The Netherlands) at the age of 14 weeks were fed a vitamin D deficient diet (TD.87095 Brown C.C. Vit.D Defic; Harlan Lab-oratories, Madison, WI, USA) containing 2% calcium, 1.25% phosphate and 20% lactose. At day 1, 3, 5, 8, 10 and 12, the rats received intraperitoneal injections of 32 ng 19-nor-1,25-dihydroxyvitamin D2 (paricalcitol; Zemplar, kindly provided by Abb-Vie) for induction of CYP24 to accelerate the catabolism of endogenous 25(OH)D and 1,25(OH)2D leading to vitamin D deficiency, as published previously [45]. Ten age- and sex-matched Wistar rats (Harlan CPB, Horst, The Netherlands) were used as external control group. The control rats were fed a diet containing 1.5 IU vitamin D/gram, 1% calcium and 0.7% phosphate (2016 Teklad Global 16% Protein Rodent

129


6

Diet; Harlan Laboratories, Madison, WI, USA). Food and water were provided ad li-bitum and rats were maintained under conventional housing conditions. After 0 and 3 weeks, blood samples were collected from the vitamin D deficient rats by vena punc-ture to determine whether vitamin D deficiency was induced [45]. After 10 weeks, blood samples were collected at sacrifice by cardiac puncture from both vitamin D deficient and control rats. Serum samples were stored at -20ºC until measurements of 25(OH)D, 1,25(OH)2D, calcium, phosphate, PTH and creatinine concentrations. After sacrifice, tibiae and kidneys were dissected for further analysis. The Animal Care Committee at the VU University Medical Center in Amsterdam approved the experimental protocol, as described previously [45].

Serum biochemistrySerum 25(OH)D concentrations were analyzed using liquid chromatography-tandem mass spectrometry (LC-MS/MS) [21]. Briefly, samples were incubated with deuterat-ed internal vitamin D standards (d6-25(OH)D and d6-24R,25(OH)2D) and protein-pre-cipitated using acetonitrile. After PTAD derivatization, supernatant was purified using a Symbiosis online solid phase extraction (SPE) system (Spark Holland, Emmen, The Netherlands), followed by detection with a Quattro Premier XE tandem mass spec-trometer (Waters Corp., Milford, MA, USA). Serum 1,25(OH)2D concentrations were analyzed using a radioimmunoassay (Immunodiagnostic Systems, Boldon, UK). Se-rum PTH concentrations were analyzed using a rat intact PTH ELISA kit (Scantibodies Laboratory, Santee, CA, USA) according to the manufacturer’s protocol. Serum cal-cium, phosphate and creatinine concentrations were analyzed on a Modular system (Roche Diagnostics, Mannheim, Germany).

HistomorphometryRight tibiae were fixed in 4% phosphate-buffered formaldehyde for 24 h, dehydrated in graded ethanol and embedded in methylmetacrylate (MMA; BDH Chemicals, Poole, England) supplemented with 20% dibutylphtalate (Merck, Darmstadt, Germany), 8.0 g/L dibenzoylperoxide (AKZO Nobel, Deventer, The Netherlands) and 22 µl/10 ml N,N-dimethyl-p-toluidine (Merck), as described previously [51]. Undecalcified sec-tions of 5 µm thickness were cut with a Leica Jung K Polycut microtome (Nussloch, Germany) and sections were stained with Goldner’s trichrome, tartrate-resistant acid phosphatase (TRAP) and Von Kossa. Histomorphometric analysis was performed using a Nikon microscope equipped with NIS-Elements AR 3.1 (Nikon GmbH, Düs-seldorf, Germany). All measurements were performed according to the guidelines of the American Society of Bone and Mineral Research (ASBMR) nomenclature [12]. Measurements on trabecular bone were performed on two Goldner sections in a total area of 20.3 ± 4.7 mm2 per rat and started at one trabecular thickness medially of the endosteum to be certain that the area contained only trabecular bone. Gold-ner’s trichrome staining was used to measure bone structural parameters including

130

Chapter 6

trabecular bone volume (BV) and trabecular bone surface (BS), which were subse-quently used to calculate trabecular thickness (Tb.Th), trabecular number (Tb.N) and trabecular separation (Tb.Sp). TRAP staining was used to assess bone resorption by determining osteoclast number per bone surface (Oc.N/BS). Von Kossa staining was used to assess bone formation by determining osteoid surface per bone surface (OS/BS).

RNA isolation and RT-qPCROne week before the RNA isolation procedure, kidneys and left tibiae were placed in the RNAlater-ICE solution (Ambion, Austin, TX, USA). Total RNA isolation of kid-neys was performed using the RNeasy Midi Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. For removing residual DNA amounts an additional on-column DNase treatment was performed. The cortices of diaphyseal tibiae were pulverized in the presence of Trizol (Life Technologies, Bleiswijk, The Netherlands) using the Freezer Mill (Spex, Metuchen, NY, USA). After pulverization, a Trizol ex-traction, a chloroform/isoamylalcohol extraction and a second Trizol extraction was performed. For removing residual DNA amounts, samples were treated with DNase (Promega, Madison, WI, USA). Total RNA concentrations of both kidneys and tibiae were determined using the Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA).

RNA was reverse transcribed from 100 ng total RNA in a 20 µl reaction mixture containing 5 mmol/l MgCl2 (Eurogentec, Maastricht, The Netherlands), 1x RT buffer (Promega), 1 mmol/l dATP, 1 mmol/l dCTP, 1 mmol/l dGTP, 1 mmol/l dTTP (Roche Diagnostics), 1 mmol/l betaïne, 10 ng/µl random primer, 0.4 U/µl RNAsin (Prome-ga) and 5 U/µl M-MLV RT-enzym (Promega) [52]. The PCR reaction of total 25 µl contained 3 µl cDNA, 300 nmol/l reverse and forward primer for several genes of interest (Table 1) and SYBR Green Supermix (Bio-Rad Laboratories, Veenendaal, The Netherlands). The PCR was performed on an iCycler iQ™ Real-Time PCR Detection System (Bio-Rad): 3 min at 95°C, 40 cycles consisting of 15 sec at 95°C and 1 min at 60°C. The relative gene expression was calculated by the 2-ΔCt method and PBGD as well as HPRT were used as reference genes.

Statistical analysisData are presented as mean ± standard error of the mean (SEM). Differences be-tween two groups were assessed using the Mann-Whitney U test. A p-value <0.05 was considered statistically significant. Data were analyzed using SPSS version 20.0 software (SPSS Inc., Chicago, IL, USA).

131


6

RESULTS

Serum biochemistryVitamin D deficiency was successfully induced within three weeks in rats receiving paricalcitol injections in combination with a vitamin D deficient diet, as published previously [45]. After three weeks, mean serum 25(OH)D concentrations were 13.7 ± 0.5 nmol/l and mean serum 1,25(OH)2D concentrations were undetectable (<30.0 pmol/l) in the vitamin D deficient rats (Table 2) [45]. Mean serum PTH concentrations in the vitamin D deficient rats at baseline were 47.0 ± 7.3 pg/ml and after three weeks 30.3 ± 5.9 pg/ml [45]. After 10 weeks, both mean serum 25(OH)D and 1,25(OH)2D concentrations were still significantly lower in the vitamin D deficient rats compared to concentrations in the control rats (11.7 ± 0.3 and 72.2 ± 1.7 nmol/l, respectively;

Table 1. Primer sequence

Target Gene Primer sequence (5’- 3’)

Collagen type 1α2 (COL1α2) Forward: GCTGGGCTGCATGGTGAC

Reverse: TGGGGCCAGAAGGACCAG

Alkaline phosphatase (ALP) Forward: GACAAGAAGCCCTTCACAGC

Reverse: ACTGGGCCTGGTAGTTGTTG

Osteocalcin Forward: TCTGCTCACTCTGCTGGCC

Reverse: TCAGAGTCGCTGGGCTTTG

Osteopontin Forward: GGTTTGCTTTTGCCTGTTCG

Reverse: CTCCTCTGAGCTGCCAAACTC

Matrix extracellular phosphoglycoprotein (MEPE) Forward: AAGACAAGCCACCCTACACG

Reverse: CCCACTGGATGATGACTCACT

RANKL Forward: ACCAGCATCAAAATCCCAAG

Reverse: GGCCGCTAATTTCCTCACCA

OPG Forward: GTTCTTGCACAGCTTCACCA

Reverse: AAACAGCCCAGTGACCATTC

Fibroblast growth factor 23 (FGF23) Forward: GATGCTGGCTCCGTAGTGAT

Reverse: CGTCGTAGCCGTTCTCTAGC

Klotho Forward: TTAACGACCGCACAGCTCCGA

Reverse: TCTGGGCCCGGGAAACCATTG

CYP27B1 Forward: CCCGACACAGAAACCTTCAT

Reverse: GGCAAACATCTGATCCCAGT

CYP24 Forward: GCTGATGACAGACGGTGAGA

Reverse: TGTCGTGCTGTTTCTTCAGG

Vitamin D receptor (VDR) Forward: ACAGTCTGAGGCCCAAGCTA

Reverse: TCCCTGAAGTCAGCGTAGGT

132

Chapter 6

45.6 ± 2.2 and 162.2 ± 12.9 pmol/l, respectively; p<0.001; Table 2). Serum calcium concentrations were slightly higher in vitamin D deficient rats than in control rats (3.4 ± 0.0 and 3.1 ± 0.1 mmol/l, respectively; p<0.01), while serum phosphate concentra-tions did not differ between vitamin D deficient and control rats (3.9 ± 0.1 and 3.8 ± 0.1 mmol/l, respectively). Serum creatinine concentrations were increased in the vitamin D deficient rats compared to those in the control rats (29.4 ± 1.0 and 26.0 ± 0.6 µmol/l, respectively; p<0.01).

Bone histomorphometryVon Kossa-stained sections of bones from vitamin D deficient rats did not reveal increases of osteoid tissue as a sign of osteomalacia (Fig. 1A). Histomorphometric analysis of bone structure parameters, i.e. bone volume/tissue volume (BV/TV), tra-becular thickness (Tb.Th), trabecular number (Tb.N) and trabecular seperation (Tb.Sp), did not reveal differences between vitamin D deficient and control rats (Fig. 1B-E). Regarding remodeling parameters, trabecular osteoid surface (Tb.OS/BS) was 41% lower in the vitamin D deficient rats compared to control rats (p<0.05; Fig. 1F). The number of osteoclasts (N.Oc/BS) in the vitamin D deficient rats did not differ from control rats (Fig. 1G).

Table 2. Serum biochemistry

Deficient Deficient Deficient Control

Time (weeks) t=0 t=3 t=10 t=10

25(OH)D (nmol/l) 57.4 ± 5.0 13.7 ± 0.5 11.7 ± 0.3 a 72.2 ± 1.7

1,25(OH)2D (pmol/l) 475.5 ± 19.3 <30.0 45.6 ± 2.2 a 162.2 ± 12.9

PTH (pg/ml) 47.0 ± 7.3 30.3 ± 5.9 - -

Calcium (mmol/l) 2.5 ± 0.0 2.7 ± 0.0 3.4 ± 0.0 b 3.1 ± 0.1

Phosphate (mmol/l) 2.3 ± 0.1 2.0 ± 0.0 3.9 ± 0.1 3.8 ± 0.1

Creatinine (µmol/l) - - 29.4 ± 1.0 c 26.0 ± 0.6

NOTE. Results are expressed as mean ± SEM from 10 rats and were statistically analysed using the Mann– Whitney U test.a p<0.001 control (t=10) vs. deficient (t=10)b p<0.01 control (t=10) vs. deficient (t=10)c p<0.05 control (t=10) vs. deficient (t=10)

133


6

mRNA expression of genes involved in bone formation and resorption Expression levels of collagen type 1α2 (COL1α2; 1.5 fold, p<0.05, Fig. 2A), alkaline phosphatase (ALP; 1.5 fold, p<0.05, Fig. 2B), osteocalcin (2.0 fold, p<0.01, Fig. 2C) and osteopontin (2.3 fold, p<0.01, Fig. 2D) were all higher in the vitamin D deficient rats than those in the control rats. MEPE, RANKL and OPG mRNA levels did not differ between the vitamin D deficient and control rats (Fig. 2E-G), nor did the RANKL/OPG ratio (Fig. 2H).

FGF23 mRNA expression in bone and Klotho mRNA expression in the kidneyFGF23 mRNA levels in tibiae were 2.0 fold higher in the vitamin D deficient rats com-pared to those in the control rats (Fig. 3A). In the kidneys, Klotho mRNA levels were 39% lower in the vitamin D deficient compared to those in the control rats (Fig. 3B).

Figure 1. Bone structure and remodeling parameters in tibiae from vitamin D deficient and control rats. (A) Representative micrograph of a Von Kossa stained section of tibial bone from a vitamin D deficient rat. (B) Bone volume/tissue volume (BV/TV). (C) Trabecular thickness (Tb.Th). (D) Trabecular number (Tb.N). (E) Trabecular seperation (Tb.Sp). (F) Trabecular osteoid surface/bone surface (Tb.OS/BS). (G) Trabecular osteoclast number/bone surface (N.Oc/BS). Results are expressed as mean from 9-10 rats and were statistically analyzed using the Mann–Whitney U test (*p<0.05).

134

Chapter 6

mRNA expression of genes involved in vitamin D metabolism in bone and kidney

CYP27B1, CYP24 and VDR mRNA levels in tibiae did not differ between vitamin D deficient and control rats (Fig. 4A-C). In kidneys, CYP27B1 mRNA levels were 77% lower and CYP24 mRNA levels were 3.9 fold higher in vitamin D deficient rats com-pared to those in control rats (Fig. 4D and E). VDR mRNA levels in kidneys from vitamin D deficient rats were not different from control rats (Fig. 4F).

Figure 2. mRNA expression of genes involved in bone formation and resorption in tibiae from vitamin D deficient and control rats. (A) Collagen type 1α2 (COL1α2). (B) Alkaline phosphate (ALP). (C) Osteocalcin. (D) Osteopontin. (E) Matrix extracellular phosphoglycoprotein (MEPE). (F) Receptor activator of nuclear factor kappa-B ligand (RANKL). (G) Osteoprotegerin (OPG). (H) RANKL/OPG ratio. Results are expressed as mean from 8-10 rats and were statistically analyzed using the Mann–Whitney U test (*p<0.05, **p<0.01).

135


6

Figure 3. FGF23 mRNA expression in tibiae and Klotho mRNA expression in kidneys from vitamin D defi-cient and control rats. (A) Fibroblast growth factor 23 (FGF23). (B) Klotho. Results are expressed as mean from 8-10 rats and were statistically analyzed using the Mann–Whitney U test (*p<0.05, ***p<0.001).

Figure 4. mRNA expression of genes involved in vitamin D metabolism in tibiae and kidneys from vitamin D deficient and control rats. (A) CYP27B1 in the tibia. (B) CYP24 in the tibia. (C) Vitamin D receptor (VDR) in the tibia. (D) CYP27B1 in the kidney. (E) CYP24 in the kidney. (F) Vitamin D receptor (VDR) in the kidney. Results are expressed as mean from 8-10 rats and were statistically analyzed using the Mann–Whitney U test (**p<0.01, ***p<0.001).

136

Chapter 6

DISCUSSION

Skeletal health problems caused by vitamin D deficiency are assumed to be due mainly to hypocalcemia, hypophosphatemia and hyperparathyroidism. However, di-rect effects of low serum 25(OH)D and 1,25(OH)2D concentrations on bone cell activity may occur as well. Therefore, a recently published rat model of vitamin D deficiency, but with unchanged serum levels of minerals and PTH, was used to study the effects of vitamin D deficiency on skeletal health [45]. The current study presents the effects of both low 25(OH)D and 1,25(OH)2D concentrations on bone structure, remodeling, mineralization and expression of genes involved in vitamin D and bone metabolism.

As we hypothesized, the Von Kossa-stained bone sections of the vitamin D de-ficient rats did not show mineralization defects. The absence of mineralization de-fects is most likely due to the administration of a diet containing high calcium, high phosphate and lactose to the vitamin D deficient rats leading to normal calcium and phosphate serum concentrations. Because bone mineralization is mainly a passive process [9], the presence of normal calcium and phosphate concentrations may be sufficient to maintain an adequate mineralization of bone as shown by previously published vitamin D deficient rat studies [44;49].

Remarkably, trabecular osteoid surface was lower in tibiae of vitamin D deficient rats than in those of control rats, while mRNA levels of osteoblast markers including ALP, COL1α2, osteocalcin and osteopontin were higher. The lower trabecular osteoid surface can be explained by an increased speed of mineralization or a reduced bone formation. A reduced bone formation is less likely due to the increased mRNA levels of osteoblast markers in tibiae of vitamin D deficient rats. It is possible that the slight-ly higher serum calcium levels induced by the high calcium intake may have resulted in a higher speed of mineralization and thus a lower trabecular osteoid surface com-pared to the control rats. The increased mRNA levels of osteoblast markers would be expected to result in an increased trabecular bone volume as well. Probably, the increase in mRNA levels of osteoblast markers did not result in an increased trabec-ular bone volume yet. Alternatively, it is possible that post-translational processes differ substantially for different vitamin D levels, since we did not measure protein abundance.

Contrary to expectations, this study showed that mRNA levels of osteoblast mark-ers increased in vitamin D deficient normocalcemic rats. According to several other animal and in vitro studies a decrease in osteoblast activity was expected after a period of low 1,25(OH)2D levels [17;37;52;54]. For instance, in VDR knockout, 1α-hy-droxylase knockout and double knockout mice which showed normal PTH, calcium and phosphate levels due to a rescue diet, osteoblast numbers and bone volume were below levels in wild-type mice [37]. This suggests that the absence of a func-tional 1,25(OH)2D/VDR system has direct negative consequences for bone forma-

137


6

tion and linear growth [37]. The stimulating role of 1,25(OH)2D on bone formation has also been demonstrated by in vitro studies in which 1,25(OH)2D enhanced rat osteoblast differentiation by increasing expression levels of alkaline phosphatase, osteocalcin, and osteopontin [8;18;25;30;35;40]. Moreover, VDR overexpression in mature osteoblasts leads to an increase in trabecular and cortical bone due to an in-crease in formation and a decrease in resorption [5;17]. The studies mentioned above are in contrast to our study in which vitamin D deficiency resulted in an increase, and not in a reduction, of mRNA levels of osteoblast markers. Nevertheless, it has been reported that the absence of the VDR in osteoblasts can result in an increase in bone mass in mice with normal mineral homeostasis, but these effects were caused by a reduced bone resorption and not by an increased bone formation rate [60]. Thus, the increase in mRNA levels of osteoblast markers in vitamin D deficient rats is difficult to explain by low serum 1,25(OH)2D levels, but other factors such as the high calcium diet may play a role as well. In an adult mouse model, a high calcium diet resulted in an increase of trabecular bone volume and bone mineral density [14]. This increase of trabecular bone volume was associated with an increase in osteoblast numbers and an increased gene expression of the calcium sensing receptor (CaSR), ALP, COL1 and osteonectin, but also with a decrease in osteoclast numbers and a reduced RANKL/OPG ratio [14]. Results from the latter study suggest that a high calcium diet can stimulate bone formation. In vitro, it has also been shown that activation of the CaSR by high extracellular calcium can stimulate osteoblast differentiation and mineralization [13;61]. Thus, it is possible that the higher calcium content in the diet of vitamin D deficient animals may have stimulated mRNA levels of osteoblast markers.

The diet used in this study contained, in addition to the high calcium content, also high phosphate which may have resulted in higher FGF23 mRNA levels in tibiae of vitamin D deficient rats than those of control rats. After all, FGF23 responds to phos-phate loading as such promoting phosphaturia [32]. This feature is well-established in human subjects as well where phosphate loading increases serum FGF23 concen-trations to maintain phosphate balance [58]. An important function of FGF23 is the regulation of 1α-hydroxylase and 24-hydroxylase activity in the kidney. Since it could have been expected that vitamin D deficiency would have induced a compensatory response in expression of genes involved in its regulation, this was not observed. It can be speculated that the reduced CYP27B1 mRNA levels and increased CYP24 mRNA levels in kidneys of vitamin D deficient rats with normal calcium and phos-phate concentrations may be due to high FGF23 concentrations in serum. In this way, FGF23 suppresses serum 1,25(OH)2D levels to reduce phosphate absorption from the intestine.

Regulation of phosphate homeostasis by FGF23 in the kidney is mediated through binding to the FGF receptor (FGFR) and co-receptor α-Klotho, a protein predom-inantly expressed in the distal tubule at the cell surface [39]. The membrane form of Klotho increases the binding affinity of FGF23 to the FGFR whereby the FGF23-

138

Chapter 6

FGFR-Klotho complex can exert its effects including stimulation of phosphaturia and calcium reabsorption [32]. The secreted form of Klotho acts as an anti-aging and organ protection factor and regulates ion channels and transporters in target tissues independent of the FGFR [22]. We found a lower mRNA expression of Klotho in the vitamin D deficient rats than in the control rats which may be caused by the low 1,25(OH)2D serum levels. Supportive is a study in mice in which 1,25(OH)2D admin-istration increased Klotho expression in the kidney, while mice fed a vitamin D defi-cient diet showed decreased Klotho expression levels [47]. In addition, in human and mouse renal cell lines 1,25(OH)2D is able to induce mRNA levels of Klotho [15;19;20]. Other factors may have influenced the expression of Klotho in the vitamin D deficient rats as well. In mice, renal Klotho expression is reduced by high dietary phosphate (1.0-1.5% phosphate) [34] and in other animal models, high FGF23 levels result in decreased Klotho mRNA levels [31;33]. Moreover, the vitamin D deficient rats had a higher serum creatinine level (for unknown reasons), which is also a well-established factor in the downregulation of Klotho [46]. However, whether these factors act di-rectly on Klotho mRNA levels is unknown.

CYP27B1 mRNA levels in bone appeared not to be affected by low 25(OH)D and 1,25(OH)2D serum concentrations which is in line with a previous study in long-term vitamin D deficient older adult mice [51]. Because the locally synthesized 1,25(OH)2D in bone acts via autocrine and paracrine mechanisms, it is most likely that CYP27B1 mRNA is regulated at a local level and not systemically. This is supported by stud-ies in which bone CYP27B1 mRNA is regulated by local factors such as mechanical loading [50], interleukin-1β [54] and TGF-β [48]. CYP24 and VDR mRNA levels were also not affected by low serum 25(OH)D and 1,25(OH)2D concentrations, suggest-ing that these mRNA levels in bone are not regulated by circulating 25(OH)D and 1,25(OH)2D.

In our rat model, paricalcitol injections were administered in the first two weeks to induce CYP24 expression leading to a rapid reduction of the 25(OH)D and 1,25(OH)2D serum concentrations [45]. In rats, the clearance rate of paricalcitol is similar to that of 1,25(OH)2D [6]. Although there are no data available about the half-life of paricalcitol in rats, in healthy humans the half-life of paricalcitol is 5-7 hours [7]. Therefore, a carry-over effect of paricalcitol on our results is highly unlikely.

This study has several limitations. The use of an external control group may have led to small differences between the groups, but differences between groups were minimized by the use of age-, sex- and strain-matched rats and the maintenance of the same housing conditions. Furthermore, eight weeks of vitamin D deficiency in 14 weeks old rats may be too short to alter bone structure or remodeling parameters. A vitamin D deficient bone phenotype could not be established for this animal model due to the absence of a vitamin D deficient control group receiving a normal diet in combination with paricalcitol injections. Another point that can be made is that we did not have the possibility to confirm the presence of high concentrations of FGF23

139


6

in serum of vitamin D deficient rats due to instability of FGF23 in serum samples. Lastly, we did not measure protein content in bone tissue.

We showed that vitamin D deficiency in young adult rats did not result in the de-velopment of bone mineralization defects and an increase in bone resorption which is most likely due to the administration of a diet high in calcium, phosphate and lactose. The high calcium and high phosphate content in the diet may even have resulted in the development of additional effects such as the high FGF23 mRNA levels in the vitamin D deficient rats. In other studies, diets containing 2% calcium and 1.25% phosphate in combination with 20% lactose are not unusual but these rescue diets are mostly administered to growing animals [1;10;37]. We used young adult rats, which did not have a period of rapid growth during the study and probably had a lower need for calcium and phosphate.

We can conclude that vitamin D deficient adult rats receiving a diet high in calci-um, phosphate and lactose do not develop a vitamin D deficient bone phenotype. CYP27B1, CYP24 and VDR mRNA levels in bone do also not change after a period of low serum 25(OH)D and 1,25(OH)2D levels in adult rats accompanied by normal serum calcium and phosphate concentrations.

AcknowledgementsWe thank Paulien Holzmann, Ina Kamphuis and Mirjam Bethlehem for their excellent technical support. We also thank the technicians from the department of Clinical Chemistry for performing 25(OH)D, 1,25(OH)2D, PTH, calcium, phosphate and cre-atinine measurements in serum.

140

Chapter 6

1. Amling M, Priemel M, Holzmann T, Chapin K, Rueger JM, Baron R, Demay MB (1999) Rescue of the skeletal phenotype of vita-min D receptor-ablated mice in the setting of normal mineral ion homeostasis: formal histomorphometric and biomechanical analyses. Endocrinology 140:4982-4987

2. Anderson PH, Atkins GJ (2008) The

skeleton as an intracrine organ for vitamin D metabolism. Mol Aspects Med 29:397-406

3. Anderson PH, Atkins GJ, Turner AG,

Kogawa M, Findlay DM, Morris HA (2011) Vitamin D metabolism within bone cells: effects on bone structure and strength. Mol Cell Endocrinol 347:42-47

4. Atkins GJ, Anderson PH, Findlay DM,

Welldon KJ, Vincent C, Zannettino AC, O’Loughlin PD, Morris HA (2007) Metab-olism of vitamin D3 in human osteoblasts: evidence for autocrine and paracrine activities of 1α,25-dihydroxyvitamin D3. Bone 40:1517-1528

5. Baldock PA, Thomas GP, Hodge JM, Baker

SU, Dressel U, O’Loughlin PD, Nicholson GC, Briffa KH, Eisman JA, Gardiner EM (2006) Vitamin D action and regulation of bone remodeling: suppression of osteo-clastogenesis by the mature osteoblast. J Bone Miner Res 21:1618-1626

6. Brown AJ, Finch J, Takahashi F, Slatopol-

sky E (2000) Calcemic activity of 19-Nor-1,25(OH)2D2 decreases with duration of treatment. J Am Soc Nephrol 11:2088-2094

7. Cato A, Buschen C, Ahmed A, Chang M,

Chang M, Amdahl M, Klemz M, and Stoll R (1997) The pharmacokinetics of paracal-cin. Clin Pharmacol Ther 61(218)

8. Chen J, Thomas HF, Sodek J (1996) Regu-

lation of bone sialoprotein and osteopon-tin mRNA expression by dexamethasone and 1,25-dihydroxyvitamin D3 in rat bone organ cultures. Connect Tissue Res 34:41-51

9. Clarke B (2008) Normal bone anatomy and physiology. Clin J Am Soc Nephrol 3 Suppl 3:S131-S139

10. Dardenne O, Prud’homme J, Hacking SA,

Glorieux FH, St-Arnaud R (2003) Correc-tion of the abnormal mineral ion home-ostasis with a high-calcium, high-phos-phorus, high-lactose diet rescues the PDDR phenotype of mice deficient for the 25-hydroxyvitamin D-1α-hydroxylase (CYP27B1). Bone 32:332-340

11. Dardenne O, Prudhomme J, Hacking SA,

Glorieux FH, St-Arnaud R (2003) Rescue of the pseudo-vitamin D deficiency rickets phenotype of CYP27B1-deficient mice by treatment with 1,25-dihydroxyvitamin D3: biochemical, histomorphometric, and biomechanical analyses. J Bone Miner Res 18:637-643

12. Dempster DW, Compston JE, Drezner

MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, Recker RR, Parfitt AM (2013) Standardized nomenclature, symbols, and units for bone histomorpho-metry: a 2012 update of the report of the ASBMR Histomorphometry Nomenclature Committee. J Bone Miner Res 28:2-17

13. Dvorak MM, Siddiqua A, Ward DT, Carter

DH, Dallas SL, Nemeth EF, Riccardi D (2004) Physiological changes in extracel-lular calcium concentration directly control osteoblast function in the absence of calciotropic hormones. Proc Natl Acad Sci U S A 101:5140-5145

14. Feng Y, Zhou M, Zhang Q, Liu H, Xu Y,

Shu L, Zhang J, Miao D, Ren Y (2015) Synergistic effects of high dietary calcium and exogenous parathyroid hormone in promoting osteoblastic bone formation in mice. Br J Nutr 113:909-922

15. Forster RE, Jurutka PW, Hsieh JC, Haussler

CA, Lowmiller CL, Kaneko I, Haussler MR, Kerr WG (2011) Vitamin D receptor controls expression of the anti-aging klotho gene in mouse and human renal cells. Biochem Biophys Res Commun 414:557-562

REFERENCES

141


6

16. Franceschi RT, Li Y (2011) Vitamin D Reg-ulation of Osteoblast Function. In Vitamin D (Third Edition), edited by Feldman D, Pike JW, Adams JS. Academic Press, San Diego, pp 321-333

17. Gardiner EM, Baldock PA, Thomas GP,

Sims NA, Henderson NK, Hollis B, White CP, Sunn KL, Morrison NA, Walsh WR, Eisman JA (2000) Increased formation and decreased resorption of bone in mice with elevated vitamin D receptor in mature cells of the osteoblastic lineage. FASEB J 14:1908-1916

18. Halstead LR, Scott MJ, Rifas L, Avioli LV

(1992) Characterization of osteoblast-like cells from normal adult rat femoral trabec-ular bone. Calcif Tissue Int 50:93-95

19. Haussler MR, Haussler CA, Whitfield GK,

Hsieh JC, Thompson PD, Barthel TK, Bartik L, Egan JB, Wu Y, Kubicek JL, Lowmiller CL, Moffet EW, Forster RE, Jurutka PW (2010) The nuclear vitamin D receptor controls the expression of genes encoding factors which feed the “Fountain of Youth” to mediate healthful aging. J Steroid Biochem Mol Biol 121:88-97

20. Haussler MR, Whitfield GK, Kaneko I,

Forster R, Saini R, Hsieh JC, Haussler CA, Jurutka PW (2012) The role of vitamin D in the FGF23, klotho, and phosphate bone-kidney endocrine axis. Rev Endocr Metab Disord 13:57-69

21. Heijboer AC, Blankenstein MA, Kema IP,

Buijs MM (2012) Accuracy of 6 routine 25-hydroxyvitamin D assays: influence of vitamin D binding protein concentration. Clin Chem 58:543-548

22. Kim JH, Hwang KH, Park KS, Kong ID, Cha

SK (2015) Biological Role of Anti-aging Protein Klotho. J Lifestyle Med 5:1-6

23. Kuchuk NO, Pluijm SM, van Schoor NM,

Looman CW, Smit JH, Lips P (2009) Relationships of serum 25-hydroxyvitamin D to bone mineral density and serum parathyroid hormone and markers of bone

turnover in older persons. J Clin Endo-crinol Metab 94:1244-1250

24. Lester GE, VanderWiel CJ, Gray TK,

Talmage RV (1982) Vitamin D deficiency in rats with normal serum calcium concentra-tions. Proc Natl Acad Sci U S A 79:4791-4794

25. Lian J, Stewart C, Puchacz E, Mackowiak S, Shalhoub V, Collart D, Zambetti G, Stein G (1989) Structure of the rat osteocalcin gene and regulation of vitamin D-dependent expression. Proc Natl Acad Sci U S A 86:1143-1147

26. Lips P (2001) Vitamin D deficiency and

secondary hyperparathyroidism in the elderly: consequences for bone loss and fractures and therapeutic implications. Endocr Rev 22:477-501

27. Lips P (2006) Vitamin D physiology. Prog

Biophys Mol Biol 92:4-8 28. Lips P (2007) Relative value of 25(OH)D

and 1,25(OH)2D measurements. J Bone Miner Res 22:1668-1671

29. Lips P (2010) Worldwide status of vitamin

D nutrition. J Steroid Biochem Mol Biol 121:297-300

30. Manolagas SC, Burton DW, Deftos LJ

(1981) 1,25-Dihydroxyvitamin D3 stimulates the alkaline phosphatase activity of osteo-blast-like cells. J Biol Chem 256:7115-7117

31. Marsell R, Krajisnik T, Goransson H, Ohls-

son C, Ljunggren O, Larsson TE, Jonsson KB (2008) Gene expression analysis of kidneys from transgenic mice expressing fibroblast growth factor-23. Nephrol Dial Transplant 23:827-833

32. Martin A, David V, Quarles LD (2012)

Regulation and function of the FGF23/klotho endocrine pathways. Physiol Rev 92:131-155

142

Chapter 6

33. Meyer MH, Dulde E, Meyer RA, Jr. (2004) The genomic response of the mouse kidney to low-phosphate diet is altered in X-linked hypophosphatemia. Physiol Genomics 18:4-11

34. Morishita K, Shirai A, Kubota M, Katakura

Y, Nabeshima Y, Takeshige K, Kamiya T (2001) The progression of aging in klotho mutant mice can be modified by dietary phosphorus and zinc. J Nutr 131:3182-3188

35. Mosavin R, Mellon WS (1996) Posttran-

scriptional regulation of osteocalcin mRNA in clonal osteoblast cells by 1,25-dihy-droxyvitamin D3. Arch Biochem Biophys 332:142-152

36. Need AG, O’Loughlin PD, Morris HA,

Coates PS, Horowitz M, Nordin BE (2008) Vitamin D metabolites and calcium absorption in severe vitamin D deficiency. J Bone Miner Res 23:1859-1863

37. Panda DK, Miao D, Bolivar I, Li J, Huo

R, Hendy GN, Goltzman D (2004) Inactivation of the 25-hydroxyvitamin D 1α-hydroxylase and vitamin D receptor demonstrates independent and interde-pendent effects of calcium and vitamin D on skeletal and mineral homeostasis. J Biol Chem 279:16754-16766

38. Peterlik M, Cross HS (2005) Vitamin D and

calcium deficits predispose for multiple chronic diseases. Eur J Clin Invest 35:290-304

39. Prie D, Friedlander G (2010) Reciprocal

control of 1,25-dihydroxyvitamin D and FGF23 formation involving the FGF23/Klotho system. Clin J Am Soc Nephrol 5:1717-1722

40. Prince CW, Butler WT (1987) 1,25-Dihy-

droxyvitamin D3 regulates the biosynthesis of osteopontin, a bone-derived cell attachment protein, in clonal osteo-blast-like osteosarcoma cells. Coll Relat Res 7:305-313

41. Rasmussen P (1969) The action of vitamin D deficiency on bone tissue and the epiphyseal plate in rats given adequate amounts of calcium and phosphorus in the diet. Arch Oral Biol 14:1293-1304

42. Rowling MJ, Gliniak C, Welsh J, Fleet JC

(2007) High dietary vitamin D prevents hy-pocalcemia and osteomalacia in CYP27B1 knockout mice. J Nutr 137:2608-2615

43. Saji F, Shigematsu T, Sakaguchi T, Ohya

M, Orita H, Maeda Y, Ooura M, Mima T, Negi S (2010) Fibroblast growth factor 23 production in bone is directly regulated by 1α,25-dihydroxyvitamin D, but not PTH. Am J Physiol Renal Physiol 299:F1212-F1217

44. Schaafsma G, Visser WJ, Dekker PR, van

Schaik M (1987) Effect of dietary calcium supplementation with lactose on bone in vitamin D-deficient rats. Bone 8:357-362

45. Stavenuiter AW, Arcidiacono MV, Ferran-

telli E, Keuning ED, Vila CM, ter Wee PM, Beelen RH, Vervloet MG, Dusso AS (2015) A novel rat model of vitamin D deficiency: safe and rapid induction of vitamin D and calcitriol deficiency without hyperparathy-roidism. Biomed Res Int 2015:604275

46. Sun CY, Chang SC, Wu MS (2012)

Suppression of Klotho expression by protein-bound uremic toxins is associated with increased DNA methyltransferase expression and DNA hypermethylation. Kidney Int 81:640-650

47. Tsujikawa H, Kurotaki Y, Fujimori T, Fukuda

K, Nabeshima Y (2003) Klotho, a gene related to a syndrome resembling human premature aging, functions in a negative regulatory circuit of vitamin D endocrine system. Mol Endocrinol 17:2393-2403

48. Turner AG, Dwivedi PP, May BK, Morris

HA (2007) Regulation of the CYP27B1 5’-flanking region by transforming growth factor-beta in ROS 17/2.8 osteoblast-like cells. J Steroid Biochem Mol Biol 103:322-325

143


6

49. Underwood JL, DeLuca HF (1984) Vitamin D is not directly necessary for bone growth and mineralization. Am J Physiol 246:E493-E498

50. van der Meijden K, Bakker AD, van Essen

HW, Heijboer AC, Schulten EAJM, Lips P, Bravenboer N (2016) Mechanical loading and the synthesis of 1,25(OH)2D in prima-ry human osteoblasts. J Steroid Biochem Mol Biol 156:32-39

51. van der Meijden K, Buskermolen J, van

Essen HW, Schuurman T, Steegenga WT, Brouwer-Brolsma EM, Langenbach GE, van Ruijven LJ, den Heijer M, Lips P, Bravenboer N (2015) Long-term vitamin D deficiency in older adult C57BL/6 mice does not affect bone structure, remode-ling and mineralization. J Steroid Biochem Mol Biol

52. van der Meijden K, Lips P, van Driel M,

Heijboer AC, Schulten EA, den Heijer M, Bravenboer N (2014) Primary human osteoblasts in response to 25-hydroxyvi-tamin D3, 1,25-dihydroxyvitamin D3 and 24R,25-dihydroxyvitamin D3. PLoS One 9:e110283

53. van Schoor NM, Visser M, Pluijm SM, Ku-

chuk N, Smit JH, Lips P (2008) Vitamin D deficiency as a risk factor for osteoporotic fractures. Bone 42:260-266

54. van Driel M, Koedam M, Buurman CJ,

Hewison M, Chiba H, Uitterlinden AG, Pols HA, van Leeuwen JP (2006) Evidence for auto/paracrine actions of vitamin D in bone: 1α-hydroxylase expression and activity in human bone cells. FASEB J 20:2417-2419

55. van Driel M, Pols HA, van Leeuwen JP

(2004) Osteoblast differentiation and control by vitamin D and vitamin D metab-olites. Curr Pharm Des 10:2535-2555

56. van Driel M, van Leeuwen JP (2014) Vita-

min D endocrine system and osteoblasts. Bonekey Rep 3:493

57. Verstuyf A, Carmeliet G, Bouillon R, Mathieu C (2010) Vitamin D: a pleiotropic hormone. Kidney Int 78:140-145

58. Vervloet MG, van Ittersum FJ, Buttler RM,

Heijboer AC, Blankenstein MA, ter Wee PM (2011) Effects of dietary phosphate and calcium intake on fibroblast growth factor-23. Clin J Am Soc Nephrol. 6:383-389

59. Weinstein RS, Underwood JL, Hutson MS,

DeLuca HF (1984) Bone histomorphome-try in vitamin D-deficient rats infused with calcium and phosphorus. Am J Physiol 246:E499-E505

60. Yamamoto Y, Yoshizawa T, Fukuda T,

Shirode-Fukuda Y, Yu T, Sekine K, Sato T, Kawano H, Aihara K, Nakamichi Y, Watanabe T, Shindo M, Inoue K, Inoue E, Tsuji N, Hoshino M, Karsenty G, Metzger D, Chambon P, Kato S, Imai Y (2013) Vitamin D receptor in osteoblasts is a negative regulator of bone mass control. Endocrinology 154:1008-1020

61. Yamauchi M, Yamaguchi T, Kaji H,

Sugimoto T, Chihara K (2005) Involvement of calcium-sensing receptor in osteoblas-tic differentiation of mouse MC3T3-E1 cells. Am J Physiol Endocrinol Metab 288:E608-E616

the effects of vitamin d deficiency on bone structure and ... 6.pdf · vitamin d deficiency results...

Documents