The ABC Transporter Pdr18 is a Determinant of Yeast

Thermo- and Osmo- Tolerance: underlying mechanisms

and biotechnological implications

Rute Isabel Ribeiro Costa

Thesis to obtain the Master of Science Degree in

Biotechnology

Supervisor

Dr. Cláudia Sofia Pires Godinho

Prof. Dr. Isabel Maria de Sá-Correia Leite de Almeida

Examination Committee

Chairperson

Prof. Dr. Nuno Gonçalo Pereira Mira

Supervisor

Dr. Cláudia Sofia Pires Godinho

Member of the Committee

Prof. Dr. Miguel Nobre Parreira Cacho Teixeira

October 2019

i

Preface

The work presented in this thesis was performed at the Institute for Bioengineering and Biosciences of

Instituto Superior Técnico (Lisbon, Portugal), during the period February-October 2019, under the

supervision of Dr. Cláudia Godinho and Prof. Dr. Isabel Sá-Correia.

ii

Declaration

I declare that this document is an original work of my own authorship and that it fulfills all the

requirements of the Code of Conduct and Good Practices of the Universidade de Lisboa.

iii

Acknowledgments

I would like to acknowledge my supervisors Prof. Dr. Isabel Sá-Correia, and Dr. Cláudia Godinho for

their guidance during the experimental work and writing of my thesis, which was a key for the completion

of my Master thesis. I would also like to acknowledge Prof. Dr. Isabel Sá-Correia, ashead of the

Biological Sciences Research Group (BSRG) at the Institute for Bioengineering and Biosciences (iBB)

for the opportunity to join the group for one year.

I acknowledge the collaboration of Dr. Margarida Palma in performing the glucose uptake assays and

for the help and suggestion given during this year.

The work carried out during this Master thesis was financed by FCT ERA-IB2/0003/2015 “Engineering

of the yeast Saccharomyces cerevisiae for bioconversion of pectin-containing agro-industrial side-

streams”. Funding received by iBB from FCT (UID/BIO/04565/2019) is also acknowledged.

The following personal acknowledgements will be addressed in Portuguese.

Quero agradecer à Prof. Isabel Sá-Correia pela oportunidade de integrar a sua equipa e pelo

acompanhamento e transmissão de conhecimento ao longo desta jornada. À minha orientadora,

Cláudia, quero deixar um agradecimento especial pela disponibilidade para ajudar e ouvir as minhas

questões e por, durante este ano, ter sido incansável em aligeirar o que corria menos bem e deixar

uma palavra de incentivo quando mais precisava. Sem toda esta partilha, a conclusão deste documento

não seria possível.

A todos os membros do BSRG agradeço pela amabilidade com que me receberam e me fizeram sentir

que estava em casa no piso 6. A todos os companheiros do 6.6.13 agradeço por terem proporcionado

um ambiente agradável para se trabalhar, repleto de amizade e bom humor. Ao Luís e à Margarida

quero deixar um agradecimento especial, por estarem sempre dispostos a ajudar no brainstorming

quando as coisas menos faziam sentido.

Aos meus colegas de mestrado, agradeço pela amizade ao longo destes dois anos. Deixo um obrigada

especial à Inês pela capacidade de me estender a mão quando mais precisei, não só ao longo destes

dois anos, mas ao longo de toda a jornada académica, obrigada por seres incrível!

Aos que nada têm a ver com o técnico, obrigada pelo carinho e por compreenderem as longas

ausências. Um agradecimento forte ao Marcelo por ser o meu suporte, por ter partilhado todo o meu

entusiasmo e lidado com o desespero. Obrigada por saberes sempre o que dizer e por me fazeres

acreditar que sou capaz, mesmo quando mais parece impossível.

Finalmente, quero agradecer à minha mãe, ao meu pai e irmã, por todo o amor e por tornarem

diariamente a minha vida mais simples. Obrigada por me acompanharem no meu crescimento e

partilharem as minhas vitórias, mas, principalmente por me apoiarem nas derrotas e por me fazerem

acreditar que sou capaz de muito mais do que julgo.

iv

Abstract

The productivity of alcoholic fermentation depends on Saccharomyces cerevisiae tolerance to multiple

stresses. Among multi-tolerance determinants is the Pleiotropic Drug Resistance (PDR) family of

plasma membrane transporters. The susceptibility of single deletion mutants for yeast PDR transporters

towards several industrially-relevant stresses was compared and Pdr18 identified as a determinant of

yeast thermo- and osmo-tolerance, extending the range of stresses towards which PDR18 is a tolerance

determinant. PDR18 expression was found to be required for maximum ethanol titers from 300 g/L

glucose, alleviating the viability loss observed at the beginning of fermentation. Ergosterol biosynthetic

genes were found to be transcriptionally activated in the susceptible pdr18Δ cells at 40ºC (2.1-3.5-fold)

and during of 300 g/L glucose fermentation (3.3-6.7-fold), when compared with 20 g/L glucose at 30ºC.

Surprisingly, during 300 g/L glucose fermentation at 30ºC, pdr18Δ exhibited higher fermentation rate

than the parental strain when glucose decreased to concentrations in the range 50-180 g/L and the

ethanol produced was below 15 % (v/v). These cells were found to exhibit an increased Vmax for glucose

uptake in the mutant compared with the parental strain (3.60 versus 2.46 μmol/h/108 cells), while the

affinity for glucose was higher in cells expressing PDR18. The observed differences in glucose transport

kinetic constants are likely related to the expected differences occurring in plasma membrane ergosterol

content. This study increases our understanding on the physiological role of Pdr18 in yeast thermo- and

osmo- tolerance and relation with the regulation of ergosterol biosynthesis and activity of plasma

membrane embedded hexose transporters.

Key words: Saccharomyces cerevisiae; ATP-binding cassette (ABC) transporters; PDR transporters;

Multidrug/multixenobiotic resistance (MDR/MXR); Pdr18, Very high gravity (VHG) fermentation,

Ergosterol biosynthesis, Yeast thermo- and osmo- tolerance.

v

Resumo

A produtividade da fermentação alcoólica por Saccharomyces cerevisiae depende da sua tolerância a

múltiplos stresses. Os transportadores da membrana plasmática da família PDR encontram-se entre

os determinantes de multi-tolerância. A suscetibilidade a diversos stresses com relevância industrial de

mutantes em que genes que codificam transportadores PDR foram individualmente eliminados foi

examinada e o Pdr18 identificado como determinante de termo- e osmo-tolerância, estendendo a lista

de stresses para os quais Pdr18 é um determinante de tolerância. A expressão de PDR18 foi necessária

para uma máxima produção de etanol de 300 g/L glucose, reduzindo a perda de viabilidade observada

no início das fermentações. Em células pdr18Δ, foi detetada a ativação da transcrição de genes da via

de biossíntese de ergosterol a 40ºC (2.1-3.5 vezes) e durante a fermentação de 300 g/L glucose (3.3-

6.7 vezes), comparando com fermentações de 20 g/L a 30ºC. Durante a fermentação de 300 g/L

glucose a 30ºC, o mutante pdr18Δ mostrou taxas de fermentações mais elevadas do que a estirpe

parental, quando a glucose desceu para valores entre 50-180 g/L e a produção de etanol não

ultrapassou 15 % (v/v). Estas células apresentaram valores de Vmax de transporte de glucose superiores

à estirpe parental (3.60 face a 2.46 μmol/h/108 células) o que está, presumivelmente, relacionado com

os diferentes níveis de ergosterol na membrana plasmática. Este trabalho contribui para a compreensão

do papel fisiológico do Pdr18 na termo- e osmo-tolerância da levedura e sua relação com a ativação da

via biossíntética de ergosterol e atividade dos transportadores de hexoses.

Palavras-chave: Saccharomyces cerevisiae; Transportadores ABC; Transportadores PDR;

Resistência a múltiplas drogas e xenobióticos (MDR/MXR); Pdr18, Fermentações de gravidade muito

elevada (VHG); Biossíntese de ergosterol; Termo- e osmo- tolerância.

vi

Table of Contents

1. Motivation and thesis outline ........................................................................................................... 1

2. Introduction ...................................................................................................................................... 4

2.1. Saccharomyces cerevisiae as a biotechnological tool ............................................................ 4

2.1.1. S. cerevisiae relevance in Biotechnology and as a model eukaryote ............................. 4

2.1.2. S. cerevisiae as a Microbial Cell Factory for Bioethanol production ............................... 4

2.2. Saccharomyces cerevisiae plasma membrane lipid composition and organization ............... 7

2.2.1. Yeast plasma membrane as a target for stress-induced damage during industrially

relevant stresses ............................................................................................................................. 9

2.3. Stress induced by growth at supra-optimal temperature and high osmotic pressure in yeast

cells….. .............................................................................................................................................. 10

2.3.1. Mechanisms and transcriptional regulation of S. cerevisiae response to heat stress ... 10

2.3.2. Mechanisms and transcriptional regulation of S. cerevisiae response to osmotic

stress…… ...................................................................................................................................... 11

2.4. The ABC superfamily of transporters involved in multidrug/multixenobiotic (MDR/MXR)

phenomenon ...................................................................................................................................... 13

2.4.1. The ABC superfamily of transporters in yeast ............................................................... 13

2.4.2. The role of ABCG/PDR family of transporters in lipid homeostasis and MDR/MXR ..... 15

2.4.3. Pdr18 transporter role in yeast tolerance to multiple stresses ...................................... 17

2.4.4. The complex regulatory network behind ABCG/PDR transporters activation in yeast

stress response ............................................................................................................................. 18

3. Materials and Methods .................................................................................................................. 20

3.1. Strains, Media, and Inocula preparation ................................................................................ 20

3.2. Susceptibility analysis by spot assays ................................................................................... 20

3.3. Fermentation conditions ........................................................................................................ 21

3.4. Yeast cell viability .................................................................................................................. 21

3.5. HPLC analyses ...................................................................................................................... 21

3.6. Glucose Transport Assays .................................................................................................... 22

3.7. Transcription analysis of ERG-genes .................................................................................. 22

3.7.1. mRNA extraction............................................................................................................ 22

3.7.2. RT-PCR ......................................................................................................................... 23

4. Results ........................................................................................................................................... 25

4.1. Pdr18 is an important determinant of yeast thermo- and osmo- tolerance ........................... 25

vii

4.2. Pdr18 expression improves yeast performance under fermentation at a supra-optimal

temperature and high osmotic pressure ............................................................................................ 28

4.3. Effect of PDR18 expression in ergosterol biosynthetic genes transcription levels under supra-

optimal temperature or osmotic stress .............................................................................................. 32

4.4. The absence of PDR18 expression leads to higher glucose uptake rate in the presence of

high glucose concentrations .............................................................................................................. 34

5. Discussion ..................................................................................................................................... 36

6. Concluding Remarks ..................................................................................................................... 43

7. References .................................................................................................................................... 45

viii

List of Figures

Figure 1.1. List of compounds to which Pdr18 confers improved tolerance in yeast .............................. 2

Figure 2.1. Scheme showing the several stresses faced by yeast cells during bioethanol production

fermentation ............................................................................................................................................. 6

Figure 2.2. Schematic representation of the ergosterol biosynthetic pathway as well as the main

transcriptional regulators ......................................................................................................................... 8

Figure 2.3. Hog signaling pathway in yeast .......................................................................................... 12

Figure 2.4. Yeast PDR transporters’ localization, physiological function (when documented) and role in

MDR/MXR (when documented it is represented the classes of compounds) ....................................... 15

Figure 2.5. Schematic representation of the hypothesized biological function of Pdr18 in counteracting

plasma membrane decreased order and increased permeability induced by membrane-active

compounds (acetic acid and ethanol) and consequently restriction of the diffusional uptake rate of

toxic compounds .................................................................................................................................... 17

Figure 2.6. Transcription factors regulating the expression of S. cerevisiae PDR plasma membrane

transporters genes under stress conditions .......................................................................................... 18

Figure 4.1. Comparison of the susceptibility of deletion mutants in PDR transporters and of the

parental strain S. cerevisiae BY4741 towards industrially-relevant stresses in rich media by spot

assays .................................................................................................................................................... 26

Figure 4.2. Susceptibility of the parental and pdr18Δ strains to hyperosmotic and thermal shock....... 27

Figure 4.3. Fermentations in YP media supplemented with 20 or 300 g/L of glucose, carried out at 30

and 40ºC, by parental or pdr18∆ strains ............................................................................................... 29

Figure 4.4. Fermentations in YP media supplemented with 300 g/L of glucose, carried out at 30 and

40ºC, by parental or pdr18∆ strains ...................................................................................................... 30

Figure 4.5. Levels of mRNA from ergosterol biosynthetic pathway genes (ERG13, ERG9, ERG11,

ERG25, ERG3) during cultivation under fermentation of 300 g/L and 20 g/L glucose at 30ºC and 20

g/L glucose at 40ºC ............................................................................................................................... 33

Figure 4.6. Michaelis-Menten plots of glucose uptake rates for parental strain and pdr18∆ cells during

fermentation under 20 and 300 g/L glucose at 30ºC ............................................................................. 35

Figure 5.1. Venn diagram built using YEASTRACT database to identify putative regulators of PDR18

and ERG genes in the presence of heat and/or high sugar-induced stress ......................................... 39

Figure 6.2. Scheme of the hypothesized involvement of Pdr18 and ergosterol biosynthesis in yeast cell

response to supra-optimal temperatures and osmotic stress ............................................................... 41

ix

List of Tables

Table 3.1. Conditions tested by spot assays to assess yeast parental and deletion mutant strains

susceptibility to industrially-relevant stresses........................................................................................ 21

Table 3.2. PCR settings for reverse transcription reaction. ................................................................... 23

Table 3.3. Sequences of the primers used for RT-PCR. ....................................................................... 24

Table 3.4. PCR settings for RT-PCR reaction. ...................................................................................... 24

Table 4.1. Michaelis-Menten kinetic parameters Km and Vmax of glucose uptake rates for parental and

pdr18∆ strains cells during fermentation under 20 and 300 g/L glucose at 30ºC ................................. 35

x

List of abbreviations

2,4-D 2,4-dichlorophenoxyacetic acid

ABC ATP-binding Cassette

ATP Adenosine triphosphate

BSRG Biological Sciences Research Group

cDNA Complementary DNA

CFU Colony Forming Unit

CT Threshold Cycle

DNA Desoxyribonucleic acid

DRM Detergent-Resistant Membrane

EC Enzyme Comission Number

EDTA Ethylenediaminetetraacetic Acid

ERG Ergosterol biosynthetic pathway

GFP Green Fluorescence Protein

HMF 5-(hydroxymethyl)furfural

HOG High Osmolarity Glycerol

HPLC High-performance liquid chromatography

HSF Heat-Shock Factor

HSP Heat-Shock Protein

HSR Heat-Shock Response

HUGO Human Genome Organization

HXT Hexose transporters

iBB Institute Bioengineering and Biosciences

MCPA 2-methyl-4-chlorophenoxyaceticacid

MFS Major Facilitator Superfamily

MDR/MXR Multidrug Resistance/Multixenobiotic Resistance

NAC No Amplification Control

NBD Nucleotide Binding Domain

NTC No Template Control

OD600nm Optical Density at 600 nm

PCR Polymerase Chain Reaction

PDR Pleiotropic Drug Resistance

PDRE Pdr1/Pdr3-Responsive Element

xi

RNA Ribonucleic acid

rpm Rotation per minute

RT-PCR Real-time Reverse Transcription-PCR

S. cerevisiae Saccharomyces cerevisiae

SGD Saccharomyces cerevisiae Genome Database

STRE Stress Responsive Element

TMD Transmembrane Binding Domain

TMS Transmembrane Spanning Domain

VHG Very High Gravity

YPD Yeast Peptone Dextrose

YRE Yap Responsive Element

1

1. Motivation and thesis outline

Yeast cell plasma membrane is, together with the cell wall, the first barrier of defense of the cell from

the ever-changing conditions of the outside environment. Consequently, plasma membrane is a primary

target for environmental stress damage and its homeostasis is extremely important for yeast cell survival

in challenging conditions. Therefore, its composition and organization are tightly regulated to ensure the

protection of the cell and a suitable environment for the localization and activity of embedded proteins.

These proteins are responsible for physiological functions such as nutrient uptake, sensing of

environmental changes and respective signal transduction, and toxic compounds extrusion1. These

membrane-embedded proteins include members of the ATP-binding cassette (ABC) superfamily of

transporters which are a hot topic of research. They have been for long associated with the

multidrug/multixenobiotic resistance (MDR/MXR) phenomenon, which can be defined as the

simultaneous acquisition of resistance to a wide range of unrelated toxic compounds2,3. The ABCG/PDR

family is the most studied ABC family and is generally associated with pleiotropic drug resistance, and

therefore its members are commonly referred to as PDR transporters4,5. These transporters have been

proposed to mediate the extrusion of a large spectrum of functionally and structurally unrelated

compounds and even substrates that are not present in the natural environment of the cell6. It is

suggested that their action alters the compounds partition across the plasma membrane, reducing their

toxicity5. More recently, several ABC transporters, including members of the PDR family, have been

associated with maintenance of plasma membrane lipid homeostasis, impacting membrane potential

and fluidity, which have been suggested to consequently influence the passive diffusion and/or action

of cytotoxic compounds7. Therefore, it is expected that the role of these transporters in MDR/MXR is

also a consequence of their physiological function in the cell, and not only through direct export of the

toxic compounds8. Given this, it is possible to identify an interplay between the membrane and some

embedded-proteins since, the membrane environment is essential to regulate the activity of the

membrane transporters and, in turn, some of these transporters are responsible for the regulation of

plasma membrane lipidic environment and, consequently, its properties.

Although on one side, the MDR/MXR phenomenon in pathogenic yeasts can be deleterious to public

human health since it can allow pathogenic microorganisms to surpass multiple chemical treatments,

on the other side, it provides yeast cells with great robustness towards the highly toxic environment of

industrial bioprocesses. The research group led by Professor Isabel Sá-Correia at the Biological

Sciences Research Group (BSRG) of the Institute of Bioengineering and Biosciences (iBB) has been

focused, among other topics, on the study of MDR/MXR transporters, in particular, ABC transporters

and their involvement in the MDR/MXR phenomenon. Great attention has been given to the Pdr18

transporter, from the ABCG/PDR family, which interest lies in its contribution to confer yeast with

improved tolerance to an extensive wide range of structurally and functionally unrelated chemicals stress

agents such as herbicides, agricultural and clinical fungicides, metal cations, anticancer drugs, weak

acids and alcohols that are described in detail in Figure 1.19–14. Interestingly, a study from our group

shows that from a set of 21 genes encoding MDR/MXR transporters from the ABC superfamily and

Major Facilitator Superfamily (MFS), in S. cerevisiae, only PDR18 gene was found to confer resistance

2

to growth inhibitory concentrations of ethanol14. Given this, the Pdr18 transporter reveals as a

determinant player during yeast industrial fermentation due to is involvement in tolerance to stress of

industrial relevance. Previous studies from our laboratory proposed that Pdr18 is involved in ergosterol

transport at the plasma membrane level. Ergosterol is the main sterol in yeast plasma membrane and

has an important role in its integrity, modulating properties such as permeability, rigidity, and order.

Plasma membrane ergosterol content is also essential for membrane microdomain formation and,

therefore, for correct localization and activity of embedded plasma membrane proteins15. In the absence

of Pdr18, yeast plasma membrane exhibits lower ergosterol content which results in decreased order

and increased permeability9. Given this, it is proposed that the Pdr18 transporter counteracts the

decreasing in plasma membrane ergosterol content induced by stresses such as acetic acid and 2,4-

D9–11. Additionally, in the presence of acetic acid induced stress, it was observed that some genes of

the ergosterol biosynthetic pathway (ERG genes) and also the PDR18 gene are coordinately

transcriptionally up-regulated. This finding supports the idea that Pdr18 involvement in MDR/MXR

results from its physiological role of ergosterol transport and further suggests an interplay between

ergosterol biosynthesis and Pdr18, under acetic acid stress9.

Figure 1.1. List of compounds to which Pdr18 confers improved tolerance in yeast. The list is based on the

literature available at the time of this thesis’ publication.

Given the biotechnological importance of the yeast Saccharomyces cerevisiae as a microbial cell

factory, there is an urgent need to develop new and improved yeast strains for sustainable industrial

bioprocesses that can cope with the harsh industrial environments. A common approach to reach more

robust strains is through genetic engineering of genes involved in cell response and tolerance to

industrially-relevant stresses. The involvement of PDR transporters in MDR/MXR makes them a good

target for genetic manipulation. However, to identify targets for yeast genome manipulation, it is

important to understand their role under the various industrial toxic environments. Given this, in this

work, S. cerevisiae deletion mutants for the PDR genes were screened for several industrially-relevant

stresses (toxic concentrations of ethanol, acetic acid, furfural and, 5-(hydroxymethyl)furfural, and

3

osmotic and heat stresses) and the Pdr18 transporter was identified as the most interesting, among the

conditions tested. In this screening, Pdr18 was unveiled as a determinant for tolerance to growth at

supra-optimal temperatures and osmotic stress and we further tested the relevance of this transporter

in yeast fermentative performance under conditions mimicking very high gravity (VHG) fermentation.

For that, parental and pdr18Δ strains were examined under fermentation of 20 g/L and 300 g/L glucose,

both at 30ºC and 40ºC. Growth and fermentative performance were assessed by following optical

density, cell viability, glucose consumption, and ethanol production. It was observed that under 300 g/L

glucose at 40ºC, the fermentative performance of the two strains was deeply affected, and this is more

dramatic for the pdr18Δ deletion mutant performance. During fermentation carried with 300 g/L glucose

at 30ºC, the pdr18Δ strain showed an extended lag phase and viability loss at the beginning of the

fermentation, compared with the parental strain, as it had been observed previously. However, there

was an intermediary fermentation stage in which the pdr18Δ strain showed a higher fermentative rate

than the parental strain. The present work was devoted to understanding the underlying mechanisms

for the higher susceptibility of the pdr18Δ mutant under fermentation of 300 g/L glucose at 30ºC, and

the mechanisms by which pdr18Δ strain exhibits higher fermentation rate during a range of glucose

concentration of 50-180 g/L and ethanol of 4-15 % (v/v)9,11. For that, we investigated transcription levels

of several ERG genes of both parental and pdr18Δ strain at fermentation of 20 g/L and 300 g/L at 30ºC.

Furthermore, we examined the kinetic parameters for glucose uptake in the dependence of PDR18

expression and fermentation conditions.

4

2. Introduction

2.1. Saccharomyces cerevisiae as a biotechnological tool

2.1.1. S. cerevisiae relevance in biotechnology and as a model eukaryote

The yeast Saccharomyces cerevisiae has a high biotechnological interest. This yeast is used since

ancient times, even before the understanding of the mechanisms underlying fermentation, to produce

bread and alcoholic beverages such as wine and beer. Over time, the knowledge gathered about the

biological, physiological and metabolic pathways of this yeast enables the increased exploitation of the

yeast fermentation capacity and enlargement of the commercially-relevant products derived from yeast

activity16.

S. cerevisiae is also a eukaryote model organism, widely used in research due to the high degree of

conservation of protein functions and essential pathways to those of higher eukaryotes. Among these

conserved mechanisms are those underlying toxicity, adaptation, and resistance to environmental

changes8,17,18. The key driver for the use of this yeast species as a model organism was the sequencing

of its genome, back in 199619, which allowed gene annotation and boosted further studies comprising

global genomic analysis. Even in the present time, in which the advances in sequencing techniques

allowed the release of genome sequences from more complex eukaryotes, the use of the yeast model

still represents an advantage, mainly because of the databases, tools and biological material available

to facilitate the gathering and interpretation of the obtained data20. There are well-curated databases

easily accessible to the yeast research community, such as the Saccharomyces cerevisiae Genome

Database (SGD) and YEASTRACT available at www.yeastgenome.com21 and www.yeastract.com22,

respectively. Among others, there are collections of plasmids for deletion mutant complementation and

protein overexpression23; a collection of strains with each individual gene fused with a GFP tag, for

protein localization studies24; and a collection of single deletion mutants for each non-essential gene,

called yeast disruptome25. This last collection eases the task of performing genome-wide

toxicogenomics analysis, used to a great extent to identify genetic determinants of yeast tolerance to a

given stress.

2.1.2. S. cerevisiae as a Microbial Cell Factory for bioethanol production

The current dependence on oil-based plants for the production of bulk chemicals has major drawbacks

such as the non-renewable nature of petroleum and the contribution to the accumulation of greenhouse

gases that contributes to worsen the global warming problem. Therefore, biobased industries are

emerging as alternatives, aiming to reach a sustainable economic growth26. The success and

implementation of protocols of this nature rely on the efficiency of the industrial strains used to become

microbial cell factories and produce bio-based economically-valuable products under the harsh

industrial conditions. S. cerevisiae is greatly exploited for this purpose since it is generally recognized

as safe (GRAS), has fast and inexpensive growth, a very efficient fermentation performance, and innate

robustness towards some industrially relevant stresses. Bioethanol is exploited since ancient times for

alcoholic beverages and great attention was drawn to its use as biofuel, due to the urgent need to reduce

5

the dependency on fossil fuels especially for electricity, heating, and transportation16. Currently, the

purification of bioethanol from yeast fermentation broth is mainly achieved through distillation and

accounts for highly energetic costs. Huang, W., et al. (2011) show a decrease in separation costs with

increasing concentration of ethanol in the fermentation broth, especially when ethanol titers are lower

than 4 % (w/w)27. Therefore, to turn bioethanol production more efficient and competitive, it is essential

to reach high and toxic concentrations of ethanol produced, which is a harsh environment for the yeast

cells. USA and Brazil are currently the main producers of bioethanol from yeast fermentation, holding

85 % of the world production, but the market is growing in China, Thailand and in the EU28.

The production of bioethanol for biofuel is classified depending on the type of feedstock used in the

process. First-generation bioethanol is produced from edible feedstocks such as sugar cane or

hydrolyzed corn starch29. The major drawback of relying on edible feedstocks is the competition with

food production for water and arable land. It also negatively impacts on the environment, particularly

through deforestation, contribution to resource depletion such as soil and water degradation due to over-

fertilization. Second-generation bioethanol arose to overcome these limitations and relies on abundantly

available substrates such as cheap agricultural and forestry residues in the form of lignocellulose

biomass, as well as fast-growing energy crops as feedstocks29. However, second-generation bioethanol

production from lignocellulosic material represents a challenge since this feedstock is mostly composed

of cellulose, hemicelluloses, and lignin that form a robust and recalcitrant structure and, therefore, needs

to suffer a pre-treatment for sugar release29. The pre-treatments required for this type of waste result in

the production of toxic compounds like acetic acid, furfural (which can originate in formic acid30) and 5-

hydroxymethylfurfural (HMF) (can originate in formic and levulinic acids31). These furans are toxic to

yeast cells, inhibiting the activity of alcohol dehydrogenase (EC 1.1.1.1) as well as of glycolytic enzymes

such as hexokinase (EC 2.7.1.1) and glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12), and

also cause depletion of NAD(P)H in cells, through the reduction of furans to the respective acids32,33.

The presence of this mixture of inhibitory sub-products results in a highly toxic environment for the yeast

cells, leading to inhibition of growth and fermentation performance, which is a challenging reality to the

manufacturers34. Third-generation bioethanol relies on microalgae as feedstock. This process aims to

utilize industrial waste streams to produce microalgae biomass which, in turn, would be used as

feedstock for bioethanol production. These waste streams include effluent gases from industrial power

plants, wastewater, products of hydrolysis of organic waste and digestate, from which microalgae can

retrieve nutrients. Bioethanol from algal biomass is obtained from the fermentation of starch and starch-

like polysaccharides which are extracted from reservoirs of this microalgae, under anaerobic

conditions35. Given this, third-generation biofuels represent a way to minimize and add economic value

to waste streams from many industries. However, the production of third-generation bioethanol is still at

an early stage and more research and development are required to improve microalgae biomass

production and harvesting processes, in order to reach an economically and environmentally viable

processes28.

Yeasts used as microbial cell factories face several challenges related to the fermentation environment

namely due to the conditions of the process and toxicity of fermentation end and by-products. Some

6

end products can be toxic to the cell, especially when accumulated in the high titters necessary for an

industrial process to reach economic viability, as is the case of bioethanol production and the

accumulation of by-products during fermentation, e.g. weak acids, impairs essential metabolic functions

and contributes to decreased productivity36,37. Moreover, fermentation is an exergonic process that leads

to an increase in temperature in the fermentation media that may reach values above 40ºC, while the

optimal temperature for S. cerevisiae fermentation is 30-37ºC38,39. Additionally, in the presence of toxic

compounds, S. cerevisiae cells suffer a shift in the optimal and maximal temperatures to lower values.

In the case of ethanol, this shift is observed with only 3 % (w/v) ethanol and, when concentrations reach

6 % (w/v) ethanol the optimal temperature decreases about 12°C and the maximum temperature for

growth decreased about 8ºC40. This fact forces companies to expend considerable amounts of money

in refrigerated systems, which increases the costs associated with the protocols that rely on yeast

fermentative performance and hinders its implementation and/or optimization in industrial plants.

Another stress factor that leads to the decreased fermentative performance is the high osmotic pressure

to which yeast cells are subjected to fermentation of very high sugar concentrations. This is especially

relevant in fermentations using very high gravity (VHG) technology, which aims to produce very high

titers of ethanol [up to 18 % (v/v)] from at least 250 g/L of glucose39.

Figure 2.1. Scheme showing the several stresses faced by yeast cells during bioethanol production fermentation. Yeast fermentation for bioethanol production is hindered by the composition of the feedstock since it can contain high sugar concentrations that lead to osmotic pressure. The fermentation process is exergonic, leading to an increase in temperature which limits S. cerevisiae growth fermentation and even viability, depending on the level of stress. The increasing concentration of ethanol and the formation of by-product, together with the

previously mentioned stress factors, induce stress in the cell and can lead to stuck or sluggish fermentations.

Although S. cerevisiae is an important microbial cell factory especially for bioethanol production, the use

of this yeast species also has some limitations associated with its susceptibility to the stressors present

during the fermentation process and the temperature range in which S. cerevisiae is able to conduct

successful fermentation of feedstocks in the presence of multiple inhibitors. This limitation drove the

attention of researchers to the search for non-conventional yeasts since they present attractive

alternative features related with higher tolerance under extremely severe conditions. The yeast

7

Kluyveromyces marxianus, for instance, is able to grow under high temperatures, up to 52ºC, tolerating

dramatic heat-shocks and oscillations in temperatures41,42. In turn, the yeast species

Zygosaccharomyces bailli and Zygosaccharomyces rouxii have drawn the attention of researches due

to its tolerance to weak acids and osmotolerance, respectively43,44. Therefore, exploring non-

conventional yeast species is interesting to investigate the mechanisms underlying their tolerance and

also to identify target genes and pathways that could be used for further improvement of S. cerevisiae

industrial strains41,43.

2.2. Saccharomyces cerevisiae plasma membrane lipid composition and

organization

The yeast plasma membrane composition and organization are determinant for yeast cells’ tolerance to

the ever-changing environmental conditions, considering that the plasma membrane is not only an

essential physical barrier between the cell interior and the external environment but also home for a

huge number of biological processes that include, among others, the transport of compounds, the uptake

of nutrients, export of toxic metabolites and signal transduction sensors1.

Plasma membrane composition is dependent on the synthesis, trafficking, and recycling and/or

degradation of the lipid species present in yeast: glycerophospholipids, sphingolipids, and sterols. It has

a complex and dynamic structure and, since the classical model proposed by Singer and Nicolson- the

fluid mosaic model45 - the knowledge gathered about its complexity has evolved a long way. This model

states that both lipids and membrane-embedded proteins moved unrestrictedly within the plane of the

membrane. However, now it is known that membrane lipids are asymmetrically distributed across the

bilayer and that glycerophospholipids do not spontaneously exchange between the two membrane

layers at a physiologically-relevant rate46. Instead, the movement is rather regulated by lipid-

translocating enzymes called flippase (movement towards the inner layer) and floppase (movement

towards the outer layer)47,48. Plasma membrane asymmetry is verified not only between the two

membrane leaflets but also within the plane of the membrane, by the formation of more and less

condensed microdomains46. Lipid rafts are condensed microdomains enriched in sterols and

sphingolipids in which the acyl chains are relatively long and highly saturated, allowing close packing49.

Specific proteins are presumed to preferentially localize in these microdomains, proving the role of this

membrane asymmetry in protein sorting, secretion, endocytosis, and cell polarity15,46.

Through their interactions with phospholipids and sphingolipids, sterols are important structural

molecules of the yeast plasma membrane50 and this literature review on plasma membrane lipids will

focus mainly on sterols considering the scope of this thesis work. Ergosterol is the main sterol in yeast

and has an important role in plasma membrane integrity. It has been observed that different membrane

sterols confer plasma membrane distinct properties such as the tensile properties, phase separation,

and the curvature of the liquid-ordered phase in membranes which influences yeast tolerance to stress50.

Ergosterol is the final product of a complex multistep biosynthesis pathway that is tightly regulated. The

Ecm22 and Ucp2 are zinc finger transcription factors associated with ergosterol biosynthesis regulation

by binding to the promoters of ergosterol biosynthesis genes (ERG genes). Furthermore, these

8

transcription factors also bind to the promoters of sterol uptake genes (PDR11 and AUS1) under sterol

depletion and anaerobiosis. Yang et al. (2015) demonstrated that Upc2 C-terminal binds ergosterol in

the cell membranes51. Low ergosterol levels result in Upc2 in the free state, in which it relocates from

the cytosol to the nucleus for transcriptional activation of ergosterol biosynthesis51. In contrast, the

mechanism of activation of the transcription factor Ecm22 is still unknown51. Yeast cells cannot degrade

sterols and its excessive accumulation can be toxic to the cells. Therefore, high levels of sterols are

alleviated through esterification regulated by the two acetyltransferases Are1 and Are252. These

esterified sterols are stored as lipid droplets that can be re-converted in free sterols by the action of one

of the three hydrolases Yeh1, Yeh2, and Tgl153. The yeast modulation of sterol levels is also regulated

by the transcription factors Mot3 and Rox1 which repress the expression of some ERG genes under

hypoxic conditions54. Additionally, under anaerobiosis conditions, the Mot3 transcription factor activates

the gene expression of the two ABC membrane transporters Pdr11 and Aus1 which are responsible for

sterol uptake from the extracellular media to the cell55.

Figure 2.2. Schematic representation of the ergosterol biosynthetic pathway as well as the main transcriptional regulators. Ecm22 and Upc2 are two transcription factors that activate the pathway for ergosterol production and Upc2 is sensitive to absence of ergosterol in the plasma membrane. Mot3 and Rox1 and transcription factors that repress the expression of the pathway for ergosterol biosynthesis and are activated in

anaerobic conditions.

Proteins are also important components of the yeast plasma membrane. Plasma-membrane associated

proteins can be either adjacent or embedded in the membrane and play a vast range of physiological

functions, such as nutrient transport, ion export/import, drug efflux, and stress response. Among the

9

most important classes of proteins are those belonging to the ATP-binding cassette superfamily of

transporters, which will be further discussed in Section 2.4.

2.2.1. Yeast plasma membrane as a target for stress-induced damage during industrially

relevant stresses

The mechanisms involved in membrane homeostasis are essential to maintain the physiology of the

cell, the performance of vital processes and cell response to different environmental stresses56. Most

industrially relevant stresses to which yeast cells are exposed can cause alterations in the physical

properties of the yeast plasma membrane, namely resulting in increased membrane fluidity. The packing

of the yeast plasma membrane lipids can assume three different forms, depending on the membrane

lipids’ phase: the crystalline lamellar (Lc), the fluid lamellar gel (Lβ) and lamellar liquid–crystalline or fluid

lamellar (Lα)57. There is a temperature dependency associated with each phase and the phase transition

temperature (Tm) represents the temperature at which there are as many phospholipids in the fluid state

as in the rigid state58. However, temperatures above the Tm leads phospholipids to the Lα phase and

temperatures below the Tm to the Lβ phase. Moreover, when the temperature exceeds the physiological

range, that is, when cells face heat stress, lipids change conformation which results in a loss of plasma

membrane integrity59. Additionally, osmotic stress has also been linked with changes in the yeast plasma

membrane60. Laroche, C. et al. (2001) show that osmotic stress can influence the Tm and, therefore, it

is possible to represent membrane fluidity as a function of temperature and osmotic pressure58.

It has been well-described that heat and ethanol stresses cause similar changes in the plasma

membrane composition, and therefore affecting membrane-associated processes61. The effect of

ethanol stress in the plasma membrane is dependent on the content of unsaturated and saturated fatty

acids and ergosterol. In membranes with high content in unsaturated lipids and low ergosterol content,

ethanol reduces the interfacial tension in a concentration-dependent manner, which results in

progressive bilayer thinning and lateral expansion. However, in more rigid membranes, with a higher

content of saturated lipids and ergosterol, there is little structure change62.

These changes in membrane properties caused by the different stresses result in higher permeability

and, therefore, uncontrolled traffic of small molecules across the membrane, including ethanol63. It is

also observed a disruption in the function of membrane-associated proteins, due to the alterations in

their lipid environment, such as receptors, ion channels, and enzymes. The ATPases are embedded

membrane enzymes which are among the affected plasma membrane proteins. ATPases are essential

to maintain the electrochemical potential across the plasma membrane64 and the disruption of these

proteins activity result in the dissipation of this potential and, consequently, disrupted nutrient uptake

through active transport65.

Under industrial fermentation, yeast cells face these membrane disrupting stresses and, therefore, the

plasma membrane is highly affected throughout the fermentation process. In this scenario

understanding the yeast plasma membrane homeostasis and response to the different stresses is of

extreme importance. Therefore, the plasma membrane can be a strategic target to achieve more robust

strains since it is a common target for damage during stress and the plasma membrane homeostasis is

a determinant for yeast survival.

10

2.3. Stress induced by growth at supra-optimal temperature and high osmotic

pressure in yeast cells

2.3.1. Mechanisms and transcriptional regulation of S. cerevisiae response to

heat stress

Saccharomyces cerevisiae exhibits optimal growth between 30° and 37°C and, at higher temperatures,

yeast cells start to sense the stress stimuli and activate a protective transcriptional program, the heat

shock response (HSR). S. cerevisiae cells can maintain growth at temperatures up to 42°C, however, it

is unable to cope with chronic exposure to higher temperatures, in fact, yeast RNA polymerase II is

inactive at temperatures above 42°C66. Thermotolerance is a highly desired feature of industrial yeast

strains. Increasing tolerance of yeast strains to higher temperatures would improve the fermentative

performance and sustainability since the induced yeast tolerance could lead to increased ethanol titers

and decreased refrigeration costs.

Heat stress disturbs the yeast plasma membrane by increasing its fluidity, permeability and,

consequently, adversely affect membrane-associated processes61. Additionally, high temperatures also

negatively influence the stability of proteins and cytoskeleton structures, resulting in protein malfunction

and ultimately may lead to cell death67. Therefore, due to the emerging necessity of maintaining protein

stability, the induction of Heat Shock Proteins (HSP), under the control of Heat Shock Factor 1 (Hsf1)

and Msn2/Msn4 transcription factors, plays a major role in the yeast HSR. Msn2 and Msn4 are general

stress response transcription factors known to regulate the expression of about 200 genes in response

to different stresses by recognizing STRE (stress response element) in the target genes’ promoter and

are presumably essential for long-term survival at high temperatures66. Heat shock proteins are

evolutionarily conserved proteins that function as molecular chaperones to assist the folding of newly

synthesized proteins, the refolding of misfolded proteins, and the disaggregation of protein aggregates67.

Although HSP are determinant in the subject of thermotolerance, there are other mechanisms to

maintain cell survival under heat stress, namely the synthesis of some compatible solutes such as

trehalose, cell wall remodeling, induction of expression of antioxidant genes in a Yap1-dependent

manner, transient interruption of the cell cycle, stimulation of the H+-ATPase membrane pump, and

increase activity of cytoplasmic catalase T and the mitochondrial manganese form of superoxide

dismutase (MnSOD)69,66,75. Trehalose is a nonreducing disaccharide of glucose and it has been

proposed that it interacts with the polar groups of lipids forming hydrogen bonds, possibly mimicking the

solvation by water molecules68. The transcription of genes encoding enzymes of the trehalose synthesis

pathway (TPS1, TPS2, and NTH1) was shown to be activated by the transcription factors Msn2 and

Msn467. It is proposed that trehalose binds to the unfolded proteins to maintain a partially-folded state

until being refolded by molecular chaperones61. However, while low levels of trehalose are deleterious

under heat-shock conditions, excess of trehalose is also problematic since hyperaccumulation of

trehalose impedes the refolding of proteins that were partially denatured69. Therefore, the regulation of

trehalose synthesis and degradation is essential to recover from heat stress69.

11

Furthermore, the readjustment of plasma membrane composition is essential to maintain homeostasis

and its correct functioning. Yeast counteracts the increased permeability of the membrane caused by

supra-optimal temperatures with changes in membrane lipid composition such as the unsaturation of

the lipids of the cell membranes61. In fact, the degree of lipid saturation and the presence of ergosterol

as modulators of membrane fluidity in the S. cerevisiae plasma membrane were suggested to be

determinant factors to heat stress tolerance, independently of heat shock proteins and trehalose70.

Swan, T. M. et al. (1998) demonstrated that a yeast strain sterol auxotroph is more susceptible to heat

stress than the parental strain and that this phenotype is disposed of if exogenous ergosterol is

supplemented to the media70. Furthermore, chemogenomic studies have identified in S. cerevisiae

several heat stress resistance determinant genes encoding ergosterol biosynthetic enzymes and the

inclusion of that increased content of sterols in the plasma membrane demonstrated to counteract the

deleterious effects of high temperatures70–72. Thus, cell survival to stress induced by supra-optimal

temperatures of growth is highly related to the role of ergosterol as a stabilizer of yeast plasma

membrane, influencing properties such as rigidity, fluidity, and permeability70.

2.3.2. Mechanisms and transcriptional regulation of S. cerevisiae response to

osmotic stress

Hyperosmotic stress can be caused by high solute concentrations in the external medium and it is quite

deleterious under VHG fermentation. During hyperosmotic stress, there is a considerable reduction in

the volume of S. cerevisiae cells, up to 60% within a few milliseconds, and an increase in the cell surface-

to-volume ratio73. This leads to dehydration and serious deformations in the plasma membrane, like

ruffles, wrinkles, surface roughness and changes in the arrangement of membrane lipids that

compromise the integrity and functioning of plasma membrane73. Therefore, yeast cells have a complex

and highly regulated osmotic stress response to counteract the damage suffered and maintain plasma

membrane homeostasis. This osmoregulation monitors and adjusts osmotic pressure for the cell to

control the shape, turgor, and relative water content74. The central mechanism of response and

adaptation of yeast cells to osmotic stress is the High Osmolarity Glycerol (HOG) signaling system. This

is a complex metabolic pathway in which regulation starts with the two redundant, but mechanistically

distinct transmembrane proteins: Sln1 and Sho175. The two have different downstream responses upon

osmotic shock and for yeast cell survival it is only necessary the activation of one of the two branches75.

The pathway activation by the two branches results in Pbs2 activation which, in turn, results in

phosphorylation of the MAP kinase Hog1. Activation of Hog1 results in a substantial fraction of the Hog1

MAPK transported into the nucleus where it regulates gene expression, although there are also targets

in the cytoplasm74. Hog1 dependent transcription includes the transcription factors Sko1, Hot1, Msn2,

Msn4, and Smp1.

The various kinases regulating Hog1 activation allows the system to obtain a “switch-like” behavior in

which it remains unresponsive until a certain threshold. Above the threshold, the amplitude of stimulation

is progressively prolonged approaching a maximum73. Hot1 is a protein that recruits the Hog1p kinase

to target promoters which include GPD1 and GPD2 genes that encode enzymes involved in glycerol

biosynthesis67. Glycerol production is important in osmotic stress response since this metabolite

12

functions as an osmolyte to increase intracellular osmotic pressure67. The Hog1 activation also results

in a rapid closing of the aquaglyceroporin Fps1, which is an exporter of glycerol, and combined with the

basal glycerol production level result in glycerol accumulation. The long-term response of transcription

of enzymes involved in glycerol production is crucial for cell response to osmotic stress and yeast cells

must redirect carbon resources towards enhanced production of glycerol, and thus there is significant

modulation of central carbon metabolism during osmo-adaptation76.

The general stress response transcription factors Msn2 and Msn4, as similarity to the described for heat

stress, also activates the expression of genes of the trehalose synthesis pathway under saline osmotic

stress, as well as osmo-inducible genes include those involved in the protection against oxidative

damage and protein denaturation67,68,77.

Figure 2.3. Hog signaling pathway in yeast. The pathway receptors are activated by osmotic shock and activate a MAP kinase cascade and include complex formation, phosphorylation, and dephosphorylation. This results in the activation of transcription factors that activates the transcription of target genes. This Figure was adapted from Klipp, E. et. al (2006)78.

13

The ERG genes transcription is repressed leading to a decrease of cellular ergosterol levels in a process

dependent on Mot3 and Rox1 transcription factors and Hog1 MAP kinase54. It was suggested that Hog1

activation by osmotic stress targets MOT3 and ROX1 via the Sko1 transcription factor but regulates

mainly Mot3 expression; these transcription factors downregulate the expression of ERG2, ERG11, and

ECM22 genes54. However, Dupont, S. et al. (2010) observed that the deletion mutant for the ERG6 gene

showed increased susceptibility to osmotic stress when compared with the parental strain. This

increased susceptibility of the mutant strain was related to altered plasma membrane composition since

supplementation of the media with ergosterol, under anaerobic conditions, eliminated the erg6∆ strain

susceptibility50. Therefore, the nature of the sterols accumulated at the plasma membrane influences its

deformation and stretching resistance during variations of cell volume caused by hyperosmotic

treatment50. The sterol molecules vary in terms of planar structure, size, and properties of its small polar

3-OH group and these characteristics influence the physical membrane properties. It was observed that

a yeast deletion mutant for ERG6 gene which accumulates mainly zymosterol and cholesta-5,7,24-

trienol in the plasma membrane, is more susceptible to hyperosmotic perturbations than the parental

strain which accumulates mainly ergosterol50.

2.4. The ABC superfamily of transporters involved in

multidrug/multixenobiotic (MDR/MXR) phenomenon

2.4.1. The ABC superfamily of transporters in yeast

The ATP-binding cassette (ABC) transporters are members of one of the largest superfamilies and the

focus of several studies due to their large range of functions and conservation in organisms ranging

from bacteria to mammals. The ABC superfamily is divided into seven families, designated ABCA to

ABCG according to the Human Genome Organization (HUGO) nomenclature6. The function of these

proteins is associated with transport of molecules across membranes against a gradient concentration,

with the hydrolysis of ATP as a source of energy6. The architectural structure of the ABC transporters is

conserved between the different subfamilies and consists of two homologous halves with one TMD with,

at least, six spanning domains (TMSs) and a nucleotide-binding domain (NBD). These domains can be

organized in a forward topology, where TMDs precede NBD [TMD6-NBD]2 or in a reverse topology,

where TMD follow NBD [NBD-TMD]2. Nevertheless, in S. cerevisiae there is some variation, namely the

absence of TMD in ABCE and ABCF subfamilies79, an extra TMD that precedes the [TMD-NBD]2

domains in ABCC subfamily and the absence of ABCA subfamily2. The two TMD form the ligand binding

site and provide specificity80,81. In contrast, the NBD is homologous throughout the family, containing

two important invariant microdomains: the Walker A motif and LSGGQ motif and the other five

conserved but not invariant domains: aromatic, Q-loop, Walker B, D-loop and H-lop82. The transporter

can be constituted by one polypeptide chain that includes four domains, or by two “half-transporters”

whose peptide chain encodes one TMD and NBD, functioning as a homodimer or heterodimer83,84.

In the genome of S. cerevisiae, there are 30 distinct genes encoding ABC transporters and the action

of some members is associated with the multidrug/multixenobiotic resistance (MDR/MXR) phenomenon.

14

It is suggested that these transporters function as drug pumps, catalyzing the extrusion out of the cell

of a large spectrum of functionally and structurally unrelated compounds and even substrates that are

not present in the natural environment85. However, it is unlikely that a specific transporter can recognize

and export a wide range of unrelated compounds, especially when the organism is not expected to be

in contact with them in the natural environment. Over time, a physiological role has been proposed for

these transporters that is general associated with transport of specific substrates88, for example, the

plasma membrane transporter Ste6 is associated with the export of the peptide mating pheromone a-

factor by MATa yeast cells and the peroxisomal transporters Pxa1 and Pxa2 form a heterodimer

responsible for the import of long-chain fatty acids into peroxisomes89,90. This suggests that the

transporters may have other mechanisms of alleviating yeast stress, namely through their impact in

plasma membrane homeostasis, affecting membrane potential, and fluidity7,11,84,91. Therefore, it has

been proposed that these proteins exert a natural physiological role in the cell in absence of stress and

that their effect in MDR/MXR is also a consequence of that role, which consequently influences the

passive diffusion and/or action of cytotoxic compounds, rather than exclusively export of cytotoxic

compounds. However, more detailed research is needed, namely in the understanding of the

physiological function of the MDR/MXR transporters, to support such hypothesis7,99.

The understanding of the biological functions and substrates of these transporters as well as their role

in MDR/MXR is important to increase our scientific knowledge on these transporters as well as to the

industrial field since it can potentiate new strategies to develop more robust strains. It is important to

complement the studied to unveil the role of these transporters with the study of the membrane

composition and properties since the two seem to be related to the acquisition of tolerance to multiple

stresses in yeast.

15

2.4.2. The role of ABCG/PDR family of transporters in lipid homeostasis and

MDR/MXR

From the 30 ABC transporters encoded in the yeast genome, 10 belong to the ABCG family, which

represents the largest family of the ABC superfamily and is associated with pleiotropic drug resistance

(PDR)2. Transporters from this family share the same reverse topology [NBD-TMD]282. Six of them (Pdr5,

Pdr10, Pdr12, Pdr15, Snq2, and Pdr18) are considered PDR transporters sensu stricto since, besides

the topology, they possess a substitution of a lysine residue in the N-terminal Walker A motif for a

cysteine, a specific NVEQ motif in the C-terminal ABC signature and are reported to be involved in

multidrug resistance92. The remaining transporters, YOL075C, Aus1, Pdr11 and Adp1 all fail to comply

with at least one of the requirements and are, therefore, frequently referred to as PDR transporters

sensu lato4,92. The subcellular localization, physiological role and role in MDR/MXR for PDR transporters

in S. cerevisiae is summarized in Figure 2.4.

Figure 2.4. Yeast PDR transporters’ localization, physiological function (when documented) and role in MDR/MXR (when documented it is represented the classes of compounds). Paralogous transporters are represented with the same color. N: nucleus; E.R: endoplasmic reticulum; P.M: plasma membrane.

As discussed for the ABC transporters, some members of the PDR family also have a documented

physiological function in the yeast cell related to plasma membrane lipid homeostasis and their

overexpression confers resistance to a large range of compounds4,6. The best characterized

transporters are Pdr5 and Snq2 which are localized at the plasma membrane and confer resistance to

a large range of compounds, some of them in common between the two transporters. Pdr5 was shown

to act as a floppase, translocating phosphatidylethanolamine, in order to maintain membrane asymmetry

as well as playing a role in quorum sensing through the export of signaling molecules87,93. It was also

suggested that the Pdr5 activity is responsible for its role in MDR/MXR, that is, the transporter can

modulate the permeability of plasma membrane thus, contributing to the extruding of the toxic

16

compounds94. Snq2's physiological role is not clear. Nevertheless, due to its identified role in alleviating

estradiol toxicity in S. cerevisiae and its paralogue relation with Pdr18, a known ergosterol transporter,

it is speculated a possible involvement in lipid translocation10,92,95.

Pdr5 has two paralogs: Pdr15 and Pdr1092. Although Pdr15 has no defined physiological role, it was

suggested that it shares a redundant function with Pdr5, and the failure in detecting growth defects in a

pdr15Δ strain exposure to stress conditions is due to the high levels of expression of Pdr5 that masks

Pdr15 activity96. Pdr10 has a particular function among the PDR subfamily since it was described to be

responsible for the localization and function of other membrane proteins in S. cerevisiae: chitin synthase

Chs3 and the PDR transporter Pdr1297. This led to hypothesize that the action of Pdr10 transporter as

a regulator of the establishment of membrane microdomains97. The mechanism by which Pdr10 controls

the microdomain localization of these proteins is still unknown, however, Rockwell et. al (2009)

hypothesized that, in analogy with its close homologue Pdr5, Pdr10 catalyzes the outward translocation

of a yet unidentified lipid substrate or, alternatively, that Pdr10, when embedded in the membrane,

interacts with a specific set of lipids (or even other proteins), functioning like a detergent, resulting in the

enhancement of dispersal of certain proteins within the plane of the membrane97.

Pdr12 has no physiological role assigned in the absence of stress, however, it has been suggested to

participate in the Ehrlich pathway for amino acid catabolism by exporting several fusel acids98.

The function in the yeast cell of the endoplasmic reticulum transporter Adp1 and the putative plasma

membrane YOL075C is unknown99.

PDR18 is a paralog of SNQ2, that was found recently to be specific for the Saccharomyces genus

yeasts, resulting from an independent gene duplication event in the common ancestor of these yeasts,

that resulted in duplication of Snq2 and translocation of the new copy to the subtelomeric region of

chromosome XIV10. However, these transporters confer yeast with increased tolerance to a very

different set of chemical compounds with little overlapping. It was suggested that the two copies were

kept in the genome due to subfunctionalization, in which one of the paralogs became more efficient at

performing one of the original functions of the ancestor, or due to neofunctionalization of Pdr1810. The

Pdr18 is involved in the maintenance of membrane ergosterol homeostasis by transporting it at the

plasma membrane and, therefore, is essential for the adequate physiological function of the cell plasma

membrane as a selective barrier thus allowing the efficient import of nutrients and excretion of toxic

metabolites9. The role of Pdr18 in yeast tolerance to stress will be discussed in more detail in section

2.4.3.

AUS1 and PDR11 are paralogs genes that encode transporters that play overlapping physiological

functions as they are both responsible for the uptake of exogenously supplied sterols when endogenous

sterol biosynthesis is impaired. Additionally, under anaerobiosis, these transporters seem to play a role

in the transport of ergosterol from the plasma membrane to esterification sites, by physically interacting

with the acyltransferase Are2100,101.

17

2.4.3. Pdr18 transporter role in yeast tolerance to multiple stresses

The plasma membrane transporter Pdr18 confers yeast with resistance to a wide range of structurally

unrelated chemical stress agents9–14. In the first study published on the role of Pdr18, the deletion for

PDR18 gene was found to lead to the increased accumulation in the plasma membrane of the ergosterol

precursors squalene and lanosterol and reduction of ergostatetraenol and ergosterol content when

compared with the parental strain membrane sterol composition11. In the same work, it was also

provided evidence that PDR18 gene expression counteracts the depletion in ergosterol caused by 2,4-

dichlorophenoxyacetic acid (2,4-D) exposure and decreases the intracellular accumulation of this

agricultural herbicide, conferring tolerance to the yeast cells11.

It was also shown by our group that, among a set of 21 proteins encoding ABC and MFS transporters

involved in MDR/MXR, only PDR18 expression seemed to confer yeast cells with tolerance towards

inhibitory concentrations of ethanol14. PDR18 gene over-expression was found to increase yeast ethanol

tolerance and fermentation performance reaching higher ethanol final titers14. Furthermore, the

improved fermentative performance of yeast cells over-expressing PDR18 gene was found to be

correlated with decreased plasma membrane permeabilization induced by ethanol stress14.

Figure 2.5. Schematic representation of the hypothesized biological function of Pdr18 in counteracting plasma membrane decreased order and increased permeability induced by membrane-active compounds (acetic acid and ethanol) and consequently restriction of the diffusional uptake rate of toxic compounds. This scheme is based on the literature available at the time of this thesis publication, focusing on Pdr189,11,14.

When yeast cells were exposed to acetic acid stress, PDR18 expression was found to be essential to

counteract acetic acid-induced decrease in ergosterol content and order of yeast plasma membrane, its

non-specific permeability, and electrochemical potential9. Furthermore, under acetic acid-induced

stress, the transcription levels of PDR18 and of some ergosterol biosynthetic genes were increased,

when compared with the levels of yeast cells cultivated in the absence of acetic acid, which implies a

coordinate interplay between both Pdr18 and ergosterol9. This role for Pdr18 in the maintenance of the

plasma membrane integrity under different stresses is essential for adequate physiological function of

18

the yeast plasma membrane as a selective barrier allowing the entrance of nutrients, the export of toxic

metabolites, and the reduction of the diffusional entrance of toxicants such as ethanol and acetic acid,

and, likely, the physiological activity of membrane-embedded transporters.

2.4.4. The complex regulatory network behind ABCG/PDR transporters

activation in yeast stress response

The expression of ABCG/PDR transporters in yeast response to stress is regulated through a complex

network that has two key players: Pdr1 and its homologue Pdr3102,103. These two are Zn2Cys6-containing

transcription factors that control the expression of several genes involved in MDR/MXR, including

transporters from the PDR family104. Pdr1 and Pdr3 both bind to the same consensus sequence called

PDRE (Pdr1p/Pdr3p Response Element) which is present at different numbers and combinations in the

promoter of the target genes104. Besides the similarities, the two transcription factors have different

levels of expression and activate the expression of a different subset of genes104,3. However, Pdr1 and

Pdr3 were found to regulate the expression of all the PDR membrane transporters involved in MDR/MXR

of our dataset (Figure 2.6). Additionally, it was demonstrated the presence of two PDRE sequences in

the promotor of PDR3 gene and that this regulator is responsible for the control of the expression of its

own gene via an autoregulatory loop. It is also likely that Pdr1 recognizes this regulatory sequence in

the PDR3 gene promoter, although the direct binding was not demonstrated3,104. It was also shown that

these proteins can dimerize, not only in homodimers but also in heterodimers. Pdr1 may form

heterodimers with other zinc cluster proteins besides Pdr3, such as Stb5, found to regulate SNQ2

transcription (Figure 2.6)105. Therefore, the dimerization between zinc cluster proteins may be an

important mechanism of regulation since different combinations of homo or heterodimers seem to be

required to achieve the expression of certain target genes105.

Figure 2.6. Transcription factors regulating the expression of S. cerevisiae PDR plasma membrane transporters genes under stress conditions. This regulatory network was retrieved from the YEASTRACT database (October 2019). The transcription factors represent documented regulations (DNA binding plus expression evidence) under stress condition.

Other transcription factors were demonstrated to be part of the complex regulatory network behind PDR

expression. Some of these transcription factors, namely Msn2, Msn4, and Yap1 were already described

in chapter 2.3. Furthermore, RLM1 is a paralogue of SMP1 which represents an important transcription

factor activated by the Hog pathway. The general stress response transcription activators Msn2 and

19

Msn4 were shown to be involved in the PDR network since they were documented to regulate 2 PDR

genes: PDR5 and PDR15. The zinc-finger transcription factor Yap1 binds to the Yap responsive

elements (YRE) in the promoter region of some of PDR genes11,6 and was found to regulate the

expression of 5 out of the 6 PDR genes of our dataset, including the Pdr18 transporter. The PDR18

gene expression activation was also shown to be regulated by the transcription factors Nrg1, and Pdr311.

The Nrg1 (Negative Regulator of Glucose-repressed genes) mediates glucose repression and

negatively regulates a variety of processes including filamentous growth and alkaline pH response. This

is an example of the complexity inherent to the PDR regulatory network and that the expression of the

PDR genes, under stress conditions, is behind the regulation of multiple, and apparently unrelated,

transcription factors.

The role of some PDR transporters in plasma membrane lipid homeostasis raised the hypothesis of an

interplay between the transcriptional regulators of PDR network and of lipid metabolism. Consistent with

this idea it was shown that some regulators of the PDR network play a role in the regulation of the

sphingolipid biosynthesis: LCB2, SUR2, LAC1, IPT1, and RSB1 genes contain a Pleiotropic Drug

Responsive Element (PDRE) within their promoter region and their expression is induced by Pdr1 and

Pdr3 under stressful stimuli3,106. This contributes to the idea of the importance of membrane lipid

composition in yeast cell response to stress and is another indication that the regulation of membrane

lipid homeostasis under stress is under control of the PDR network.

20

3. Materials and Methods

3.1. Strains, Media, and Inocula preparation

The haploid strain Saccharomyces cerevisiae BY4741 (MATa, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0) and

the derived deletion mutants for the PDR plasma membrane transporters' encoding genes (pdr18Δ,

pdr15Δ, pdr12Δ, pdr10Δ, pdr5Δ, snq2Δ, adp1Δ, and YOL075CΔ) were obtained from EUROSCARF

collection (Frankfurt, Germany).

Yeast cells were cultivated in Yeast Peptone Dextrose (YPD) medium that contains, per liter, 20 g

glucose (from Merck, Darmstadt, Germany), 20 g BactoTM Peptone and 10 g yeast extract (both from

BD Biosciences, New Jersey, United States). The media pH was adjusted to 4.5 with HCl. Unless stated

otherwise, yeast cultivation was performed at 30ºC, with orbital agitation of 250 rpm. The inocula for all

the experiments carried out were prepared by harvesting yeast cells (5,000× 𝑔, 5 min) cultivated for 8

hours in YPD, inoculating in fresh YPD media and growing the culture over-night to an OD600nm of 5.

3.2. Susceptibility analysis by spot assays

Susceptibility to different stresses of S. cerevisiae parental strain BY4741 and the derived deletion

mutants for the PDR plasma membrane transporters’ encoding genes were evaluated by spot assays.

Yeast cell suspensions grown over-night in liquid YPD media were transferred to fresh liquid YPD media

to an initial OD600nm= 0.1 and were grown until exponential phase (OD600nm≈0.5). The exponential cell

cultures were diluted in sterile ddH2O to an OD600nm of 0.25 followed by four serial dilutions of 1:5 each.

These cell suspensions were plated as 4 μL spots onto the surface of YPD solid media at pH 4.5,

supplemented or not (control) with the toxic compound to be tested. The conditions tested and the

selected concentrations for the screening for yeast parental and deletion mutant strains tolerance are

listed in Table 3.1.

We further tested the susceptibility of the parental and pdr18∆ strains to short-term exposure to heat-

shock and high osmotic pressure. For that, inocula were prepared as described above for spot assays

and OD600nm= 0.5 cell suspensions were transferred to fresh YPD liquid media (pre-shock), to liquid YPD

media incubated at 50ºC (heat shock) or to liquid YPD media supplemented with 600 g/L of glucose

(hyperosmotic shock). All yeast cell suspensions were incubated for 30 minutes in each condition. Cell

suspensions to be spotted were prepared as described above for spot assays but spotted in fresh solid

YPD medium.

All the spotted plates were incubated at 30°C for 48 hours unless stated otherwise and pictures were

taken. The susceptibility of the deletion mutant to the different cytotoxic compounds tested was

assessed by comparing their growth performance with that exhibited by the parental strain. Results are

representative of, at least, two independent experiments.

21

Table 3.1. Conditions tested by spot assays to assess yeast parental and deletion mutant strains susceptibility to industrially-relevant stresses.

Condition Spot assays

Manufacturer Long-term stress Short-term stress

Acetic Acid (pH=4.5) 60.0 mM - Fluka (99.8%)

Ethanol 6.0 % (v/v) - Fluka (≥99.8%)

Supra-optimal temperature 40 ºC 50 ºC -

HMF 8.0 mM - Sigma (99%)

Furfural 6.0 mM - Sigma (99%)

NaCl 0.8 M - Panreac (98%)

Glucose 1.8 M 3.3 M Merck (99%)

Sorbitol 1.6 M - Sigma (>98%)

3.3. Fermentation conditions

Fermentations with different glucose concentrations were carried out to evaluate the performance of

BY4741 and the pdr18Δ deletion mutant strain. Inocula were prepared as described in section 3.1 and

YP medium (20 g/L BactoTM Peptone and 10 g/L yeast extract) at pH 4.5 supplemented with glucose

(pH 4.5) to a final concentration of 20 and 300 g/L. The fermentations were performed with a

standardized initial OD600nm of 1, under orbital agitation of 250 rpm, both at 30 and 40ºC.

Fermentation performance was monitored by measuring culture optical density at 600nm, assessing

yeast cell population viability and following glucose and ethanol concentrations. At adequate time points

(marked with an arrow in Figure 4.3), yeast cells were harvested for glucose uptake assays and frozen

with liquid nitrogen for RNA extraction for transcription analysis of ergosterol biosynthesis genes by real-

time Reverse Transcription Polymerase Chain Reaction (RT-PCR).

All fermentations were performed as independent experiments at least three times.

3.4. Yeast cell viability

Cellular viability of yeast cell populations during the fermentation process was assessed by determining

colony forming units per mL (CFU/mL), relying on the serial dilution method. Briefly, yeast cell

suspensions were diluted in sterile water and 50 µL were plated in solid YPD media to obtain between

30-300 colonies on the media plate. Plates were incubated at 30ºC for 48 hours and colonies were

counted to assess CFUs/mL. Results are means of, at least, three independent experiments.

3.5. HPLC analyses

Samples collected during fermentation were centrifuged (6,000× 𝑔, 5 min, 4ºC) to recover supernatants.

These were used for the quantification of ethanol and glucose concentrations by high-performance liquid

chromatography (HPLC). The Aminex HPX 87H Ion Exchange Chromatography column (from BioRad,

California, USA) was used and samples were eluted at 65ºC with 0.005 M H2SO4 at a flow-rate of 0.6

mL/min for 30 minutes, using a refractive index detector. Under such experimental conditions, glucose

had a retention time of 8.3 minutes and ethanol 19.4 minutes. Reproducibility and linearity of the method

22

were tested, and concentrations were estimated based on appropriate calibration curves. All glucose

and ethanol quantification results are means of at least three independent experiments.

3.6. Glucose Transport Assays

Cells were harvested from fermentation of 20 g/L and 300 g/L glucose at 30ºC by parental and pdr18∆

deletion mutant strain to assess glucose uptake kinetics. For that, transport assays were conducted with

radiolabeled D-[U-14 C]-glucose (PerkinElmer, MA, USA, 300 mCi mmol-1, 11.1 GBq mmol-1) as

described previously with minor modifications107.

Briefly, cells were harvested, at the time points marked with an arrow in Figure 4.3, by filtration

(Membrane filters white, 0.2 µm, WhatmanTM, ME24/21ST), washed twice with 5 mL ice-cold water and

resuspended to a final density of 109 cells mL-1 in TM buffer (0.1 M MES, 41 mM Tris, pH 5.5). Aliquots

of 40 μL of these cellular suspensions were transferred to 5 mL Röhren tubes were incubated at 30°C

for 5 min for temperature equilibration. Then, 10 μL of radiolabeled D-[U-14 C]-glucose was added to

each tube by vigorous vortexing. The concentration of radiolabeled D-[U-14 C]-glucose solutions added

to the tubes was 5, 10, 25, 50, 200, 250 and 500 mM, prepared by dilution in distilled water at 1 M

radiolabeled D-[U-14 C]-glucose stock solution to obtain final concentrations of 1, 2, 5, 10, 20, 50, 100

and 200 mM. After 5 seconds of cell incubation with the radiolabeled glucose, the reaction was stopped

by vigorous quenching with 3.5 mL ice-cold demineralized water. Cells were immediately collected by

filtration (Whatman GF/C glass microfiber membranes), washed twice with 5 mL of ice-cold

demineralized water and the filters were transferred to scintillation vials containing 7 mL liquid

scintillation cocktail Ultima GoldTM MV (Perkin-Elmer). The radioactivity was measured in a Beckman

LS 5000TD scintillation counter. Glucose uptake rates are means of results in duplicate for each sugar

concentration and each transport assay was repeated at least twice. The obtained data were used for

estimation of the kinetic parameters Km and Vmax performed using the Michaelis–Menten kinetic model

using GraphPad Prism (GraphPad Software Inc., La Jolla, CA). It is important to state that the candidate

performed the preparation of the yeast suspensions and collaborated with Dr. Margarida Palma in

performing the glucose uptake assays.

3.7. Transcription analysis of ERG-genes

3.7.1. mRNA extraction

Cells corresponding to an OD600nm of approximately 15 were harvested (5,000 × 𝑔, 5 min) from the

different fermentations at the timepoints marked with an arrow in Figure 4.3, and total RNA was

extracted following the hot-phenol method108. Briefly, cells harvested were resuspended in 900 µL of

buffer AE [50 mM sodium acetate (from Merck, Darmstadt, Germany)], 10 mM

ethylenediaminetetraacetic acid [EDTA (from Sigma, Tokyo, Japan), pH 5.3] and 90 µL of 10% SDS

and samples were vortexed for 5 seconds at room temperature. 800 µL of phenol (pH = 4.5-5.5; Sigma,

Tokyo, Japan) were added to each sample which was vortexed for 1 minute at room temperature and

then incubated at 65°C for 4 minutes. The samples were then cooled on dry ice for 15 minutes and then

23

centrifuged at 23615× 𝑔, 4ºC for 5 minutes. The aqueous phase was recovered and transferred to new

tubes with 400 µL of phenol and 400 µL of chloroform/isoamyl alcohol (24:1). Samples were vortexed

for 5 seconds then centrifuged at 23615 × 𝑔, 4ºC for 5 minutes and the aqueous phase was recovered.

This process was repeated three times but in the last one, only 800 µL of chloroform/isoamyl alcohol

(24:1) was added to the samples. The aqueous phase was collected, and 50 µL of sodium acetate and

1 mL volumes of absolute ethanol were added, vortexed and incubated at -80°C for 20 minutes. The

samples were then centrifuged at 23615× 𝑔, 4ºC for 20 minutes and 1 mL of ethanol 70% (v/v) was

added to wash the pellet. Another centrifugation step in the same conditions was performed. The RNA

pellet was dried using speed vacuum and then resuspended in 30µL of deionized water, quantified in

nanodrop ND-100 spectrophotometer and kept at -20°C until further use.

3.7.2. Real-time RT-PCR

The quantification of transcripts from the genes ERG3, ERG9, ERG11, ERG13, and ERG25 was

assessed by real-time Reverse Transcription- PCR (RT-PCR). Extracted RNA was reverse transcribed

to generate cDNA using Multiscribe™ reverse transcriptase. The reaction was performed in a total

volume of 10 µL: 1x TaqMan RT buffer 10X, 5.5 mM MgCl2, 500 µM for each dNTP, 2.5 µM random

hexamers, 4 U/µL RNase inhibitor, 1.25 U/µL MultiScribe™ reverse transcriptase and 100 ng/µL RNA

sample. Additionally, two control reactions were performed: No Template Control (NTC) included all the

mix components except RNA template and No Amplification Control (NAC) included all the mix

components except MultiScribe™ reverse transcriptase. The reverse transcription reaction was

accomplished using a thermal cycler block (7500 Real-Time PCR System – Applied Biosystems) with

the setting parameters described in Table 3.2.

Table 3.2. PCR settings for reverse transcription reaction.

Time (min) Temperature (ºC)

Incubation 10 25

Reverse transcription 30 48

Reaction inactivation 5 95

The cDNA samples obtained in the first step were diluted (1:2) so that the concentration of cDNA of

each reaction was kept around 25 ng/ µL. The real-time RT-PCR step was carried out using SYBR

Green® reagents. The reaction was performed in a total volume of 25 µL: 12.5 µL SYBR Green® PCR

master mix 2x, 0.4 pmol/µL of each primer and 2.5 µL of the diluted cDNA template. For the control

reactions performed in NTC, it was added all the mix components except cDNA template and in NAC it

was only added the master mix. The ACT1 mRNA level was used as an internal control, accounting for

variability in the initial concentration and quality of the RNA. The primers used for the amplification of

each target ERG gene and ACT1 were designed using Primer Express Software (Applied Biosystems)

and are shown in Table 3.3.

24

Table 3.3. Sequences of the primers used for RT-PCR.

Target gene Sequence (5’-3’)

ACT1 fw: CTCCACCACTGCTGAAAGAGAA

rev: CCAAGGCGACGTAACATAGTTTT

ERG3 fw: GCTCTGCACAAGCCTCATCA

rev: GGAAAGAATGAGATGCGAAAGG

ERG9 fw: ATCAGTCAACGTCTCCATATC

rev: GCAAACGATCTGGAGGTCAAG

ERG11 fw: CACGAATTTGTCTTCAACGCTAA

rev: AGTCAAATGAGCGTAAGCAGCTT

ERG13 fw: GATCGGTCCTGATGCTCCAA

rev: CGTAGGCGTGTTCCATGTAAGA

ERG25 fw: GCTACCCTTTCAGGTCTAGTCCAA

rev: AATGGGCGACATTTTGCAA

The real-time RT–PCR reaction was performed using a thermal cycler block (7500 Real-Time PCR

System; Applied Biosystems, California, USA) and the parameters used are described in Table 3.4.

Table 3.4. PCR settings for RT-PCR reaction.

Time (min) Temperature (ºC) Nº of cycles

Activation 10 95 1

Denaturation 30 98 40

Anneal/Extend 5 60

For each sample, it was calculated the difference between the threshold cycle (CT) values obtained for

the amplification plots of target genes and control (ERG gene CT -ACT1 CT). After this normalization

with the internal control, the fold expression values of each target gene are relative to the value of

expression of that gene for the parental strain at 20 g/L of glucose (∆∆CT). Finally, to calculate the

fold gene expression we do 2-(∆∆CT) which was set as 1. The comparative method was used to calculate

relative quantities of a nucleic acid sequence. Since SYBR Green® I dye binds nonspecifically to all

double-stranded DNA, the absence of non-specific amplification with the chosen primers was confirmed

by the generation of a dissociation curve for each pair of primers.

25

4. Results

4.1. Pdr18 is an important determinant of yeast thermo- and osmo- tolerance

Members of the ABC superfamily of transporters, particularly the transporters belonging to the ABCG or

PDR family, are frequently associated with MDR/MXR in yeast86,109. To gain new insights on the role of

the PDR transporters in S. cerevisiae tolerance to individual industrially-relevant stress conditions, a set

of individual deletion mutants of S. cerevisiae BY4741 for PDR18, PDR15, PDR12, PDR10, PDR5,

SNQ2, ADP1, and YOL075C transporters genes were screened for growth performance in the presence

of different stress conditions, when compared to the parental strain. This set of transporters tested

comprise all PDR transporters expressed in aerobic and semi-aerobic conditions. The PDR11 and AUS1

genes were left out of this study since these transporters perform sterol uptake and consequently are

only functional in case of impairment of the ergosterol biosynthesis pathway caused by growth under

anaerobic conditions or mutations in ERG genes under aerobic growth conditions, which is not the case

of our study100. The cytotoxic conditions used in this screening were chosen due to their relevance in

industrial fermentations, namely in the production of alcoholic beverages and second-generation

bioethanol. Susceptibility of the S. cerevisiae BY4741-derived deletion mutant strains towards

selected stress conditions was assessed in rich medium (YPD) and compared to the parental strain,

by spot assays (Figure 4.1).

The results show that several of the PDR transporters examined in this work do not confer yeast with

tolerance to the selected biotechnologically-relevant stresses, under the conditions tested herein.

This is the case of the deletion mutants for SNQ2, PDR12, and PDR15 genes, although the

expression of these genes has been previously associated with the MDR/MXR

phenomenon5,10,13,110,111.

In our screening, we tested osmotic stress induced by high concentrations of NaCl, glucose, and

sorbitol, due to the distinct effects that these stresses exert in yeast cells112. At hyperosmotic stress

induced by 0.8 M NaCl or by 1.8 M glucose, only pdr18∆ strain showed increased mild susceptibility,

when compared to the parental strain. However, no phenotype was observed in the presence of

osmotic stress induced by 1.6 M sorbitol.

The toxicants 5-(hydroxymethyl)furfural (HMF) and furfural, typically present in lignocellulosic

hydrolysates were also included in the screening but no determinant of tolerance to these toxicants

was found among the tested mutants.

Under stress induced by 6.0 % (v/v) of ethanol, the deletion mutants for PDR18 and PDR10 genes

showed a decreased growth ability when compared with the parental strain. These results are in

agreement with previous studies that showed that PDR18 expression is essential for increased

tolerance to ethanol stress10,14. The phenotype for pdr10∆, on the contrary, is a new result. However,

it would be important to increase the concentration of ethanol examined to confirm these phenotypes,

since the concentration used in this study is low, considering yeast tolerance to ethanol.

26

HMF 8.0 mM Furfural 6.0 mM Acetic acid 60.0 mM Control

YOL075CΔ

pdr10Δ

pdr12Δ

snq2Δ

Parental

strain

pdr15Δ

pdr18Δ

adp1Δ

pdr5Δ

pdr18Δ

Parental strain

pdr5Δ

snq2Δ

pdr10Δ

pdr15Δ

pdr12Δ

adp1Δ

YOL075CΔ

Sorbitol 1.6 M Glucose 1.8 M 40ºC Control

adp1Δ

YOL075CΔ

pdr18Δ

pdr10Δ

pdr5Δ snq2Δ

Parental Strain

pdr12Δ

pdr15Δ

pdr15Δ pdr10Δ

pdr5Δ

pdr18Δ

Parental Strain

snq2Δ

pdr12Δ

adp1 Δ

YOL075CΔ

NaCl 0.8 M Control Ethanol 6.0 % (v/v) Control

Figure 4.1. Comparison of the susceptibility of deletion mutants in PDR transporters and of the parental strain S. cerevisiae BY4741 towards industrially-relevant stresses in rich media by spot assays. Cells suspensions were prepared from culture grown to exponential-phase, diluted in sterile ddH2O to OD600nm=0.25 following 4 serial dilutions of 1:5 and then plated as 4 µL spots in YPD pH 4.5 supplemented or not (control) with the compounds studied. Plates were incubated for 48 hours at 30ºC or 40ºC and pictures were taken. Red rectangles represent the stronger phenotype in each condition, when applicable. The phenotypes were confirmed by, at least, three replicates varying the position of each strain in the agar plates to guarantee that results were not influenced due to the position of the cells in the plate. A representative plate is shown for each stress conditions.

27

Under acetic acid stress, the pdr18∆ strain showed a very strong susceptibility phenotype compared

to the parental strain, as observed before9,10.

At the studied supra-optimal temperature of 40ºC, the pdr18∆ strain showed higher susceptibility

compared with the parental strain which is a new phenotypes.

Overall, this screening showed that among the PDRs tested, the transporter Pdr18 provides yeast

tolerance to the higher number of conditions studied (6 out of 8), also exhibiting the strongest

phenotypes. Given this, Pdr18 is of interest due to its involvement in yeast tolerance to several

industrially-relevant stresses, in particular, those related with industrial alcoholic fermentation either for

the production of alcoholic beverages or bioethanol production.

Considering the relevance of hyperosmotic- and thermal-induced stresses in industrial processes relying

on yeast fermentative performance, and the role proved herein for Pdr18 transporter in yeast tolerance

to these stress conditions, we proceed to investigate the parental and pdr18∆ strains susceptibility to

short-term exposure to high temperatures or hyperosmotic shock. For that, S. cerevisiae BY4741 and

BY4741_pdr18∆ mid-exponentially growing cells were exposed to 50ºC or transferred to YPD media

with 600 g/L of glucose (for 30 minutes in both cases), to induce heat and hyperosmotic shock,

respectively, and then plated in YPD and incubated at 30ºC (Figure 4.2).

Figure 4.2. Susceptibility of the parental and pdr18Δ strains to hyperosmotic and thermal shock. Yeast cell suspensions used for spot assays were prepared from mid-exponential cell cultures grown in liquid YPD media (no-shock) and transferred to either YPD media incubated at 50ºC (heat shock) or to YPD media supplemented with 600 g/L of glucose (hyperosmotic shock). After 30 minutes of incubation, cell suspensions were diluted in sterile ddH2O to an OD600nm of 0.25 followed by four serial dilutions of 1:5 each. These cell suspensions were plated as 4 μL spots onto the surface of YPD solid media at pH 4.5. The spotted plates were incubated at 30ºC for 48h. The

results shown are independent biological replicates.

(A) No shock

(B) Post-heat shock (50ºC, 30 minutes)

(C) Post-osmotic shock (600 g/L glucose, 30 minutes)

Replicate 1 Replicate 2

28

The results obtained show that following heat and osmotic shocks, yeast cells from pdr18∆ strain

markedly loss viability when compared to the parental strain, confirming Pdr18 as a genetic determinant

of yeast tolerance to these conditions. Although the thermal and osmotic shocks applied caused a similar

level of stress to the parental strain, reflected by a similar growth in solid YPD media after exposure to

the two different stress conditions, the pdr18∆ strain was found to be more susceptible to thermal shock

compared with hyperosmotic shock.

4.2. Pdr18 expression improves yeast performance under fermentation at a

supra-optimal temperature and high osmotic pressure

Considering the susceptibility phenotypes observed in the previous section of results, and due to the

biotechnological interest of very high gravity (VHG) fermentation, the role for Pdr18 transporter in yeast

performance during fermentation conditions mimicking VHG was assessed. The performance of the

parental and pdr18Δ strains during fermentation at a supra-optimal temperature (40ºC) and under high

sugar concentration (300 g/L of glucose) individually and combined (300 g/L of glucose at 40ºC) was

studied by monitoring culture OD600nm, colony forming units per mL (CFU/mL), and quantifying glucose

and ethanol concentrations in the medium by HPLC (Figures 4.3 and 4.4).

Under fermentation in the absence of thermal and/or osmotic stress (20 g/L glucose at 30ºC), the

parental and pdr18∆ strains showed similar specific growth rates and fermentative performance,

producing final ethanol titers of 2.2 % and 2.1 % (v/v), respectively (Figure 4.3 A). Under fermentation

of the same glucose concentration but at higher temperature (20 g/L glucose at 40ºC, Figure 4.3 C),

the specific growth and fermentative rates of parental and pdr18∆ strains were also similar between the

two strains, however, the fermentative performance was affected when compared with the performance

under 20 g/L glucose at 30ºC. Although the glucose consumption of the two strains was faster at 20 g/L

glucose at 40ºC, the ethanol produced was 1.5 % (v/v) for both strains, which is below the values

obtained with the same glucose concentration at 30ºC. The reduced ethanol production is likely to be

related to the loss of viability (decrease in CFU/mL values) observed for both strains after 8 hours of

fermentation, although it is noteworthy that ethanol evaporation at 40ºC may take part to some extent.

The loss of viability exhibited by both strains at 40ºC is probably a consequence of the combined

deleterious effect of the supra-optimal temperature with the fermentation products generated during the

process, rather than the effect of the supra-optimal temperature alone. However, this viability loss is

slightly increased in the pdr18Δ deletion mutant, when compared to the parental strain, which is

consistent with the previously observed susceptibility of this strain to the fermentation products ethanol,

acetic acid9,14 and on growth at supra-optimal temperature (Section 4.1).

29

Figure 4.3. Fermentations in YP media supplemented with 20 or 300 g/L of glucose, carried out at 30 and 40ºC,

by parental or pdr18∆ strains. Fermentations were divided and each letter represent different conditions: A) 20 g/L glucose at 30ºC, B) 300 g/L glucose at 30ºC, C) 20 g/L glucose at 40ºC and D) 300 g/L glucose at 40ºC. Yeast strains’ performance was compared by following OD600nm (black), CFU (blue), and glucose (red) and ethanol (green) concentrations in the medium. The parental strain is represented by the circle (○) and the pdr18∆ by the square (□) symbol. Black arrows indicate the time points at which cells were harvested for further analysis. Results are means of three independent replicates and error bars represent standard deviation.

40

ºC

A- 20 g/L

C- 20 g/L

30

ºC

B- 300 g/L

D- 300 g/L

○ Parental strain

□ pdr18∆ strain

○ Parental strain

□ pdr18∆ strain

○ Parental strain □ pdr18∆ strain

○ Parental strain □ pdr18∆ strain

30

Figure 4.4. Fermentations in YP media supplemented with 300 g/L of glucose, carried out at 30 and 40ºC, by parental or pdr18∆ strains. These graphs represent a zoom-in of the beginning of fermentations represented in Figure 4.3 (initial 30 hours) of 300 g/L of glucose at 30ºC and 40ºC and the middle of the fermentation (between 30 and 200 hours) of 300 g/L at 30ºC, by the parental strain (○) and the pdr18∆ (□). Yeast strains’ performance was compared by following OD600nm (black), CFU (blue), and glucose (red) and ethanol (green) concentrations in the

medium. Results are means of three independent replicates and error bars represent standard deviation.

Under fermentation conditions of high initial sugar concentration (300 g/L glucose at 30ºC), the

fermentation profile is complex, and it can be differentiated in 3 phases to ease the analysis (Figure 4.3

B). The first phase, at the beginning of the fermentation is highlighted in Figure 4.4 B. In this phase, the

pdr18∆ strain exhibits a slower specific growth rate and slower specific fermentation rate, characterized

by decreased glucose consumption and ethanol production rates when compared to the parental strain.

This behavior is likely the consequence of the increased loss of viability (decreased CFU/mL values) of

the deletion mutant strain when compared to the parental strain. The pdr18Δ population exhibits a

marked loss of viability, reaching its minimal values at 6 hours (7.3×106 cells/mL), which is consistent

with the observed increased death after a hyperosmotic shock of the yeast cells from pdr18Δ stain,

compared with the parental strain.

After approximately 26 hours, the second phase of the fermentation profile begins (Figure 4.3 B). By

this stage, the fermentation rate of the pdr18Δ strain is greatly enhanced and overpasses that of the

parental strain which can be observed by glucose consumption and ethanol production rates (Figure

4.3 B). This fermentation stage was kept during the range of 50-180 g/L glucose and to ethanol

concentrations below 15 % (v/v) ethanol. This result was not expected due to the susceptibility of the

pdr18Δ strain to high sugar concentrations, ethanol toxicity, and the fermentation sub-product acetic

B- 300 g/L at 30ºC

D- 300 g/L at 40ºC

○ Parental strain

□ pdr18∆ strain

○ Parental strain

□ pdr18∆ strain

31

acid9,14. Based on the results obtained it is observed that the absence of Pdr18 transporter is,

temporarily, advantageous for the fermentative performance in the specific environment created during

this second phase of the fermentation curve.

The third, and last phase of the fermentation begins after, approximately 170 hours of fermentation. The

accumulation of high ethanol concentrations combined with other fermentation sub-products that

contribute to yeast cell toxicity affected the fermentation rates of both strains, although it was marked

for the pdr18Δ strain population. This can be supported by the loss of viability observed for both strains

from 124 hours, which is more marked for the pdr18Δ strain and is consistent with the higher

susceptibility of this strain to the fermentation inhibitors, in particular, ethanol and acetic acid9,14. The

glucose consumption and ethanol production of the pdr18Δ strain ceases at, approximately 200 hours,

producing 18.4 %(v/v) of ethanol, and leaving 51.5 g/L glucose in the medium while for the parental

strain the fermentation ceases at, approximately 270 hours, producing 19.4 % (v/v) of ethanol, leaving

35.0 g/L of glucose in the medium (Figure 4.3 B).

Under fermentation conditions of combined high initial glucose concentration and supra-optimal

temperature (300 g/L of glucose at 40ºC), the performance of the two strains is highly affected (Figure

4.3 D). At the beginning of the fermentation, it is observed a loss of viability for both strains, however,

the parental strain recovers after 4 hours while the pdr18∆ strain shows marked viability loss until 10

hours of fermentation (Figure 4.4 D). After the adaptation phase, both strains’ populations resume the

fermentation process throughout but the pdr18∆ strain fermentative performance is consistently lower

than the parental strain. The glucose consumption arrests leaving 130.9 and 164.4 g/L glucose in the

medium and the ethanol final titers are 10.2 % and 8.9 % (v/v) for the parental and pdr18∆ strains,

respectively. The ethanol production is lower for both strains when compared to the fermentation of the

same glucose concentration at 30ºC (Figure 4.3 B), consistent with the marked loss of viability observed

for parental and pdr18∆ strains under fermentation of 300 g/L glucose at 40ºC after only 50 hours of

fermentation. Overall, under these fermentation conditions (300 g/L of glucose at 40ºC), which better

mimics the conditions of VHG fermentation, the pdr18∆ strain shows an inferior fermentative

performance when compared with the parental strain.

Overall, the results indicate that the PDR18 expression is determinant for yeast tolerance to demanding

fermentation conditions, mainly when there is a synergistic effect due to the accumulation of different

cytotoxic compounds in the external medium.

32

4.3. Effect of PDR18 expression in ergosterol biosynthetic genes

transcription levels under supra-optimal temperature or osmotic stress

Ergosterol, the main sterol in yeast, influences plasma membrane properties such as fluidity and

permeability and the levels of expression of the ergosterol biosynthetic pathway genes have been

related with yeast cell tolerance to thermal and osmotic stresses70,71,113. Additionally, sterol content and

composition have also been linked with yeast thermo- and osmo- tolerance, respectively50,72. Given the

role of Pdr18 in ergosterol transport at the plasma membrane level, we investigated the effect of PDR18

expression in the mRNA levels of ergosterol biosynthetic pathway genes under fermentation with high

initial glucose concentration (300 g/L) or at a supra-optimal temperature (40ºC), compared with

fermentation under low glucose concentration (20 g/L) at optimal growth temperature (30ºC).

Cells were harvested for quantification of ergosterol biosynthetic genes’ mRNA at adequate time points

(marked with an arrow in Figure 4.3) from fermentations of 20 g/L and 300 g/L, both at 30ºC and of 20

g/L at 40ºC. The ERG genes selected cover several stages of the pathway, including the early, middle

and final steps (ERG13, ERG9, ERG11, ERG25, and ERG3). The time points were chosen so that,

under the different conditions for both strains, cells were at exponential phase of growth and active

fermentation stage, and in the case of 300 g/L glucose fermentations, cells already adapted to the

osmotic stress, surpassing the induced phase of viability loss. Transcription levels were determined by

qRT-PCR (Figure 4.5). The parental strain mRNA levels of the studied ERG genes during fermentation

of 20 g/L of glucose and at 30ºC, were considered control transcription levels and, thus, set to 1.

For fermentation of 20 g/L glucose at 30ºC (unstressed control conditions), the absence of PDR18 gene

expression did not significantly affect the transcription of the studied ERG genes since the pdr18∆ strain

exhibited similar transcription levels as the parental strain.

For fermentations carried out of the same initial sugar concentration (20 g/L glucose) but at a higher

temperature, 40ºC, the transcription levels of the studied ERG genes in the parental strain cells were

similar to those of the control transcription levels. On the contrary, these conditions (20 g/L, 40ºC)

induced increased transcription of ERG13, ERG9, ERG25 and ERG3 genes in the pdr18∆ strain cells.

The activation of the transcription of these genes was of 2.3-, 3.5-, 3.5-, and 2.1-fold the levels of the

parental strain, respectively (Figure 4.5 B). These results suggest that the increase in ERG genes

transcription levels are important for pdr18∆ strain, but not for parental strain, tolerance to the supra-

optimal temperature. These differences may be related to the increased susceptibility of the pdr18∆

strain under heat stress when compared with the parental strain (Figures 4.1 and 4.2).

For cells harvested from a fermentation of 300 g/L of glucose at 30ºC, the parental strain cell population

shows increased mRNA transcription levels, of approximately 2.0-, 1.5- and 5.1- fold, of ERG9, ERG25

and ERG3 genes, respectively, when compared with the control transcription levels (Figure 4.5 B).

Under these fermentation conditions (300 g/L glucose at 30ºC) the pdr18∆ strain also showed increased

transcription levels of ERG9, ERG3 and ERG25 genes of 3.7-; 3.3- and 6.7-fold, respectively, when

compared to the transcripts’ control levels. These results suggest that the up-regulation of the ERG

genes’ transcription is important for yeast tolerance to high osmotic pressure since, at the time point in

which yeast cells were harvested, there were, approximately, 190 g/L of glucose in the external medium.

33

Furthermore, under fermentation of 300 g/L glucose at 30ºC, the ERG9 and ERG25 genes transcription

levels are higher for the pdr18∆ strain than for the parental strain. These differences of transcription

levels between the parental and pdr18∆ strains are likely related to the higher susceptibility of the pdr18∆

strain under high osmotic pressures, when compared to the parental strain and corroborate with the

physiological role attributed to Pdr18 in ergosterol transporter in the plasma membrane.

A B

Figure 4.5. Levels of mRNA from ergosterol biosynthetic pathway genes (ERG13, ERG9, ERG11, ERG25, ERG3) during cultivation under fermentation of 300 g/L and 20 g/L glucose at 30ºC and 20 g/L glucose at 40ºC. A) Steps from the ergosterol biosynthesis pathway where the ERG genes studied are involved. B) Levels of mRNA from cells harvested at fermentation of 300 g/L and 20 g/L glucose at 30ºC and 20 g/L glucose at 40ºC of the different ERG genes indicated, assessed by qRT-PCR. Transcription levels for parental strain at 20 gL glucose at 30ºC were set to 1. The relative expression of each ERG gene for parental strain (black) and deletion mutant (blue) for fermentation carried at 30ºC and 40ºC, are plotted in the same graph. Results are means of, at least, two independent replicates, with three technical replicates each. All bar graphs are displayed as mean ± SD, and the p-values were evaluated by unpaired t test (non-star p-value > 0.05; * p-value < 0.05). ERG genes highlighted in blue in the figure show significant changes in the presence of thermal- and/or osmotic-induced stress.

34

Overall, our results indicate that the deletion of PDR18 gene influences the cell transcriptional response

to osmotic and thermal-induced stress related to genes of the ergosterol biosynthetic pathway. This

most likely reflects a response from pdr18Δ cells in order to surpass the additional stress resulting from

deleterious conditions exacerbated by an ergosterol-depleted plasma membrane.

4.4. The absence of PDR18 expression leads to increased glucose uptake rate

in the presence of high glucose concentrations

The higher fermentation rate observed for the pdr18∆ strain, compared with the parental strain, in the

presence of 300 g/L glucose concentrations at 30ºC (Figure 4.3) was intriguing due to the susceptibility

of this strain under high osmotic pressure, and toxic concentrations of ethanol and acetic acid.

Considering the role for Pdr18 transporter in yeast plasma membrane composition and organization,

and the dependence of plasma membrane transporters in their lipidic environment, led us to hypothesize

different glucose uptake kinetics for cells expressing or not PDR18 gene.

To test this hypothesis, yeast cells of parental and pdr18∆ strains were harvested at the time points

indicated by arrows in Figure 4.3 A and B to evaluate the glucose uptake parameters. The kinetic

parameters of glucose uptake in yeast cells from the two strains were determined using radiolabeled D-

[U-14C]-glucose assays and relying on Michaelis-Menten plots (Figure 4.6 and Table 4.1). This model

retrieves a curve that best fits the experimental data which allows the acquirement of the kinetic

parameters Km and Vmax and the identification of high- and low-affinity glucose uptake system

components114. The Vmax reflects the rate of activity when the enzyme is saturated with substrate, that

is, the maximum reaction rate. The Km constant is defined as the substrate concentration corresponding

to half of the maximal velocity and reflects the affinity of the enzyme for the substrate. The glucose

uptake kinetic parameters obtained represent the contribution of several co-expressed transporters, with

distinct glucose affinities115. When cells were harvested from fermentation of 20 g/L at 30ºC (at 6 hours,

≈10 g/L glucose in the media), there is an increase in the glucose uptake rates of the pdr18∆ strain

compared with the parental strain however the affinity for the substrate decreased in the pdr18∆ strain

(Table 4.1). When cells were harvested from fermentation of 300 g/L at 30ºC (at 48 hours, ≈140 g/L

glucose in the media) the kinetic parameters Vmax and Km obtained were markedly decreased and

increased, respectively, for both strains when compared with the values obtained under fermentation of

20 g/L glucose at 30ºC (Table 4.1). Furthermore, similar to the described previously, the pdr18∆ strain

showed increased Vmax and increased Km when compared to the parental strain (Table 4.1). In the

Michaelis-Menten plot for cells harvested from both fermentation conditions (20 g/L and 300 g/L glucose

at 30ºC, Figure 4.6) it is observed that for lower glucose concentrations in the medium the parental

strain exhibits higher velocities of glucose uptake while for higher glucose concentrations, the velocities

of substrate uptake are higher for the pdr18∆ strain. However, for cells harvested from fermentation of

20 g/L glucose the described shift is observed for substrate concentrations of approximately 150 mM

(27 g/L) and for the cells harvested from fermentation of 300 g/L glucose the same is observed for lower

substrate concentrations, of approximately 50 mM (9 g/L).

35

Table 4.1. Michaelis-Menten kinetic parameters Km and Vmax of glucose uptake rates for parental and pdr18∆ strains cells during fermentation under 20 and 300 g/L glucose at 30ºC. The values of Km and Vmax parameters, for the parental and deletion mutant strains, represent means of, at least, two independent experiments with respective standard deviation error.

20 g/L glucose 300 g/L glucose

Kinetic constants

Km

(mM)

Vmax

(μmol h-1 10-8 cells)

Km

(mM)

Vmax

(μmol h-1 10-8 cells)

Parental strain 28.92 ± 2.58 9.26 ± 0.24 33.56 ± 10.65 2.46 ± 0.24

pdr18Δ strain 52.39 ± 6.21 10.61 ± 0.45 73.67 ± 24.16 3.60 ± 0.48

Figure 4.6. Michaelis-Menten plots of glucose uptake rates for parental strain and pdr18∆ cells during fermentation under 20 and 300 g/L glucose at 30ºC. S. cerevisiae BY4741 and BY4741_ pdr18∆ cells were harvested from fermentations under 20 g/L and 300 g/L glucose at 30ºC, at the time points marked with an arrow in Figure 4.3. These cell suspensions were used to perform glucose transport assays and construct the Michaelis-

Menten plots. The parental strain is represented by the circle (○) and the pdr18∆ by the square ( ) symbol. Results

were used to determine the kinetic parameters Km and Vmax shown in Table 4.1. Results are means of, at least, two biologically independent experiments arising from at least two technical replicates. Error bars represent standard deviation.

These results indicate that the absence of PDR18 gene affects the expression and/or activity of the

yeast glucose uptake transporters, decreasing glucose uptake rate for lower glucose concentration but

increasing the uptake for high concentrations of the substrate in the external medium. The glucose

concentration range for which the pdr18∆ strain exhibits increased glucose uptake rate depends on the

external environment in which the yeast cells are present. Therefore, the increased fermentation rate of

the pdr18∆ strain, compared to the parental strain, during fermentation of 300 g/L at 30ºC is related with

increased glucose uptake rate.

20 g/L glucose 300 g/L glucose

○ Parental strain

pdr18∆ strain ○ Parental strain

pdr18∆ strain

36

5. Discussion

The present work provided further insights into the role of PDR transporters in yeast under stress

conditions of industrial relevance. Until now, the impact of the expression of PDR transporters was

mainly studied in the presence of drugs and has not been systematically examined. The stresses

relevant in fermentation industries were the focus of this work: inhibitory concentrations of acetic acid;

and ethanol; inhibitory concentrations of 5-(hydroxymethyl)furfural (HMF) and furfural both present in

the lignocellulosic hydrolysates that is a common feedstock for second-generation bioethanol

production; a supra-optimal temperature, 40ºC; and osmotic stress present during fermentation of

sugarcane juice and molasses fermentation for bioethanol production. The screening of yeast PDR

transporters allowed the identification of Pdr18 transporter as the most important PDR in yeast tolerance

to those stresses, being a determinant of yeast tolerance to acetic acid, the supra-optimal temperature

40ºC, ethanol, osmotic stress induced by high salt and high sugar concentration. Pdr18 was proposed

before by our group to transport ergosterol at the plasma membrane level, thus influencing its

organization, wherefore, it is hypothesized that the role of this transporter in yeast MDR/MXR is due to

different drug partition between the cell interior and the extracellular medium as a result of its

physiological function7,8. Given the relevance of yeast tolerance to heat and osmotic stresses for

industrial alcoholic fermentations, the role of Pdr18 and of ergosterol synthesis in fermentations carried

out in the presence of these stress factors was investigated.

The effect of the stresses induced by ethanol, acetic acid, high osmotic pressure and growth at supra-

optimal temperature share a common toxicity target in yeast cells: the plasma membrane. Yeast

adaptation to the individual toxicity of these stresses has been related to altered sterol composition and

increased expression of some ERG genes. Zhang, K. et al. (2015) developed an S. cerevisiae mutant

strain with improved fermentation performance under 265 g/L glucose that produced a 7.9 % higher

ethanol final titer than the parental strain116. This improvement was correlated with increased

transcription of some ERG genes that resulted in increased production of ergosterol, compared with the

parental strain, which led to the authors’ conclusion that ergosterol exerts a protective effect and

counteracts the increased permeability of yeast cells under VHG fermentation116.

Additionally, although acetic acid stress does not directly damage yeast plasma membrane, S.

cerevisiae strains found to be especially susceptible to weak acids were identified as deficient for

ergosterol biosynthesis117. Acetic acid disturbs yeast lipid metabolism and intracellular trafficking, and

yeast adaptation to this weak acid includes mechanisms of membrane remodeling which reduce

intracellular accumulation of the counterion, by its extrusion through the plasma membrane, and

restriction of the diffusional entrance into the cell of the liposoluble acid form44,118. In fact, S. cerevisiae

cell response to acetic acid stress has also been linked to increased expression of some ERG genes in

coordination with PDR18 transporter expression activation during the exponential phase of growth,

which suggests an interplay between the ergosterol biosynthesis pathway and the role of the multi-

stress resistance determinant Pdr189. This highlights the importance of ergosterol content as a plasma

membrane stabilizer, not only to counteract the perturbation in plasma membrane properties but also to

37

maintain the plasma membrane selective permeability to avoid the passive diffusion of toxic compounds

into the cell.

Heat stress disturbs yeast plasma membrane by increasing its fluidity, permeability and, as a

consequence, negatively impacts several membrane-associated processes119. Therefore, it is essential

that the heat stress response includes the readjustment of yeast plasma membrane composition,

namely the sterol content, to counteract the corresponding damage 9,11,25,50,70–72,117,120,121. Furthermore,

it was described that mild osmotic stress can improve yeast cell survival to a subsequent heat stress

which suggests that both stresses share transcription factors and mechanisms involved in yeast

response to this stress122. Hyperosmotic stress also targets the yeast plasma membrane, affecting its

properties123. Thus, based on this and on gene transcription results from previous studies, it is expected

that ergosterol biosynthesis may be an important player in both heat and osmotic stress response and

that the increased susceptibility of the pdr18Δ strain to thermal and osmotic stresses is likely to be linked

with the reduced of ergosterol content at the plasma membrane71,77,113,120,123. To test this hypothesis, we

examined the transcription levels of several ERG genes in the parental and pdr18∆ strains under the

fermentation conditions studied. The ERG genes examined in this work included those encoding

enzymes catalyzing the early, middle and final steps of the ergosterol biosynthesis. These were also

selected because their transcription is altered under several stress conditions, according to previous

microarray data9,71,77,113,117,120,123–126.

In the present work, it was observed that, under fermentation of 20 g/L glucose at 40ºC, the pdr18Δ

strain showed to increase the transcription levels from a number of ERG genes compared with

transcription levels under fermentation of the same glucose concentration but at 30ºC. However, the

parental strain under these two conditions showed similar levels of ERG genes transcription. It was

previously observed that the pdr18Δ strain shows a plasma membrane with decreased ergosterol

content than the parental strain and higher membrane permeability9,14. We suggest that the differences

in membrane composition between parental and pdr18Δ strains result in the higher susceptibility of the

mutant to a supra-optimal temperature of growth. This was confirmed by the spot assays showing a

decreased growth of the pdr18Δ strain under 40ºC and an increased loss of cell viability of the pdr18Δ

culture after short-time exposure to a heat shock. Therefore, it is expected that at the supra-optimal

temperature of growth studied, the pdr18Δ strain suffers a markedly increase in membrane permeability

triggering the activation of the ergosterol biosynthetic pathway, a response that allows to counteract

those deleterious effects. The fact that the up-regulation of the ERG genes was not detected in the

parental strain at the same supra-optimal temperature is likely due to the higher tolerance of the parental

strain cells and to the higher ergosterol content which confers more rigidity to the cells plasma

membrane. Moreover, since yeast cells are known to have ergosterol supplies stored as lipid droplets,

it is possible that parental strain cells may primarily use these supplies to modulate plasma membrane

composition, relying on Pdr18 for ergosterol incorporation rather than by activating ergosterol

biosynthesis which requires more time and energy127. For the pdr18Δ strain, we hypothesize that the

reliance on these ergosterol supplies is less efficient due to the disrupted incorporation of ergosterol in

the plasma membrane. However, to test this hypothesis, it would be important to investigate the lipid

droplet content in both strains’ cells at both 30ºC and 40ºC. Thus, would be interesting to compare the

38

permeability of parental and pdr18Δ cells plasma membranes as well as its lipidic composition to gain

new insights about how the two strains differently adapt to fermentation under 40ºC.

During fermentation of 300 g/L glucose at 30ºC there is an activation of the ergosterol biosynthetic

pathway, both for parental and pdr18Δ strains when compared with fermentation of 20 g/L glucose at

30ºC, however this activation was higher in the pdr18Δ strain population. These results suggest that

increasing the ergosterol content at the plasma membrane is a determinant of yeast tolerance to heat

and osmotic stresses, nonetheless, it would be important to confirm this hypothesis by quantifying the

ergosterol content in the yeast plasma membrane under the conditions studied, to confirm that the

increased transcription of ERG genes results in increased plasma membrane ergosterol content.

Apparently, salt-induced stress leads to decrease of transcription levels of some ERG genes, driven by

Hog pathway54. This is also supported by the analysis of the transcriptional response of yeast to osmotic

stress induced by high concentrations of NaCl and sorbitol77. The discrepancy on the observations

regarding the transcriptional response of ERG genes under osmotic stress tolerance may be associated

with three main reasons:

First, it is important to consider that the studies are performed in different S. cerevisiae strains that

present different characteristics, resulting in different tolerances to several stress factors128,129 and

therefore the same stress conditions may lead, or not, to the activation of stress response mechanisms;

Second, the effect of osmotic stress induced by high salt concentrations on the cell is distinct from the

effect induced by high sugar concentrations which, in turn, also varies with the sugar112.

Third, for the same stress agent, the concentration and time of exposure used influence the

transcriptional response of the yeast cells68. Therefore, the adaptation of the yeast cells after 48h of

fermentation at 300 g/L glucose, as it is the case of this thesis, is substantially different from the exposure

of yeast cells to the same conditions for a shorter period of time. Additionally, previous work from our

lab showed that for yeast cells grown in liquid minimal growth medium supplemented with the adequate

nutrients, the transcriptional profile of some ERG genes has a maximum value during exponential phase

of growth9. Therefore, it is expected that in the early phase of the osmotic stress response, the energy

would be used for more rapid response mechanisms such as protein covalent modifications (such as

acetylation, oxidation, phosphorylation, methylation, ubiquitination, etc.); allosteric or nonallosteric

regulation or physically induced protein structural changes (such as by high temperature or mechanical

forces)130. These mechanisms are capable of rapidly altering the activity of critical proteins to counteract

perturbations caused by the stress and restore cellular homeostasis. Furthermore, as it was briefly

discussed here, excess ergosterol is stored as lipid droplets that can be mobilized to liberate free sterols

by the action of three steryl-ester hydrolases: Yeh1, Yeh2, and Tgl153. This is a faster and less energy-

demanding source of ergosterol for the cell than the activation of transcription of ergosterol biosynthesis

pathway. The increased of ERG genes transcription would possible be detectable at a later phase of

fermentation, rather than after the first minutes following by sugar and salt-induced osmotic stress as

the case of most studies on yeast cells.

Transcriptionally mediated responses are characterized by activation of specific transcription factors

that may cause the remodeling of genomic expression for their target genes. However, different stress

39

conditions have specific sensor molecules that activate specific transcription factors, and, consequently,

key stress responsive genes130,131. Relying on works by Chen et al. (2009) and Święciło (2016), we

collected 62 transcription factors proposed to be involved in heat stress response and 65 involved in

osmotic stress response122,132. Among these transcription factors, 16 were common to the two stresses

conditions, suggesting an overlap of stress response mechanisms between the two conditions that are

in agreement with the similarity of the deleterious effect provoked by these two stresses in the yeast

cell. However, there are several transcription factors associated with only one stress condition indicating

that there are also individual response mechanisms related to each stress condition.

Considering the results observed in this thesis work, indicating that activation of the ergosterol

biosynthetic pathway is determinant for tolerance to supra-optimal temperatures and/or of high glucose

concentration, and that Pdr18 is a determinant of yeast tolerance to these conditions, we wanted to gain

new insights about the potential regulatory network behind the mechanisms of response and tolerance

to these stresses. Therefore, we searched for documented transcription factors that activate the

expression of PDR18 and all the ERG genes based on DNA binding evidences plus expression

evidences, relying on the YEASTRACT22 database and compared these genes with the transcription

factors involved in heat and osmotic stress responses. The data is represented on the Venn diagram of

Figure 5.1.

Figure 5.1. Venn diagram built using YEASTRACT database to identify putative regulators of PDR18 and ERG genes in the presence of heat and/or high sugar-induced stress. The transcription factors involved in heat and osmotic yeast stress response were retrieved from Chen et al. (2009) and Święciło (2016)122,132. The transcription factors regulating ERG genes and PDR18 gene were obtained in YEASTRACT database22 as predicted activators, with documented evidence based on DNA binding plus expression evidence and filtered to the environmental condition stress.

In the Venn diagram from Figure 5.1 we can see that the transcription factors Hac1, Yap1, Pdr1, and

Pdr3 seem to activate the expression of both ERG and PDR18 genes, suggesting that the transcription

of PDR18 gene may share regulatory mechanisms as the ERG genes under stress conditions.

40

Therefore, since it was seen in this work that ERG genes transcription was increased under the

fermentation conditions described (20 g/L glucose at 40ºC or 300 g/L glucose at 30ºC), it would be

interesting to investigate if the transcription of PDR18 gene is also increased under these conditions

when compared with fermentation under optimal temperature of growth and in the absence of high

glucose concentration (20 g/L glucose at 30ºC). The Hac1 transcription factor is known to regulate the

unfolded protein response and its expression, is repressed under non-stress conditions133,134, and it was

identified in our search as being activated under osmotic stress response; Yap1 is involved in oxidative

stress response135 and was found to be activated under heat stress response; Pdr1 and Pdr3 are

involved in the Pleiotropic Drug Resistance (PDR) network104,134,136 and were herein identified among

stress response for both conditions studied. This exploitation of the YEASTRACT database can be of

use to guide new experiments on uncovering the regulatory network behind activation of PDR18 and

ERG genes’ transcription under the conditions tested in this work. Furthermore, Yap1, Pdr1 e Pdr3, and

Rpn4 were identified as determinants in yeast cell response to the toxic compound HMF, present in

lignocellulosic hydrolysates111. Therefore, it would be interesting to consider these transcription factors,

in further studies, as targets for genome engineering to further improve yeast stress response

robustness under VHG fermentations.

During this work, we observed that exposure of yeast cells to fermentation conditions of high osmotic

pressure (initial glucose concentration 300 g/L) decreases the glucose uptake capacity (2.46 μmol h-1

10-8 cells) when compared with cells harvested from fermentation of initial glucose concentration 20 g/L

(9.26 μmol h-1 10-8 cells). It was already demonstrated that at the beginning of fermentation of 200 g/L

glucose, the glucose transport capacity was maximal, linked with the expression of the low-affinity and

high-capacity glucose transporter Hxt1p114. The yeast hexose transporter Hxt1, as well as the human

glucose transporters Glut-1 and Glut-4 have been associated with lipid rafts microdomains137–139.

Additionally, the yeast S. cerevisiae was used as host for heterologous expression of the plant glucose

transporter Hup-1, which clearly showed a distribution and activity dependence on the plasma

membrane lipid rafts, and it was specifically associated with ergosterol, phosphatidylethanolamine, and

phosphatidylcholine141. Therefore, we suggest that the altered glucose uptake kinetics observed across

the fermentation stages is linked with the cell plasma membrane remodeling triggered by the high

osmotic pressure of the fermentation conditions, which influences the activity and/or expression of Hxt

transporters36,112,140,141.

Additionally, independent on the fermentation conditions, the pdr18Δ cells exhibited higher glucose

uptake rates compared to the parental strain for certain glucose ranges. These glucose ranges,

however, were dependent on the fermentation conditions: for cells harvested from fermentation of 20

g/L glucose (harvested at 6 hours and ≈ 10 g/L glucose) the pdr18Δ cells exhibited increased glucose

uptake compared to the parental strain cells when exposed to D-[U-14C] glucose concentration higher

than 27 g/L while for cells harvested from fermentation of 300 g/L glucose (harvested at 48 hours and ≈

120 g/L glucose) the increased rate of the pdr18Δ cells was observed for D-[U-14C] glucose

concentration higher than 9 g/L. For both fermentation conditions, the affinity of the glucose transporters

for the substrate was lower in the pdr18Δ strain compared to the parental strain which is consistent with

the increased glucose uptake rate for higher glucose concentrations. Yeast cells lacking the Pdr18

41

transporter have a lower ergosterol content which may influence the formation of membrane

microdomains and, consequently, affect membrane-dependent cell functions9,11. This innate differences

between parental and pdr18Δ strains, combined with the deleterious effects of high osmotic pressure,

influence the lipidic environment of the plasma membrane and, consequently, the activity of glucose

transporters.

The altered activity of the glucose transporters influences the yeast cells fermentation performance since

we observed that for a range fermentation of 50-180 g/L glucose and up to 16 % (v/v) ethanol pdr18Δ

cells exhibited an increased fermentation rate compared with the parental strain. We suggest that for

glucose concentrations >300 and <50 g/L, the improved fermentation rate of the pdr18Δ deletion mutant

population does not occur due to the increased susceptibility of the deletion mutant strain to high osmotic

stress and to the deleterious effect of the accumulation of fermentation products, respectively. However,

it would be important to understand the changes in membrane composition that trigger this phenotypes,

in future studies, investigating the lipidic composition of the pdr18Δ and parental strains under

fermentation of 300 g/L glucose at 30ºC, namely, could contribute to understand the differences in

ergosterol and sphingolipids content and the consequent effect in lipid rafts formation. Furthermore, we

consider that the yeast cells increased fermentation rate at 40ºC compared to 30ºC could also be linked

with distinct glucose uptake rates between the two conditions, influenced by altered membrane

properties induced by the imposed heat stress, thus, it would also be important to determine the kinetic

parameters of glucose transporters of cells grown at 40ºC and clarify this matter.

Figure 5.2. Scheme of the hypothesized involvement of Pdr18 and ergosterol biosynthesis in yeast cell response to supra-optimal temperatures and osmotic stress. The supra-optimal temperature of growth and osmotic stress triggers a yet unknown pathway of signal transduction that results in increased transcription of ERG genes which results in increased ergosterol biosynthesis. Increased incorporation of ergosterol in the yeast plasma membrane, mediated by Pdr18 increases membrane order which will affect the conformation and activity of glucose uptake transporters.

42

Our results support the notion that PDR18 gene is a promising target for genetic manipulation to reach

increased fermentation performances under conditions mimicking VHG fermentations. An

advantageous manipulation would aim to increase expression of the PDR18 gene at the beginning of

the fermentation when there is extremely high osmotic pressures in the medium and at the time of the

fermentation when there is a toxic synergistic effect due to the accumulation of toxic fermentation

compounds such as ethanol and acetic acid. For this, it is possible to rely on synthetic promoters since

it can be a modified version of natural promoters or hybrid promoters, consisting of a minimal promoter

(the binding sites for general transcription factors including RNA polymerase II) and a defined cis-acting

element that will determine the expression characteristics for the gene142,143. The main advantage is the

possibility of reducing unwanted expression repression and, by combining transcription factor binding

sites, the promoters can be sensitive to several pre-determined stimuli143. Thus, it is easier to control

the levels of PDR18 expression and prevent the overexpression above a certain threshold which may

be disadvantageous for the cell physiological functions and viability. Furthermore, this study also

highlights the importance of the regulation of ERG genes under VHG fermentations which suggests that

genetic manipulation of transcription factors activating the ergosterol biosynthetic pathway would also

be a good strategy to improve yeast strains fermentative performance under VHG conditions.

43

6. Concluding Remarks

In this thesis work it was reinforced the determinant role of the ABC transporter Pdr18 for yeast

robustness towards industrially-relevant stresses. The importance of the expression of PDR18 for S.

cerevisiae thermo- and osmo-tolerance was herein reported. Transcriptional activation of several

ergosterol biosynthetic pathway genes was found to occur in the presence of supra-optimal

temperatures of growth for the pdr18Δ strain and in the presence of hyperosmotic stress-induced by

sugar for both the parental and pdr18Δ strains, unveiling a role for ergosterol in yeast cell response to

these stress factors. Although Pdr18 is herein described to be a determinant of yeast tolerance to

fermentation of high sugar concentrations, it was observed that its absence increases the uptake rate

of glucose for a given range of sugar present in the media, thus, the pdr18Δ strain exhibits improved

fermentation rates. Therefore, we hypothesize that PDR18 expression affects the activity and/or

expression of glucose transporters due to its role as a modulator of ergosterol content in the yeast

plasma membrane.

Overall, the PDR18 gene expression is a promising target for genetic manipulation to improve

fermentative performance of S. cerevisiae industrial strains under toxic environments. However, we

highlighted herein that it is of interest to rely on PDR18 gene over-expression only during the more

severe fermentation stages. In this work there were also highlighted transcription factors that may

regulate the transcription of PDR18 and ERG genes under thermal and osmotic stresses, which could

be a gateway to further studies aiming to comprehend the regulatory machinery behind the cell response

to these toxic conditions.

44

45

7. References

1. de Mendoza, D. & Pilon, M. Control of membrane lipid homeostasis by lipid-bilayer associated

sensors: A mechanism conserved from bacteria to humans. Prog. Lipid Res. 76, 100996 (2019).

2. Prasad, R., Khandelwal, N. K. & Banerjee, A. Yeast ABC transporters in lipid trafficking. Fungal

Genetics and Biology 93, (2016).

3. Gulshan, K. & Moye-Rowley, W. S. Multidrug resistance in fungi. Eukaryot. Cell 6, 1933–1942

(2007).

4. Lamping, E., Baret, P. V, Holmes, A. R., Monk, B. C., Goffeau, A. & Cannon, R. D. Fungal PDR

transporters: phylogeny, topology, motifs and function. 47, 1–36 (2011).

5. Moreno, A., Banerjee, A., Prasad, R. & Falson, P. PDR-like ABC systems in pathogenic fungi.

Res. Microbiol. (2019).

6. Piecuch, A. & Obłak, E. Yeast ABC proteins involved in multidrug resistance. Cell. Mol. Biol. Lett.

19, 1–22 (2014).

7. Roepe, P. D., Wei, L., Hoffman, M. M. & Fritz, F. Altered drug translocation mediated by the MDR

protein: Direct, indirect, or both? J. Bioenerg. Biomembr. 28, 541–555 (1996).

8. Godinho, C. P. & Sá-Correia, I. Physiological genomics of multistress resistance in the yeast cell

model and factory: focus on MDR/MXR transporters. Yeasts in Biotechnology and Human Health

– Physiological Genomic Approaches; Industrial Applications and Model Systems Section

(2019).

9. Godinho, C. P., Prata, C. S., Pinto, S. N., Cardoso, C., Bandarra, N. M., Fernandes, F. & Sá-

Correia, I. Pdr18 is involved in yeast response to acetic acid stress counteracting the decrease

of plasma membrane ergosterol content and order. Sci. Rep. 8, 1–13 (2018).

10. Godinho, C. P., Dias, P. J., Ponçot, E. & Sá-Correia, I. The paralogous genes PDR18 and SNQ2,

encoding multidrug resistance ABC transporters, derive from a recent duplication event, PDR18

being specific to the Saccharomyces genus. Front. Genet. 9, 1–17 (2018).

11. Cabrito, T. R., Teixeira, M. C., Singh, A., Prasad, R. & Sá-Correia, I. The yeast ABC transporter

Pdr18 (ORF YNR070w ) controls plasma membrane sterol composition, playing a role in

multidrug resistance. Biochem. J. 440, 195–202 (2011).

12. Hillenmeyer, M. E., Fung, E., Wildenhain, J., Pierce, S. E., Hoon, S., Lee, W., Proctor, M., St

Onge, R. P., Tyers, M., Koller, D., Altman, R. B., Davis, R. W., Nislow, C. & Giaever, G. The

Chemical Genomic Portrait of Yeast: Uncovering a Phenotype for All Genes. Science (80-. ).

320, 362–365 (2008).

13. Teixeira, M. C., Fernandes, A. R., Mira, N. P., Becker, J. D. & Sá-Correia, I. Early transcriptional

response of Saccharomyces cerevisiae to stress imposed by the herbicide 2,4-

dichlorophenoxyacetic acid. FEMS Yeast Res. 6, 230–248 (2006).

14. Teixeira, M. C., Godinho, C. P., Cabrito, T. R., Mira, N. P. & Sá-Correia, I. Increased expression

of the yeast multidrug resistance ABC transporter Pdr18 leads to increased ethanol tolerance

46

and ethanol production in high gravity alcoholic fermentation. Microb. Cell Fact. 11, 1–9 (2012).

15. Alvarez, F. J., Douglas, L. M. & Konopka, J. B. Sterol-Rich Plasma Membrane Domains in Fungi.

Eukaryot. Cell 6, 755–763 (2007).

16. Mattanovich, D., Sauer, M. & Gasser, B. Yeast biotechnology: Teaching the old dog new tricks.

Microb. Cell Fact. 13, 1–5 (2014).

17. Duina, A. A., Miller, M. E. & Keeney, J. B. Budding yeast for budding geneticists: A primer on the

Saccharomyces cerevisiae model system. Genetics 197, 33–48 (2014).

18. Teixeira, M. C., Cabrito, T. R. & Sá-Correia, I. Yeast as model eukaryote and expression host

system: is it still useful? Soc. Port. Microbiol. 2, 1–5 (2013).

19. Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W., Dujon, B., Feldmann, H., Galibert, F.,

Hoheisel, J. D., Jacq, C., Johnston, M., Louis, E. J., Mewes, H. W., Murakami, Y., Philippsen,

P., Tettelin, H. & Oliver, S. G. Life with 6000 Genes. Science (80-. ). 274, 546–567 (1996).

20. Kumar, A. & Snyder, M. Emerging technologies in yeast genomics. Nat. Rev. Genet. 2, 302–312

(2001).

21. Cherry, J. M., Hong, E. L., Amundsen, C., Balakrishnan, R., Binkley, G., Chan, E. T., Christie, K.

R., Costanzo, M. C., Dwight, S. S., Engel, S. R., Fisk, D. G., Hirschman, J. E., Hitz, B. C., Karra,

K., Krieger, C. J., Miyasato, S. R., Nash, R. S., Park, J., Skrzypek, M. S., Simison, M., Weng, S.

& Wong, E. D. Saccharomyces Genome Database: The genomics resource of budding yeast.

Nucleic Acids Res. 40, 700–705 (2012).

22. Teixeira, M. C., Monteiro, P. T., Palma, M., Costa, C., Godinho, C. P., Pais, P., Cavalheiro, M.,

Antunes, M., Lemos, A., Pedreira, T. & Sá-Correia, I. YEASTRACT: An upgraded database for

the analysis of transcription regulatory networks in Saccharomyces cerevisiae. Nucleic Acids

Res. 46, D348–D353 (2018).

23. Zhu, H., Bilgin, M., Bangham, R., Hall, D., Casamayor, A., Bertone, P., Lan, N., Jansen, R.,

Bidlingmaier, S., Houfek, T., Mitchell, T., Miller, P., Dean, R. A., Gerstein, M. & Snyder, M. Global

analysis of protein activities using proteome chips. Science (80-. ). 293, 2101–2105 (2001).

24. Huh, W., Falvo, J. V, Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J. S. & Shea, E. K.

O. Global analysis of protein localization in budding yeast. Nature 425, 686–691 (2003).

25. Kelly, D. E., Lamb, D. C. & Kelly, S. L. Genome-wide generation of yeast gene deletion strains.

Comp. Funct. Genomics 2, 236–242 (2001).

26. Kavšček, M., Stražar, M., Curk, T., Natter, K. & Petrovič, U. Yeast as a cell factory: Current state

and perspectives. Microb. Cell Fact. 14, 1–10 (2015).

27. Huang, W. D. & Percival Zhang, Y. H. Analysis of biofuels production from sugar based on three

criteria: Thermodynamics, bioenergetics, and product separation. Energy Environ. Sci. 4, 784–

792 (2011).

28. Zhang, C. Lignocellulosic Ethanol: Technology and Economics. Intech 209, 290–296 (2016).

29. Jansen, M. L. A., Bracher, J. M., Papapetridis, I., Verhoeven, M. D., de Bruijn, H., de Waal, P.

47

P., van Maris, A. J. A., Klaassen, P. & Pronk, J. T. Saccharomyces cerevisiae strains for second-

generation ethanol production: from academic exploration to industrial implementation. FEMS

Yeast Res. 17, 1–20 (2017).

30. Dalessandro, E. V. & Pliego, J. R. Fast screening of solvents for simultaneous extraction of

furfural, 5-hydroxymethylfurfural and levulinic acid from aqueous solution using SMD solvation

free energies. J. Braz. Chem. Soc. 29, 430–434 (2018).

31. Kim, H. S., Kim, S. K. & Jeong, G. T. Efficient conversion of glucosamine to levulinic acid in a

sulfamic acid-catalyzed hydrothermal reaction. RSC Adv. 8, 3198–3205 (2018).

32. Banerjee, N., Bhatnagar, R. & Viswanathan, L. Inhibition of glycolysis by furfural in

Saccharomyces cerevisiae. Eur. J. Appl. Microbiol. Biotechnol. 11, 226–228 (1981).

33. Almeida, J. R. M., Modig, T., Petersson, A., Hähn-Hägerdal, B., Lidén, G. & Gorwa-Grauslund,

M. F. Increased tolerance and conversion of inhibitors in lignocellulosic hydrolysates by

Saccharomyces cerevisiae. J. Chem. Technol. Biotechnol. 82, 340–349 (2007).

34. Koppram, R., Tomás-Pejó, E., Xiros, C. & Olsson, L. Lignocellulosic ethanol production at high-

gravity: Challenges and perspectives. Trends Biotechnol. 32, 46–53 (2014).

35. Robak, K. & Balcerek, M. Review of second generation bioethanol production from residual

biomass. Food Technol. Biotechnol. 56, 174–187 (2018).

36. Gibson, B. R., Lawrence, S. J., Leclaire, J. P. R., Powell, C. D. & Smart, K. A. Yeast responses

to stresses associated with industrial brewery handling. FEMS Microbiology Reviews 31, (2007).

37. Guo, Z. & Olsson, L. Physiological response of Saccharomyces cerevisiae to weak acids present

in lignocellulosic hydrolysate. FEMS Yeast Res. 14, 1234–1248 (2014).

38. Deparis, Q., Claes, A., Foulquié-Moreno, M. R. & Thevelein, J. M. Engineering tolerance to

industrially relevant stress factors in yeast cell factories. FEMS Yeast Res. 17, 1–17 (2017).

39. Puligundla, P., Smogrovicova, D., Obulam, V. S. R. & Ko, S. Very high gravity (VHG) ethanolic

brewing and fermentation: A research update. J. Ind. Microbiol. Biotechnol. 38, 1133–1144

(2011).

40. Van Uden, N. Temperature Profiles of Yeasts. Adv. Microb. Physiol. 25, 195–251 (1985).

41. Gündüz Ergün, B., Hüccetoğulları, D., Öztürk, S., Çelik, E. & Çalık, P. Established and upcoming

yeast expression systems. Methods in Molecular Biology 1923, (2019).

42. Matsumoto, I., Arai, T., Nishimoto, Y., Leelavatcharamas, V., Furuta, M. & Kishida, M.

Thermotolerant yeast Kluyveromyces marxianus reveals more tolerance to heat shock than the

brewery yeast Saccharomyces cerevisiae. Biocontrol Sci. 23, 133–138 (2018).

43. Martorell, P., Stratford, M., Steels, H., Fernández-Espinar, M. T. & Querol, A. Physiological

characterization of spoilage strains of Zygosaccharomyces bailii and Zygosaccharomyces rouxii

isolated from high sugar environments. Int. J. Food Microbiol. 114, 234–242 (2007).

44. Lindahl, L., Genheden, S., Eriksson, L. A., Olsson, L. & Bettiga, M. Sphingolipids contribute to

acetic acid resistance in Zygosaccharomyces bailii. Biotechnol. Bioeng. 113, 744–753 (2016).

48

45. S.J. Singer, G. L. N. The Fluid Mosaic Model of the Structure of Cell Membranes. Science 175,

720-731 (1972).

46. Spira, F., Mueller, N. S., Beck, G., Von Olshausen, P., Beig, J. & Wedlich-Söldner, R. Patchwork

organization of the yeast plasma membrane into numerous coexisting domains. Nat. Cell Biol.

14, 640–648 (2012).

47. Asymmetry, L. & Membranes, I. N. Lipid Asymmetry in Membranes. Lipids 48, 47–71 (1979).

48. Contreras, F. X., Sánchez-Magraner, L., Alonso, A. & Goñi, F. M. Transbilayer (flip-flop) lipid

motion and lipid scrambling in membranes. FEBS Lett. 584, 1779–1786 (2010).

49. Klappe, K., Hummel, I., Hoekstra, D. & Kok, J. W. Lipid dependence of ABC transporter

localization and function. Chem. Phys. Lipids 161, 57–64 (2009).

50. Dupont, S., Beney, L., Ferreira, T. & Gervais, P. Nature of sterols affects plasma membrane

behavior and yeast survival during dehydration. Biochim. Biophys. Acta - Biomembr. 1808,

1520–1528 (2011).

51. Yang, H., Tong, J., Lee, C. W., Ha, S., Eom, S. H. & Im, Y. J. Structural mechanism of ergosterol

regulation by fungal sterol transcription factor Upc2. Nat. Commun. 6, 1–13 (2015).

52. Yang, H., Bard, M., Bruner, D. A., Gleeson, A., Deckelbaum, R. J., Aljinovic, G., Pohl, T. M.,

Rothstein, R. & Sturley, S. L. Sterol esterification in yeast: A two-gene process. Science (80-. ).

272, 1353–1356 (1996).

53. Köffel, R., Tiwari, R., Falquet, L. & Schneiter, R. TGL1 Genes Encode a Novel Family of

Membrane-Anchored Lipases That Are Required for Steryl Ester Hydrolysis. Mol. Cell Biol. 25,

1655–1668 (2005).

54. Montañés, F. M., Pascual-Ahuir, A. & Proft, M. Repression of ergosterol biosynthesis is essential

for stress resistance and is mediated by the Hog1 MAP kinase and the Mot3 and Rox1

transcription factors. Mol. Microbiol. 79, 1008–1023 (2011).

55. Sullivan, D. P., Georgiev, A. & Menon, A. K. Tritium suicide selection identifies proteins involved

in the uptake and intracellular transport of sterols in Saccharomyces cerevisiae. Eukaryot. Cell

8, 161–169 (2009).

56. Tsuge, Y., Kawaguchi, H., Sasaki, K. & Kondo, A. Engineering cell factories for producing

building block chemicals for bio-polymer synthesis. Microb. Cell Fact. 15, 1–12 (2016).

57. Kulkarni, C. V. Lipid crystallization: From self-assembly to hierarchical and biological ordering.

Nanoscale 4, 5779–5791 (2012).

58. Laroche, C., Beney, L., Marechal, P. A. & Gervais, P. The effect of osmotic pressure on the

membrane fluidity of Saccharomyces cerevisiae at different physiological temperatures. Appl.

Microbiol. Biotechnol. 56, 249–254 (2001).

59. Eze, M. O. Phase Transitions in Phospholipid Bilayers: Lateral Phase Separations Play Vital

Roles in Biomembranes. Biochem. Educ. 19, 204–208 (1991).

60. Adya, A. K., Canetta, E. & Walker, G. M. Atomic force microscopic study of the infuence of

49

physical stresses on Saccharomyces cerevisiae and Schizosaccharomyces pombe. FEMS

Yeast Res. 6, 120–128 (2006).

61. PIPER, P. W. the Heat-Shock and Ethanol Stress Responses of Yeast Exhibit Extensive

Similarity and Functional Overlap. Fems Microbiol. Lett. 134, 121–127 (1995).

62. Vanegas, J. M., Contreras, M. F., Faller, R. & Longo, M. L. Role of unsaturated lipid and

ergosterol in ethanol tolerance of model yeast biomembranes. Biophys. J. 102, 507–516 (2012).

63. Stanley, D., Bandara, A., Fraser, S., Chambers, P. J. & Stanley, G. A. The ethanol stress

response and ethanol tolerance of Saccharomyces cerevisiae. J. Appl. Microbiol. 109, 13–24

(2010).

64. Viegas, C. A. & Sa-Correia, I. Activation of plasma membrane ATPase of Saccharomyces

cerevisiae by octanoic acid. J. Gen. Microbiol. 137, 645–651 (1991).

65. Cartwright, C. P., Juroszek, J.-R., Beavan, M. J., Ruby, F. M. S., de Morais, S. M. F. & Rose, A.

H. Ethanol Dissipates the Proton-motive Force across the Plasma Membrane. J. Genera 132,

369–377 (1986).

66. Morano, K. A., Grant, C. M. & Moye-Rowley, W. S. The response to heat shock and oxidative

stress in Saccharomyces cerevisiae. Genetics 190, 1157–1195 (2012).

67. Auesukaree, C. Molecular mechanisms of the yeast adaptive response and tolerance to stresses

encountered during ethanol fermentation. J. Biosci. Bioeng. 124, 133–142 (2017).

68. Posas, F., Chamber, J. R., Heyman, J. A., Hoeffler, J. P., De Nadal, E. & Ariño, J. The

transcriptional response of yeast to saline stress. J. Biol. Chem. 275, 17249–17255 (2000).

69. Wera, S., De Schrijver, E., Geyskens, I., Nwaka, S. & Thevelein, J. M. Opposite roles of trehalase

activity in heat-shock recovery and heat-shock survival in Saccharomyces cerevisiae. Biochem.

J. 343, 621–626 (1999).

70. Swan, T. M. & Watson, K. Stress tolerance in a yeast sterol auxotroph: Role of ergosterol, heat

shock proteins and trehalose. FEMS Microbiol. Lett. 169, 191–197 (1998).

71. Becerra, M., Lombardía, L. J., González-Siso, M. I., Rodríguez-Belmonte, E., Hauser, N. C. &

Cerdán, M. E. Genome-wide analysis of the yeast transcriptome upon heat and cold shock.

Comp. Funct. Genomics 4, 366–375 (2003).

72. Caspeta, L., Chen, Y., Ghiaci, P., Feizi, A., Baskov, S., Hallström, B. M., Petranovic, D. &

Nielsen, J. Altered sterol composition renders yeast thermotolerant. Science (80-. ). 346, 75–78

(2014).

73. Hohmann, S. & Mager, W. H. Osmotic Stress Signaling and Osmoadaptation in Yeasts.

Microbiol. Mol. Biol. Rev. 66, 300–372 (2002).

74. Klipp, E., Nordlander, B., Krüger, R., Gennemark, P. & Hohmann, S. Integrative model of the

response of yeast to osmotic shock. Nat. Biotechnol. 23, 975–982 (2005).

75. Maeda, T., Takekawa, M. & Saito, H. Activation of yeast PBS2 MAPKK by MAPKKKs or by

binding of an SH3-containing osmosensor. Science (80-. ). 269, 554–558 (1995).

50

76. Saito, H. & Posas, F. Response to hyperosmotic stress. Genetics 192, 289–318 (2012).

77. Rep, M., Krantz, M., Thevelein, J. M. & Hohmann, S. The Transcriptional Response of

Saccharomyces cerevisiae to Osmotic Shock . J. Biol. Chem. 275, 8290–8300 (2000).

78. Klipp, E. & Liebermeister, W. Mathematical modeling of intracellular signaling pathways. BMC

Neurosci. 7, 1–16 (2006).

79. Jungwirth, H. & Kuchler, K. Yeast ABC transporters - A tale of sex, stress, drugs and aging.

FEBS Lett. 580, 1131–1138 (2006).

80. Linton, K. J. Structure and Function of ABC Transporters. Physiology 22, 122–130 (2007).

81. Locher, K. P. Structure and mechanism of ATP-binding cassette transporters. Philos. Trans. R.

Soc. 364, 239–245 (2009).

82. Paumi, C. M., Chuk, M., Snider, J., Stagljar, I. & Michaelis, S. ABC Transporters in

Saccharomyces cerevisiae and Their Interactors: New Technology Advances the Biology of the

ABCC (MRP) Subfamily. Microbiol. Mol. Biol. Rev. 73, 577–593 (2009).

83. Kovalchuk, A. & Driessen, A. J. M. Phylogenetic analysis of fungal ABC transporters. BMC

Genomics 11, (2010).

84. dos Santos, S. C., Teixeira, M. C., Dias, P. J. & Sá-Correia, I. MFS transporters required for

multidrug/multixenobiotic (MD/MX) resistance in the model yeast: Understanding their

physiological function through post-genomic approaches. Front. Physiol. 5 MAY, 1–15 (2014).

85. Sá-Correia, I., dos Santos, S. C., Teixeira, M. C., Cabrito, T. R. & Mira, N. P. Drug:H+ antiporters

in chemical stress response in yeast. Trends Microbiol. 17, 22–31 (2009).

86. Kolaczkowski, M., Kolaczkowska, A., Luczynski, J., Witek, S. & Goffeau, A. In Vivo

Characterization of the Drug Resistance Profile of the Major ABC Transporters and Other

Components of the Yeast Pleiotropic Drug Resistance Network. Microb. Drug Resist. 4, 143–

158 (1998).

87. Hlaváček, O., Kučerová, H., Harant, K., Palková, Z. & Váchová, L. Putative role for ABC multidrug

exporters in yeast quorum sensing. FEBS Lett. 583, 1107–1113 (2009).

88. Higgins, C. F. Multiple molecular mechanisms for multidrug resistance transporters. Nature 446,

749–757 (2007).

89. Kuchler, K., Sterne, R. E. & Thorner, J. Saccharomyces cerevisiae STE6 gene product: a novel

pathway for protein export in eukaryotic cells. EMBO J. 8, 3973–3984 (1989).

90. Hettema, E. H., van Roermund, C. W., Distel, B., van den Berg, M., Vilela, C., Rodrigues-

Pousada, C., Wanders, R. J. & Tabak, H. F. The ABC transporter proteins Pat1 and Pat2 are

required for import of long-chain fatty acids into peroxisomes of Saccharomyces cerevisiae.

EMBO J. 15, 3813–22 (1996).

91. Sherlach, K. S. & Roepe, P. D. ‘Drug resistance associated membrane proteins’. Front. Physiol.

5 MAR, (2014).

92. Seret, M. L., Diffels, J. F., Goffeau, A. & Baret, P. V. Combined phylogeny and neighborhood

51

analysis of the evolution of the ABC transporters conferring multiple drug resistance in

hemiascomycete yeasts. BMC Genomics 10, 459 (2009).

93. Decottignies, A., Grant, A. M., Nichols, J. W., De Wet, H., McIntosh, D. B. & Goffeau, A. ATPase

and multidrug transport activities of the overexpressed yeast ABC protein Yor1p. J. Biol. Chem.

273, 12612–12622 (1998).

94. Kaur, R. & Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug

resistance in. Construction 809–818 (1999).

95. Mahé, Y., Lemoine, Y. & Kuchler, K. The ATP binding cassette transporters Pdr5 and Snq2 of

Saccharomyces cerevisiae can mediate transport of steroids in vivo. J. Biol. Chem. 271, 25167–

25172 (1996).

96. Schuller, C., Mamnun, Y. M., Wolfger, H., Rockwell, N. C., Thorner, J. & Kuchler, K. Membrane-

active Compounds Activate the Transcription Factors Pdr1 and Pdr3 Connecting Pleiotropic Drug

Resistance and Membrane Lipid Homeostasis in Saccharomyces cerevisiae. Mol. Biol. Cell 18,

4932–4944 (2007).

97. Rockwell, N. C., Wolfger, H., Kuchler, K. & Thorner, J. ABC transporter pdr10 regulates the

membrane microenvironment of pdr12 in Saccharomyces cerevisiae. J. Membr. Biol. 229, 27–

52 (2009).

98. Hazelwood, L. A., Tai, S. L., Boer, V. M., De Winde, J. H., Pronk, J. T. & Daran, J. M. A new

physiological role for Pdr12p in Saccharomyces cerevisiae: Export of aromatic and branched-

chain organic acids produced in amino acid catabolism. FEMS Yeast Res. 6, 937–945 (2006).

99. Snider, J., Hanif, A., Lee, M. E., Jin, K., Yu, A. R., Graham, C., Chuk, M., Damjanovic, D.,

Wierzbicka, M., Tang, P., Balderes, D., Wong, V., Jessulat, M., Darowski, K. D., San Luis, B.-J.,

Shevelev, I., Sturley, S. L., Boone, C., Greenblatt, J. F., Zhang, Z., Paumi, C. M., Babu, M., Park,

H.-O., Michaelis, S. & Stagljar, I. Mapping the functional yeast ABC transporter interactome. Nat.

Chem. Biol. 9, 565–572 (2013).

100. Wilcox, L. J., Balderes, D. A., Wharton, B., Tinkelenberg, A. H., Rao, G. & Sturley, S. L.

Transcriptional profiling identifies two members of the ATP-binding cassette transporter

superfamily required for sterol uptake in yeast. J. Biol. Chem. 277, 32466–32472 (2002).

101. Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H.,

Stagljar, I., Granato, J. T., Ruggles, K. V., Degiorgis, J. A., Kohlwein, S. D., Schon, E. A. &

Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at

membrane microdomains to modulate sterol uptake and esterification. FASEB J. 29, 4682–4694

(2015).

102. Delaveau, T., Delahodde, A., Carvajal, E., Subik, J. & Jacq, C. PDR3, a new yeast regulatory

gene, is homologous to PDR1 and controls the multidrug resistance phenomenon. MGG Mol.

Gen. Genet. 244, 501–511 (1994).

103. Balzis, E., Chen, W., Ulaszewskit, S., Capieaux, E. & Goffeaust, A. The Multidrug Resistance

Gene PDR1 from Saccharomyces cerevisiae. J. Biol. Chem. 262, 16871–16879 (1987).

52

104. Kolaczkowska, A. & Goffeau, A. Regulation of pleiotropic drug resistance in yeast. Drug Resist.

Updat. 2, 403–414 (1999).

105. Akache, B., MacPherson, S., Sylvain, M. A. & Turcotte, B. Complex interplay among regulators

of drug resistance genes in Saccharomyces cerevisiae. J. Biol. Chem. 279, 27855–27860

(2004).

106. Kihara, A. & Igarashi, Y. Cross Talk between Sphingolipids and Glycerophospholipids in the

Establishment of Plasma Membrane Asymmetry. Mol. Biol. Cell 15, 4949–4959 (2004).

107. Walsh, M. C., Smits, H. P., Scholte, M. & Van Dam, K. Affinity of glucose transport in

Saccharomyces cerevisiae is modulated during growth on glucose. J. Bacteriol. 176, 953–958

(1994).

108. Kohrer, K. & Domdey, H. Preparation of high molecular weight RNA. Methods Enzymol. 398–

405 (1991).

109. Balzi, E. & Goffeau, A. Yeast multidrug resistance: The PDR network. J. Bioenerg. Biomembr.

27, 71–76 (1995).

110. Alenquer, M., Tenreiro, S. & Sá-Correia, I. Adaptive response to the antimalarial drug artesunate

in yeast involves Pdr1p/Pdr3p-mediated transcriptional activation of the resistance determinants

TPO1 and PDR5. FEMS Yeast Res. 6, 1130–1139 (2006).

111. Ma, M. & Liu, Z. L. Comparative transcriptome profiling analyses during the lag phase uncover

YAP1, PDR1, PDR3, RPN4, and HSF1 as key regulatory genes in genomic adaptation to the

lignocellulose derived inhibitor HMF for Saccharomyces cerevisiae. BMC Genomics 11, 660

(2010).

112. Gomar-Alba, M., Morcillo-Parra, M. Á. & del Olmo, M. lí. Response of yeast cells to high glucose

involves molecular and physiological differences when compared to other osmostress

conditions. FEMS Yeast Res. 15, 1–14 (2015).

113. Gasch, A. P., Spellman, P. T., Kao, C. M., Carmel-Haren, O., Eisen, M. B., Storz, G., Botstein,

D. & Brown, P. O. Genomic Expression Programs in the Response of Yeast Cells to

Environmental Changes. Mol. Biol. Cell 11, 4241–4257 (2000).

114. Palma, M., Madeira, S. C., Mendes-Ferreira, A. & Sá-Correia, I. Impact of assimilable nitrogen

availability in glucose uptake kinetics in Saccharomyces cerevisiae during alcoholic

fermentation. Microb. Cell Fact. 11, 1 (2012).

115. Perez, M., Luyten, K., Michel, R., Riou, C. & Blondin, B. Analysis of Saccharomyces cerevisiae

hexose carrier expression during wine fermentation: Both low- and high-affinity Hxt transporters

are expressed. FEMS Yeast Res. 5, 351–361 (2005).

116. Zhang, K., Tong, M., Gao, K., Di, Y., Wang, P., Zhang, C., Wu, X. & Zheng, D. Genomic

reconstruction to improve bioethanol and ergosterol production of industrial yeast

Saccharomyces cerevisiae. J. Ind. Microbiol. Biotechnol. 42, 207–218 (2015).

117. Mira, N. P., Palma, M., Guerreiro, J. F. & Sá-Correia, I. Genome-wide identification of

53

Saccharomyces cerevisiae genes required for tolerance to acetic acid. Microb. Cell Fact. 9, 79

(2010).

118. Palma, M., Guerreiro, J. F. & Sá-Correia, I. Adaptive response and tolerance to acetic acid in

Saccharomyces cerevisiae and Zygosaccharomyces bailii: A physiological genomics

perspective. Front. Microbiol. 9, 1–16 (2018).

119. Richter, K., Haslbeck, M. & Buchner, J. The Heat Shock Response: Life on the Verge of Death.

Mol. Cell 40, 253–266 (2010).

120. Hahn, J.-S., Hu, Z., J. Thiele, D. & R. Iyer, V. Genome-Wide Analysis of the Biology of Stress

Responses through Heat Shock Transcription Factor. Mol. Cell Biol. 24, 5249–5256 (2004).

121. Yoshikawa, K., Tanaka, T., Furusawa, C., Nagahisa, K., Hirasawa, T. & Shimizu, H.

Comprehensive phenotypic analysis for identification of genes affecting growth under ethanol

stress in Saccharomyces cerevisiae. FEMS Yeast Res. 9, 32–44 (2009).

122. Święciło, A. Cross-stress resistance in Saccharomyces cerevisiae yeast—new insight into an old

phenomenon. Cell Stress Chaperones 21, 187–200 (2016).

123. Beney, L. & Gervais, P. Influence of the fluidity of the membrane on the response of

microorganisms to environmental stresses. Appl. Microbiol. Biotechnol. 57, 34–42 (2001).

124. Worley, J., Luo, X. & Capaldi, A. P. Inositol Pyrophosphates Regulate Cell Growth and the

Environmental Stress Response by Activating the HDAC Rpd3L. Cell Rep. 3, 1476–1482 (2013).

125. Causton, H. C., Ren, B., Sang Seok Koh, Harbison, C. T., Kanin, E., Jennings, E. G., Tong Ihn

Lee, True, H. L., Lander, E. S. & Young, R. A. Remodeling of yeast genome expression in

response to environmental changes. Mol. Biol. Cell 12, 323–337 (2001).

126. Yamamoto, A., Mizukami, Y. & Sakurai, H. Identification of a novel class of target genes and a

novel type of binding sequence of heat shock transcription factor in Saccharomyces cerevisiae.

J. Biol. Chem. 280, 11911–11919 (2005).

127. Hu, Z., He, B., Ma, L., Sun, Y., Niu, Y. & Zeng, B. Recent Advances in Ergosterol Biosynthesis

and Regulation Mechanisms in Saccharomyces cerevisiae. Indian J. Microbiol. 57, 270–277

(2017).

128. Mukherjee, V., Radecka, D., Aerts, G., Verstrepen, K. J., Lievens, B. & Thevelein, J. M.

Phenotypic landscape of non-conventional yeast species for different stress tolerance traits

desirable in bioethanol fermentation. Biotechnol. Biofuels 10, 1–19 (2017).

129. Brion, C., Pflieger, D., Souali-Crespo, S., Friedrich, A. & Schacherer, J. Differences in

environmental stress response among yeasts is consistent with species-specific lifestyles. Mol.

Biol. Cell 27, 1694–1705 (2016).

130. Zhang, Q., Bhattacharya, S., Pi, J., Clewell, R. A., Carmichael, P. L. & Andersen, M. E. Adaptive

posttranslational control in cellular stress response pathways and its relationship to toxicity

testing and safety assessment. Toxicol. Sci. 147, 302–316 (2015).

131. Taymaz-Nikerel, H., Cankorur-Cetinkaya, A. & Kirdar, B. Genome-Wide Transcriptional

54

Response of Saccharomyces cerevisiae to Stress-Induced Perturbations. Front. Bioeng.

Biotechnol. 4, (2016).

132. Chen, T., Li, F. & Chen, B. Sen. Cross-talks of sensory transcription networks in response to

various environmental stresses. Interdiscip. Sci. Comput. Life Sci. 1, 46–54 (2009).

133. Jarolim, S., Ayer, A., Pillay, B., Gee, A. C., Phrakaysone, A., Perrone, G. G., Breitenbach, M. &

Dawes, I. W. Saccharomyces cerevisiae genes involved in survival of heat shock. G3 Genes,

Genomes, Genet. 3, 2321–2333 (2013).

134. Sathe, L., Bolinger, C., Amin-Ul Mannan, M., Dever, T. E. & Dey, M. Evidence that base-pairing

interaction between intron and mRNA leader sequences inhibits initiation of HAC1 mRNA

translation in yeast. J. Biol. Chem. 290, 21821–21832 (2015).

135. Stephen, D. W. S., Rivers, S. L. & Jamieson, D. J. The role of the YAP1 and YAP2 genes in the

regulation of the adaptive oxidative stress responses of Saccharomyces cerevisiae. Mol.

Microbiol. 16, 415–423 (1995).

136. Wu, G., Xu, Z. & Jönsson, L. J. Profiling of Saccharomyces cerevisiae transcription factors for

engineering the resistance of yeast to lignocellulose-derived inhibitors in biomass conversion.

Microb. Cell Fact. 16, 1–15 (2017).

137. Lauwers, E. & André, B. Association of yeast transporters with detergent-resistant membranes

correlates with their cell-surface location. Traffic 7, 1045–1059 (2006).

138. Yan, Q., Lu, Y., Zhou, L., Chen, J., Xu, H., Cai, M., Shi, Y., Jiang, J., Xiong, W., Gao, J. & Wang,

H. Mechanistic insights into GLUT1 activation and clustering revealed by super-resolution

imaging. Proc. Natl. Acad. Sci. U. S. A. 115, 7033–7038 (2018).

139. Yuan, T., Hong, S., Yao, Y. & Liao, K. Glut-4 is translocated to both caveolae and non-caveolar

lipid rafts, but is partially internalized through caveolae in insulin-stimulated adipocytes. Cell Res.

17, 772–782 (2007).

140. Runner, V. M. & Brewster, J. L. A genetic screen for yeast genes induced by sustained osmotic

stress. Yeast 20, 913–920 (2003).

141. Szopinska, A., Degand, H., Hochstenbach, J. F., Nader, J. & Morsomme, P. Rapid response of

the yeast plasma membrane proteome to salt stress. Mol. Cell. Proteomics 10, (2011).

142. Stracke, R., Thiedig, K. & Kuhlmann, M. Plant Synthetic Promoters. Plant Synth. Promot. 1482,

67–81 (2016).

143. Ottoz, D. S. M. & Rudolf, F. Constitutive and regulated promoters in yeast: How to design and

make use of promoters in S. cerevisiae. Synth. Biol. Parts, Devices Appl. 109–130 (2018).