synthetic oligonucleotides recreate expression

Synthetic oligonucleotides recreate Drosophila fushi tarazu zebra-stripe expression Joanne T o p o i , ~'2 Char le s R. Dearo l f , 2,s K u l k a r n i Prakash , and Carl S. Parker

Division of Chemistry and 1Division of Biology, California Institute of Technology, Pasadena, California 91125 USA

A complex array of activator and repressor e lements located within 669 bp proximal to the jfiashi tarazu (ftz) transcriptional start site is sufficient to generate the "zebra-stripe" expression pattern characteristic of the ftz gene. P-element-mediated transformation and ftz promoter/lacZ fusion genes were used to characterize, in detail, several of these transcriptional control elements. By reconstructing promoters with synthetic oligonucleotides containing c/s-regulators of stripe expression, we show that these regulatory sites can function as independent units to direct position-specific transcription in the Drosophila embryo. In particular, we demonstrate that mult iple copies of a positive regulatory site can mediate expression in both the odd- and even-numbered parasegments throughout most of the germ band and that negative regulatory sites can transform a continuous pattern of gene expression into discrete stripes. The reconstructed promoter system presented provides an effective means of studying molecular mechanisms governing spatially restricted transcription in the early embryo.

[Key Words: Drosophila; ftz gene; stripe expression; repression]

Received November 16, 1990; revised version accepted February 8, 1991.

The molecular processes governing cell-fate specifica- tion along the longitudinal axis of the Drosophila embryo are controlled by a set of genes that are expressed in a spatially restricted manner early in embryogenesis (for review, see Scott and O'Farrell 1986; Akam 1987; Scott and Carroll 1987; Ingham 1988). The result of such position-specific gene expression is the delineation of discrete spatial domains within the developing embryo that ult imately define the body plan of the fruit fly. It is known that the spatially restricted expression patterns of these early-acting genes are generated by a network of regulatory interactions that, in many cases, take place at the transcriptional level (for review, see Prakash et al. 1991). However, the precise molecular mechanisms responsible for forming these restricted patterns of gene expression are not yet known.

The pair-rule segmentation gene fushi tarazu (ftz) is a member of this regulatory network; it has a restricted pattern of transcription that evolves from a continuous band of expression into seven discrete stripes during early embryogenesis (Hafen et al. 1984; Weir and Korn- berg 1985). Because the promoter sequences sufficient to generate the ftz stripe pattern are situated within 669 bp from the transcription start site (Hiromi et al. 1985; Dearolf et al. 1989b), the ftz gene provides an excellent

2The first two authors made equivalent contributions to this work. 3Present address: Cancer Biology Division, Joint Center for Radiation Therapy, and Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 02115 USA.

system in which to study the regulatory mechanisms governing position-specific transcription during embryogenesis.

The transcriptional control mechanisms that direct spatially restricted transcription in the early embryo are not only important for specifying embryonic cell fates. It is likely these regulatory mechanisms also play a critical role in forming and maintaining tissue-specific gene expression during the differentiation of all types of cells (Maniatis et al. 1987; Ptashne 1988; Mitchell and Tjian 1989). Therefore, a system such as that provided by ftz, which allows one to reduce the complex array of molecular interactions mediating position-specific transcription to experimentally tractable units, may lead to a better understanding of a fundamental process taking place in development.

Spatially restricted transcription can be established either by localized transcriptional activation or by a combination of global activation and localized transcriptional repression. It is likely that both mechanisms are utilized in the regulation of Drosophila segmentation genes (for review, see Carroll 1990). In the case of ftz, it appears that the combination of global activation and localized repression is the primary mechanism mediating stripe formation (for review, see Dearolf et al. 1990). The global activation of ftz expression is controlled by transcriptional regulators that function in both the odd- and even-numbered parasegments, whereas the localized repression of ftz expression appears to be controlled pri-

GENES & DEVELOPMENT 5:855-867 © 1991 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/91 $3.00 855

Cold Spring Harbor Laboratory Press on February 15, 2018 - Published by genesdev.cshlp.orgDownloaded from

http://genesdev.cshlp.org/

http://www.cshlpress.com

Topoi et al.

marily by negative regulators expressed in periodic stripe patterns. This model is supported by the temporal pattern of ftz RNA stripe formation in the early embryo (Weir and Komberg 1985}, by studies using inhibitors of protein synthesis {Edgar et al. 19861, as well as by our previous in vivo dissection of the ftz zebra element promoter region (Dearolf et al. 1989b).

Here, we provide molecular details that reveal how both the activator and repressor functions sufficient to generate a stripe pat tem of transcription are encoded in the ftz promoter. We have identified three contiguous regulatory sites within the promoter that play a critical role in this process of stripe formation. One of these sites increases the level of transcription throughout most of the region of ftz expression, another site mediates repression of transcription in each ftz interstripe region within the embryo, and a third site does both. In addition, we find that multiple copies of these regulatory elements, ligated to portions of the endogenous ftz promoter, can act independently to mediate position-specific transcription, and that at least one of the repressor sites appears to require the product of the hairy (h) locus for stripe formation.

Results

Deletion studies

In previous studies on the regulation of ftz transcription, we found that the proximal promoter region sufficient to generate a seven-stripe expression pattem (primarily in the presumptive mesoderm; Hiromi et al. 1985) contains multiple activator and repressor domains (Dearolf et al. 1989a, b). This region, originally defined by Hiromi et al. {1985} as the "zebra element", also contains at least 15 protein-recognition sites that are specifically recognized by DNA-binding proteins present in embryonic nuclear extracts (Topol et al. 1987; Harrison and Travers 1990; Ueda et al. 1990; Figure 2; J. Topoi et al., unpubl.). The protein-binding sites found within the functional regulatory region of the "zebra-stripe" promoter are summa- rized in Figure 1.

One region of the zebra-stripe promoter was chosen for detailed analysis because it exhibited an important role in both the activation of expression in the germ band and in the repression of expression in the interstripes. We have designated this the A-R region {Fig. 1; defined as A3-R1 in Dearolf et al. 1989b). When this region is deleted from ftz/IacZ fusion genes, a reduction in B-galactosidase expression as well as a derepressed expression pat tem is observed in transformed embryos (Dearolf et al. 1989b).

DNase I footprinting assays reveal that at least three protein recognition sites are located within the A-R region (Figs. 1 and 2, between - 3 5 9 and - 2 7 2 bp). We have used P-element-mediated transformation of ftz/ IacZ fusion genes to correlate promoter elements containing a single protein-binding site with cis-acting regulatory functions. The three elements are referred to as fAE3, fRE1, and fDE1, depending on whether the ftz (f)

promoter element (E) possesses an activating function (A), a repressing function (R), or a dual activating and repressing function (D). It is likely that the DNA-binding proteins generating the A-R region footprints are, at least in part, responsible for the regulatory activities of that region. However, it is also possible that altemate or additional regulatory proteins, not detected by the in vitro footprinting assay, recognize these elements in vivo.

The initial functional assignments of the regulatory sites were made using two types of deletion constructs: successive 5' and 3' deletions of the ftz promoter in which the deletion end points lie between adjacent protein-binding sites, and internal deletions in which one or two of the sites are removed {Fig. 3). The expression pattem of each transformant line was determined by J3-galactosidase staining of embryos {Fig. 4). In addition, the B-galactosidase activity was quantitated for selected transformant lines {Table 1). The patterns generated by the 3' deletions show a strong posterior preference, whereas those generated by the 5' deletions do not; this is due to the presence of caudal (cad) protein DNA-recognition elements {CDRE) in the 3' constructs that promote expression preferentially in the posterior region of the embryo (Dearolf et al. 1989a), and the lack of those elements in the 5' constructs. B-Galactosidase expression appearing anterior to the cephalic furrow is not considered in this study.

Results from our previous promoter deletion study indicate that although activator function can be reduced by changing the spacing between the upstream regulatory sites and the transcriptional start site, repressor function is not changed by such alterations (Dearolf et al. 1989b). Thus, because the 3' and intemal deletions were primarily used to detect a loss of repression, the spacing in those constructs was generally not restored. One excep- tion is the AfDE1 construct, which was analyzed for both loss of activation and loss of repression. In this construct, the precise number of deleted base pairs was re- placed by sequences from a polylinker. In the 5' deletions, spacing is not a factor because DNA splicing has not occurred within the ftz promoter sequences. The results of these deletion studies are described below.

The deletion of the fAE3 site (the distal-most site in the A-R region) results in a notable loss of B-galactosidase expression {determined by the quantitation of the I3-galactosidase activity in transformed embryos; Topol 1990), suggesting that fAE3 serves as an activator-recognition element. Deletion of this site does not, however, cause detectable ectopic expression in the interstripe regions (Fig. 4, 5'A-322), indicating that fAE3 is not likely to be a repressor-binding site. The fAE3 protein-binding site contains two copies of the GAGAG/ CTCTC DNA sequence motif found in the promoters of other Drosophila genes (Biggin and Tjian 1988; Soeller et al. 1988; Gilmour et al. 1989). A protein that binds to this motif has been purified and shown in cell-free sys- tems to be a transcriptional activator of the engrafted (en) (Soeller et al. 1988) and Ultrabithorax (Ubx) (Biggin and Tjian 1988) genes. This purified protein also recog-

856 GENES & DEVELOPMENT




Recreation of ftz zebra-stripe expression

-669 -600

I I !

-500 / - - 4 . ,

\""T " I V f A E 1 fAE2a

(CDRE)

OR SITE ! i | I

-400 i -300 -200 -100 +1

,. ".21 y " (CDRE) I fDE1

I I t

I A-R Region

>

ftz Zebra Element Protein Binding Sites

Within Activator Regions

(fAE1) N.D. fRE 1

-4~ = I

fAE2a ATTTTTAGGGAACCATAAACGG ( C D R E ) TAAAAATCCCTTGGTATTTGCC fDE1

1 -477 -~5

fAE2b GTTTTTATGTCTTTATGATT fRE2 ( C D R E ) CAAAAATACAGAAATACTAA

I -404 -329

I fAE3 CGGCTGAGAGTCGCGCCCTCTCGCTCTGCGCACCTCAT fRE3

TAGCCGACTCTCAGCGCGGGAGAGCGAGAC I

-368 -274 I

fDE1 TCAAGGTCGCCGAGTA GCAGAGTTCCAGC GGC fDE2 I

-293 -131 I

CTGCAAGGACATTTCG fDE2 CGGACGTTCCTGTAAAGCG

I - 1 4 9 - 7 4 - 3 4

I I GGATATTTATGC CCGAGGGCTCTCTGATTTTG

( fAE4) TCCCTATAAATAC CGGCTCCCGAGAGACT I I

-87 -54

Within Repressor Regions

-299 I

GGCCGTAATTACTGC CCGGCATTAATGACG I

-313 -274 I

TCAAGGTCGCCGAGTA GCAGAGTTCCAGCGGC I

-293 -234 I

GCGGATAAATCGCGATGATAATGGGC CGCCCGCCTATTTAGCGCTACTATTAC L ~

-263 -159 I

CGTACGGATAAAGTTGCCAGGACCTCGGATAACTTCC CATGCCTATTTCAACGGTCCTGGAGCCTATTGAAGG

I -195 -131

I CTGCAAGGACATTTCG

CGGACGTTCCTGTAAAGCG I

- 1 4 9

Figure 1. Protein-binding sites within activator and/or repressor regions in the ftz zebra-stripe promoter. In the schematic diagram of the ftz zebra-stripe promoter, activator sites are indicated by ovals; repressor sites are indicated by diamonds. Regulatory sites containing similar DNA sequence motifs are shaded with the same pattern. The protein-binding sites listed below the diagram include the sequences protected by DNase I in the footprint reactions. Protected regions on both strands are included. Lines and arrows above and below sequences indicate the location of the conserved DNA motifs described in the text. Numbers denote the distance in base pairs from the start point of transcription. Broken circles and parentheses indicate regions not well characterized in our assay. {N.D.} Not determined.

nizes the fAE3 site (Fig. 2), offering further support that fAE3 mediates act ivat ion of ftz transcription.

In contrast wi th the fAE3 site, deletion of the fRE 1 site in the 5' direction does cause ectopic expression in the interstripe regions, observed as a broadening of the f~-galactosidase stripes (Fig. 4; cf. the embryo trans-

formed wi th 5'A-322 to those transformed wi th 5'~-297). This result suggests that fRE1 has some repressor function. Derepression, however, is only seen in - 5 0 % of the stained embryos. The 3' delet ion of this e lement does not result in a detectable loss of repression (Fig. 4; 3'A-318) because a complete ly derepressed pat tern is

GENES & DEVELOPMENT 857




Topoi et al.

Figure 2. DNase I protection of the ftz zebra-stripe promoter. Numbers located at the left side of each panel refer to the distance in base pairs from the start point of transcription. (Left) Footprint reactions with the 5'A-458 DNA; (middle) footprint reactions with the 5'A-359 DNA; (right) footprint reactions with the 5'A-322 DNA. The sequences protected from DNase I di- gestion are indicated by open vertical rect- angles located at the right side of each panel. The name given to each protein-recognition site {and its corresponding regulatory region) is located at the right side of the rectangle. The arrow within the fRE2 site indicates the location of a DNase I hy- persensitive site. The asterisk (*) and dag- ger (#) designate protein-recognition sites that have not been correlated with regulatory function. (*) Homeo domain recognition site: homeo domain proteins such as the eve and en proteins have been found to

• .~: " .... -~ G A G A G . . . . , :~.~Se~harose • . . : . : ,~:''T

"°i : i::.:~EN::+dfaao~..i..::,::: ::~. ~0 ........ : EN ++zvZE- 0 - . ...... -. :~ :':EN ~ ..... • -°°°:'°° " " : i ~ : o : ' ; ....L ..c~+.-+ ° . . . . . . .o::~; i:': '- : q C i L ~i~_o.+.b:: "'~ : " " " .-.,. , - . , ~ o ° . ' : ° : ~ ° . . . . .

d w

[E2

-400-

-325

bind to this site (data not shown). (G/A) Chemical cleavage at purine residues; (C/T) chemical cleavage at pyrimidine residues. (EN) the 0- to 12-hr embryonic nuclear extract used in the DNase I footprint reactions; (GAGAG factor) the purified GAGAG DNA-binding protein generously supplied by Walter Soeller (Soeller et al. 1988). (Sepharose ZE) protein that was purified by its ability to selectively bind to zebra element DNA coupled to Sepharose beads. The numbers above each lane refer to the amount of protein added to the footprint reactions, given in microliters. Protein concentration of EN: 20 mg/ml. Protein concentration of Sepharose ZE: 1 mg/ml (20-fold purification of ftz DNA-binding proteins). Protein concentration of GAGAG factor: < 10~g/ml.

already observed with the 3' construct that has retained the fRE1 site (Fig. 4; 3'A-298).

Deletion of the fDE1 site (the proximal-most site of the A - R region) results in consistent derepression in all t ransformed lines. A 5' deletion of the element causes virtually all embryos to display broadened stripes (Fig. 4; 5'A-276), whereas the 3' deletion results in the conver- sion of a smeared stripe pattern into a continuous, graded band of expression (Fig. 4; 3'A-272 to 3'A-298; the smeared stripes in 3'A-272 are clearly visible wi th a light microscope). These data suggest that fDE1 functions to repress f tz transcription in the interstripe cells. Interest- ingly, it appears that fDE 1 also acts as an activator element in the f tz promoter, because a significant drop in the expression level occurs when the site is removed from the 5' direction (Table 1, 5'A-297 vs. 5'A-276; a 60% drop in the expression level is observed).

To determine the effects of el iminating the repressor sites wi thout also removing adjacent promoter sequences, internal deletions were constructed and as- sayed for [3-galactosidase expression (Fig. 3). Deleting either of the two repressor sites singly (AfRE1 or AfDE1) results in a variable phenotype in which only a small subset ( -20%) of embryos displays a derepressed pattern (data not shown). This variability is similar to that seen when only the fRE1 repressor site is removed in the 5' direction {Fig. 4; 5'A-297). Therefore, nei ther the removal of a single repressor e lement (AfRE1 and AfDE1) nor the remaining presence of a single repressor site (3'A-298) is consistently detectable in our assay. As ex- pected, when both the fRE1 and fDE1 sites are deleted (AfRE1/AfDE1), the stripes appear broadened in all of the

transformed embryos (these data are not shown because the result is identical to that of the corresponding 5' deletion construct, 5'A-276, included in Fig. 4).

Consistent wi th the 5' deletion results, the internal deletion of the fDE1 site also results in a decrease in expression of the fusion construct (Table 1, AfDE1 vs. 5'A-669; a 42% drop in the expression level is observed). This decrease in activity can be detected in whole- mount embryos transformed wi th AfDE1 as a loss of expression in all of the B-galactosidase stripes (Fig. 4; cf. pat tern of AfDE1 wi th that of 5 'a-669; Dearolf et al. 1989b). This decrease is likely to be due to removal of the specific regulatory element because as described previously, the proper spacing of the f tz promoter was main- tained in the construction of this fusion gene, by insert- ing a linker of identical length as the sequences removed.

Act iv i ty of synthetic regulatory sites

To assess directly the functional roles of the A-R regulatory sites in wild-type and m u t a n t embryos, we de- signed f tz / lacZ fusion genes in which regulatory elements are added to (rather than deleted from) ftz promoter sequences (for diagrams of reconstructed promoters, see Fig. 5). The expression patterns generated by these constructs can be seen in Figure 6. To assay for the ability of regulatory sites to selectively repress transcription, synthetic oligonucleotides containing cis-regulators were inserted into a 3' deletion construct that expresses B-galactosidase in a continuous, graded band throughout the mesoderm (Fig. 4; 3'&-298). Conversely, to assay for the ability of regulatory sites to activate tran-





Recreation o[ [ t z zebra-stripe expression

-3s~ A-R R~egio n -272 ! 1

-669

I

I

I- //

I //

1//[

I-, / /

F #

t / /

I I / /

I / /

,7

/ /

/ /

+1 TATA I

TATA

ftz transcript

l ftz coding region ]

ATG

I I 5'a-322 r I 5' A - 2 9 7

5' A - 2 7 6

E # ' ~ 7

3' A - 272

3' A - 298

3 ' A - 3 1 8

I [ AfRE1 I t &fDE1 I I a fRE1/ fDE1

Figure 3. ftz/lac Z deletion constructs used for transformation. A schematic of the A3-R1 regulatory element is shown (described in Dearolf et al. 1989b), designated as the A-R region (top), as well as the deletion constructs used for P- element-mediated transformation [bot- tom). The TATA homology is located at - 2 6 bp, and the start point of translation is at + 70 bp. The constructs were inserted into Carnegie 20 and named such that the number following the A indicates the deletion end point from the start point of transcription, or the element following the A indicates the site(s) that has been inter- nally deleted.

scription, oligonucleotides were inserted into a 5' dele- t ion construct that is incapable of promoting f tz transcription in the germ band (Dearolf et al. 1989b; 5'A-40; see Fig. 6; 5' oligo X for the control expression pattern). Finally, we ligated repressor sites upstream of synthet ic activator sites to determine whether position-specific expression can be generated entirely by oligonucleotides in tandem. In all cases, the oligonucleotides were inserted in a direction consistent wi th the orientation of the corresponding regulatory sequence in the endogenous promoter.

A striking result in the selective repression assay was observed in embryos transformed wi th the 3'fDE1 construct (Fig. 6). Four copies of the fDE1 site are able to convert a continuous, graded band of ~-galactosidase expression into a highly resolved pattern of seven stripes, indicat ing that mul t ip le copies of a single repressor site can selectively repress transcription in our assay. This result can be compared wi th that of the 3' construct in which only one copy of the fDE1 e lement is present [Fig. 4; 3'A-272). Although f tz / lacZ stripes are apparent in embryos transformed wi th 3'a-272, strong staining re- mains in the interbands. Thus, four copies of the fDE1 site can mediate repression significantly better than one copy.

When four copies of fRE1 are inserted into the basal construct for the repression assay, a stripe pattern is also recreated (Fig. 6; 3'fRE1). As wi th the fDE1 site, mul t ip le copies mediate repression more effectively than one copy (cf. wi th the 3'A-298 embryo shown in Fig. 4, which contains one copy of the fRE1 site). In this case, however, mul t ip le repressor e lements do not appear to completely repress interband transcription, as ~-galactosidase ex-

pression can be seen in the interband region (Fig. 6; 3'fRE1).

The oligonucleotides wi th in the 3'fRE3 construct contain a regulatory site found downstream of the A-R region (Figs. 1 and 2). Progressive 5' and 3' deletion studies described elsewhere (Dearolf et al. 1989b; Topoi 1990) demonstrate that when present in its natural location in the endogenous f tz promoter, this site also possesses repressor function. However, the fRE3 e lement is unable to mediate repression when placed in triplicate wi th in the basal construct for the repression assay (Fig. 6; 3'fRE3), perhaps due to its inabi l i ty to funct ion independently. This result indicates that the abil i ty of a cis- regulator (and its corresponding trans-acting repressor) to selectively inh ib i t expression of the basal construct is specific and not merely due to the presence of repressor sites between the activator e lements and the TATA homology. A control oligonucleotide designated X, which lacks the abil i ty to bind proteins present in crude embryonic extracts (data not shown), is also unable to selectively repress transcription in our assay (Fig. 6; 3' oligo X). The 3' oligo X result is a part icularly useful control for the fDE1 repressor result because the oligo X and the fDE1 oligonucleotide have identical sequences outside of the fDE1 DNase I protection region (Materials and methods; see Fig. 1). This suggests that the fDE1 protein-recognition site is indeed responsible for the repressor function.

Two distinct putative activator e lements were tested in the activation assay: the fAE3 site and the fDE1 site (Fig. 5). When three copies of the fAE3 site are ligated upstream of - 4 0 bp, [3-galactosidase expression is generated throughout most of the presumptive mesoderm of

G E N E S & D E V E L O P M E N T 859




Topoi et al.

5'A-322 / / r" ~ 3'A-272

/ / i I " ~ '~

F _ ~ 5'A-297// r""

I / / I

// ~ 3'z~-298 :~"

3'A-318 i t "

~ AfDE1 I / / I / / r"" 5'A-276 r"

Figure 4. Expression of ftz/lacZ deletion constructs. Localization of [3-galactosidase expression is displayed in whole-mount transformant embryos undergoing germ-band extension (stages 8-11 of Campos-Ortega and Hartenstein 1985). Located above each embryo is the name and diagram of the injected construct. Detailed descriptions of the expression patterns are given in the text. Arrows on the 3'A-272 embryo indicate the location of the seven stripes that are superimposed on the continuous band of B-galactosidase expression.

transformed embryos (Fig. 6; 5'fAE3 and Table 1; cf. 5'fAE3 with 5' oligo X). Understained embryos containing the 5'fAE3 construct reveal the lack of periodicity in this pattern (data not shown). Nonetheless, the continuous band of staining is not uniform in strength; instead, expression appears less intense in the region where the first and sixth stripes are normally found (note arrows on

5'fAE3 embryo). This is consistent with the observed lower level of B-galactosidase expression in the first and sixth stripes relative to the neighboring stripes when the entire zebra element is used to drive lacZ expression (our unpublished observations of understained embryos transformed with 5'A-669; J. Topol et al.).

Embryos transformed with 5'fDE1 display very low






Table 1. Expression of ftz/lacZ constructs

Units of number of ~-galactosidase activity a transformant

Construct lines quantitated mean -+- SD range

5' A-322 3 303 + 109 178-373 5' A-297 3 283 --+ 67 241-364 5' A-276 3 112 --- 19 91-127

5' A-669 5 914 - 157 744-1131 AfDE1 4 531 + 128 379-689

5' fAE3 4 197 - 125 98-358 5' oligo X 3 60 -+ 14 45-73

aEach unit of 63-galactosidase activity is equivalent to one OD574 unit/rag of protein x 102. The background value for untrans- formed ry embryos was subtracted from each value. The value for each transformant line was obtained from measurement of two separate egg collections.

runt (run), and sloppy-paired (slp). Mutations in four of these pair-rule loci (ftz, h, eve and run) are known to alter ftz expression (Carroll and Scott 1986; Harding et al. 1986; Howard and Ingham 1986; Hiromi and Gehring 1987; Ingham and Gergen 1988; Carroll and Vavra 1989). To determine the expression pattern in the homozygous mutant embryos, the stained progeny from the appropri- ate stocks were examined. The repressor function necessary for stripe formation in 3'fDE1 transformed embryos was eliminated in -25% of the progeny of the P[ry +, 3'fDE1]; h/TM3 stock and in all embryos clearly identified as h homozygotes by morphologic criteria during the transient parasegmental groove stage (see Fig. 6; 3'fDE1 in h mutant embryo). None of the stained embryos from the other mutant lines displayed a detectable loss of repression (in addition, the stripes did not appear to be displaced; data not shown). This observation supports the hypothesis that h product is somehow required for repression of expression through the fDE1 element.

levels of ~-galactosidase expression, despite the fact that four copies of the recognition element are ligated upstream of - 4 0 bp (Fig. 6). The pattern generated by this construct, however, is noteworthy in light of the dual function of the fDE1 site. Faint stripes (barely detectable in a photograph), can be observed in transformed embryos, supporting the hypothesis that the fDE1 site can function as an activator as well as a repressor.

We are unable to generate a stripe pattern of expression when four fDE1 sites are ligated upstream of the fAE3 activator sites (Fig. 6; 5'fDE1/fAE3); instead, we observe the completely derepressed pattern of ~3-galactosidase expression characteristic of the 5'fAE3 construct. This result may be due to the presence of too many activator elements in 5'fDE1/fAE3 to be effectively repressed by the fDE1 sites. Alternatively, it may reflect a requirement for the fDE1 element to be posi- tioned between fAE3 and the transcriptional start site for repression to take place in the interband cells (as is the case in the endogenous promoter). Finally, four copies of the oligo X inserted into 5'A-40 are not able to promote transcription of f tz/lacZ fusion genes (Fig. 6; 5' oligo X); this result is consistent with the lack of binding sites within the oligo X.

Expression in mutant embryos

The placement of reconstructed promoter fusion genes into mutant embryo backgrounds provides a useful ap- proach to identify genetic interactions between cis-elements and potential trans-acting regulators. The 3'fDE1 repressor construct was chosen for further study because, unlike 3'fRE1, virtually every transformed embryo showed clear f~-galactosidase stripes. To identify a genetic locus that might interact with the fDE1 site, chromosomes containing an insertion of the fDE1/ repressor assay construct were crossed into mutant fly stocks of the pair-rule genes ftz, hairy (h), even-skipped (eve), odd-paired (opa), odd-skipped (odd), paired (prd),

D i s c u s s i o n

Function of repressor sites in stripe formation

Multiple copies of individual repressor-recognition sites (fRE1 or fDE1) can act independently to direct the formation of seven stripes from the continuous, graded pattern of gene expression mediated by endogenous cis-activators. Thus, an individual repressor element is capable of functioning in a pair-rule pattern, that is, in all of the interstripe regions. This result supports the idea that the selective repression of f tz is primarily controlled by other members of the pair-rule class of segmentation genes, particularily those genes that function in periodic patterns out of phase with the ftz pattern. Our P-element-mediated transformation data, combined with our footprint results, strongly suggest that at least some of the gene products that mediate repression are sequence- specific binding proteins. The pair-rule gene products themselves may bind to DNA or they may function in conjuction with other, perhaps ubiquitous, DNA-binding proteins.

Several models have been proposed to explain how sequence-specific binding proteins might function to repress transcription (for review, see Levine and Manley 1989; Renkawitz 1990). These models are based on results from a variety of transcriptional repression studies in several eukaryotic organisms including yeast, Droso- phila, and mammals. In general, these studies suggest that repressor molecules interfere with crucial transcription factors that bind either close to the transcriptional start point or farther upstream. This interference may be mediated by competition between factors for DNA-binding sites (Jaynes and O'Farrell 1988) or by protein-protein interactions that prevent the proper formation of complexes required to promote transcription (Han et al. 1989). The dual function of the fDE1 site [and the fDE2 site (Topol 1990)] suggests that multiple regulatory proteins may indeed compete for binding within this element. However, other repressor sites in the zebra-stripe





Topoi et al.

-~69 - s 0 0 -400 - ~ 8 - ~ 0

"-r" Y Y " ff , , , , , , '3',RE1 faE1 fAE2a faE2b fAE3 f R E I ~ T"~,~Y " ' , ,~ ] i

(CDRE) (CDRE) ~ 3' fDE1

3' fRE3

txIxH× xH o,0ox TATA

-40 ~ ~ Flai l f / / / - . / / / , lac Z "//~,

~ 5' fAE3

I I ~ ~ ~ ~ 1 5' fDE1

I • "4 . . . . '1 5' fDEl l fAE3

qxlxl--tx x ,,o, ox Figure 5. ftz/lacZ oligonucleotide constructs used for transformation. The ftz/lacZ fusion genes with reconstructed promoters are illustrated. Either three or four copies of each regulatory element were placed in the reconstructed promoters, depending on their size (three copies for sites >35 bp; four copies for all others). All of the fusion genes were inserted into Carnegie 20. The designation for promoter constructs used in the repression assay include a 3' before the synthetic site name; constructs used in the activation assay include a 5' before the synthetic site name.

promoter appear to be distinct from the activator elements; thus, their corresponding repressor molecules most likely funct ion by forming disruptive interactions wi th the molecules involved in transcriptional activation.

The data derived from the oligonucleotide constructs suggest that for optimal repression, mult iple repressor molecules may need to be bound to the promoter. This hypothesis is based on the observation that mult iple copies of either repressor site mediate repression better than a single copy. In the case of fRE1, one copy is insufficient to mediate repression, whereas five copies allow stripes to be generated; similarly, one copy of fDE1 can barely repress transcription, whereas four copies appear to elim- inate transcription in the interband regions. This effect of copy number has been shown to be important for the spatially restricted expression of other segmentat ion genes in the Drosophila embryo (Driever et al. 1989; Struhl et al. 1989). In addition, the result is consistent

wi th the action of cad protein on the ftz promoter (Dearolf et al. 1989a) and with tissue culture cell assays in which multiple copies of protein recognition sites act synergistically, presumably due to some functional co- operativity of the regulatory proteins involved (Jaynes and O'Farrell 1988; Han et al. 1989). Molecules that repress transcription through the zebra-stripe promoter may also function synergistically.

Function of activator sites in stripe formation

The activator elements that we have identified are capable of functioning in both the odd- and even-numbered parasegments and throughout much or all of the germ band, rather than in only one or several stripes (Dearolf et al. 1989a, b, and this paper). The fAE3 site characterized here is one such activation site; it mediates transcription throughout the entire parasegmental portion of the embryo. Another such activator site, the CDRE, is

Figure 6. Expression of ftz/lacZ oligonucleotide constructs. The localization of B-galactosidase expression in whole-mount transformant embryos is displayed; embryos were examined during germ-band extention (stages 8-11), unless otherwise indicated. Located above each embryo is the name and diagram of the injected construct. Detailed descriptions of the expression pattems are given in the text. Arrows on the 5'fAE3 embryo indicate regions where there are relatively low levels of 9-galactosidase activity. Dots on the h mutant embryo indicate location of the parasegmental grooves; the h embryo possesses half the normal number of parasegments. The staining of the h mutant embryo appears to be weaker than that observed in wild-type embryos; the significance of this overall decrease in B-galactosidase activity is unclear. The stripes obtained with the 3'fDE1 construct are in register with the endogenous ftz pattern, as seen in the 3'fDE1 embryo completing germ-band retraction {GBR; stage 13). (At this stage ftz mesodermal expression is shifted approximately one-half segment caudally relative to ectodermal expression; Dearolf et al. 1989b). (T) thoracic segment; (A) abdominal segment.






3' fRE1 5' fAE3

3' fDE 1 5' fDE1

eO,.OH,O.O ,

5' fDE1 / fAE3

'1

5' Oligo X , p.

3' fDE1 in h mutant embryo 3' fDE1 embryo at GBR

Figure 6. (See facing page for legend.)





Topoi et al.

capable of directing transcription in odd- and even-numbered parasegments throughout the posterior half of the embryo (Dearolf et al. 1989a); the action of this site is clearly visible in the patterns generated by the 3' deletions (Fig. 4).

Unlike fAE3, the fDE1 element can only mediate very low levels of transcriptional activation when multiple copies are placed upstream of - 40 bp. Nonetheless, both quantitation data (Table 1) and observations of stained whole-mount embryos transformed with AfDE1 (Fig. 4) strongly suggest that the fDE1 site possesses activator function in the context of the endogenous ftz promoter. Perhaps, to promote transcription, the activator(s) that functions through fDE1 must form protein-protein interactions with ftz regulators bound to sequences located upstream of the TATA homology.

Ueda et al. (1990) also report an activator function for the fDE1 site; they note a strong preferential loss of B-galactosidase expression in stripes 1, 2, 3, and 6 with ftz/lacZ constructs containing point mutations in this site. We also find that the relative intensity of stripe 1 staining is lowered when the fDE1 site is disrupted (Fig. 4, AfDE1). We do not, however, observe a significant preferential loss of stripes 2, 3, and 6 in embryos transformed with AfDE 1, nor do we see a preferential increase in those stripes when multiple copies of fDE1 are inserted in our reconstructed promoters (Fig. 6; 3'fDE1 and 5'fDE1). In addition, Ueda et al. {1990) do not report a dual function for the fDE1 site. This could be due to an activator and a repressor protein, each recognizing a different motif within the fDE1 element, with only the activator binding being affected in their fusion gene. Alter- natively, their lack of detection of the fDE1 repressor function could be due to the apparent redundancy in the zebra-stripe promoter regarding repression and the consequent difficulty of observing the effects of removing a single repressor element (discussed below).

Organization of the endogenous ftz zebra-stripe promoter

A summary of the known ftz zebra-element activator and repressor sites is given in Figure 1. These sites include the two CDREs, fAE2a and fAE2b (Dearolf et al. 1989a); the GAGAG consensus activator site fAE3; a cluster of five repressor sites; and an activator region proximal to the TATA homology that contains an additional TATA-like sequence and GAGAG consensus element. Within the repressor sites are several recurring DNA sequence motifs (Fig. 1): an inverted repeat of the GCNGTAA motif in fRE1, a CAAGGNC motif in fDE1 and fDE2, and direct repeats of the CGGATAA motif in both fRE2 and fRE3. It is likely that multiple, distinct proteins recognize some of these regulatory sites; for example, both the tramtrack (ttk) protein (Harrison and Travers 1990) and the FTZ-F1 protein (Ueda et al. 1990) bind to the fDE2 site. In addition, sites containing a common motif are likely to be bound by some of the same proteins; for example, the FTZ-F1 protein can recognize both the fDE1 site and the fDE2 site (Ueda et al. 1990). It

should be noted that additional regulatory sites, not detectable by our assay, may be present within the ftz zebra element.

Interestingly, there is a cluster of repressor sites located within <200 bp of the zebra element (Fig. 1); this promoter organization may be a requirement for effective repression of transcriptional activators located both upstream and downstream of the repressor site cluster. There also appears to be redundancy in this cluster with regard to interband repression. Some embryos in our deletion study display a fully repressed transcription pattern even when a single repressor site is lost (Fig. 4; 5'A-297 and AfDE1; AfRE1, data not shown). It is possible that in a single cell all of the repressor elements within the cluster need not be occupied with regulatory molecules to fully repress ftz transcription. Perhaps the presence of the entire cluster increases the probability that the necessary number of repressor sites will be occupied in a particular cell, at the critical time in embryogenesis. Conversely, a single repressor-recognition element is insufficient to mediate repression (as is the case with fRE1 in 3'A-298, Fig. 4). Perhaps multiple sites do act synergistically and are therefore optimally functional when clustered (or ligated in tandem).

The ftz repressor elements within the cluster can be divided into three separate classes on the basis of DNA sequence homology and activity. Each class contains a distinct sequence motif (Fig. 1: class 1, fRE1; class 2, fDE1 and fDE2; and class 3, fRE2 and fRE3), and these different types of repressor sites are functionally non- equivalent in our assay. When placed in the basal construct for the repression assay, fDE1 is a more effective repressor site than fRE1, and fRE1 is more effective than fRE3. This may reflect differences in the relative strength of repressor sites, or it may reflect the ability of the different types of repressor sites to act independently. It will be interesting to determine whether a regulatory protein that recognizes a single type of repressor site functions in a unique subset of cells in the interstripe regions. This issue can be directly addressed when the repressor proteins and the genes that encode them have been isolated and identified.

3'fDEI expression in h mutant embryos

Several lines of evidence suggest that the product of the pair-rule segmentation gene h is a negative regulator of ftz expression. First, h RNA and protein are detected in the nuclei and cells out of phase with those expressing ftz, as one might predict for a negative trans-regulator of ftz expression (although some cells do express both h and ftz at certain times during embryogenesis) (Ingham et al. 1985; Carroll et al. 1988); second, the seven stripes of ftz RNA and protein expression and the stripes generated by ftz zebra element/lacZ fusion genes are clearly broadened in h mutant embryos (Carroll and Scott 1986; How- ard and Ingham 1986; Hiromi and Gehring 1987; Ingham and Gergen 1988; Carroll and Vavra 1989); third, ftz expression is greatly reduced in embryos in which h is uni- formly overexpressed (Ish-Horowicz and Pinchin 1987).






Cons i s t en t w i th these observat ions, the fDE 1 site repres- sot funct ion , wh ich very l ike ly cont r ibutes to the gener- a t ion of f t z stripes, is e l imina t ed in h m u t a n t embryos. This is no t the case in o ther pair-rule gene m u t a n t embryos, suggest ing tha t the fDE1 e l emen t is indeed a site for h -media ted repression. However , there is no evidence yet for a direct D N A - p r o t e i n in te rac t ion be tween the fDE1 site and the h pro te in or the fDE1 site and a prote in complex con ta in ing h. Consequent ly , we canno t rule out tha t the effects of h on f t z express ion m a y be indirect , w i th h pro te in perhaps regula t ing ano the r repressor no t yet ident i f ied by m u t a t i o n a l analysis .

The fDE1 site may be on ly one of several zebra ele- m e n t cis-regulators t h rough wh ich h funct ions . For in- stance, h m a y also func t ion th rough the fDE2 site, because a mo t i f found in fDE1 is also present in fDE2 (Fig. 1). In addi t ion, it is possible tha t the h pro te in also interacts w i t h f tz regula tory e l emen t s located outs ide of the zebra-stripe p romote r to media te its repressor func- t ion. Never theless , the in t e rac t ion shown here provides an oppor tun i ty to di rect ly ascer ta in the m e c h a n i s m by wh ich h regulates f t z expression.

C o n c l u s i o n s

By us ing syn the t i c o l igonucleot ides con ta in ing f tz zebra- e l emen t regulatory sites, we have ident i f ied a global ac- t ivator si te (the fAE3 " G A G A G " site) tha t can p romote t ranscr ip t ion in a c o n t i n u o u s band of nuclei , s imi lar to the p a t t e m of f t z expression observed prior to the gener- a t ion of stripes. In addi t ion, we have isolated two repressor sites {fRE1 and fDE1) tha t can act in a d o m i n a n t m a n n e r to es tabl ish a h igh ly resolved str ipe pa t te rn of expression, s imi lar to the f tz p a t t e m found in cel lular b las toderm embryos. One of these repressor sites (fDE1) appears to med ia te the ac t ion of a pu ta t ive f tz repressor molecule , the product of the pair-rule s egmen ta t ion gene h . Th rough addi t ional s tudies w i t h these cis-regulators of stripe fo rma t ion and our recons t ruc ted p romote r system, we hope to gain fur ther ins ight in to the molecu la r m e c h a n i s m s governing spat ia l ly restr ic ted t ranscr ip t ion in organismal deve lopment .

Mater ia l s and m e t h o d s

Embryonic extract procedure and footprint assays

Embryonic nuclear extracts were made from 0-12 hr, as described previously (Dearolf et al. 1989b). Footprint reactions were performed as described in Wiederrecht et al. (1987). Pro- moter fragments used for footprint reactions were derived from deletion constructs described in Dearolf et al. (1989b) and in this paper. The plasmid DNA was digested with HindIII and labeled by filling in with DNA polymerase I (Klenow fragment), the HindIII linker overhang located at the deletion end point. The DNA was subsequently digested at the EcoRI site located near the ftz promoter/lacZ fusion site. The labeled fragment was purified following agarose gel electrophoresis.

The ZE-Sepharose (zebra element-Sepharose) footprinting material was purified as follows: Zebra-element DNA was derived from 5'A-535 DNA digested with HindIII and EcoRI. One milligram of DNA fragment was purified following agarose gel

electrophoresis and coupled to Sepharose beads, as described in Wiederrecht et al. (1987). One milliliter of 0- to 12-hr embryonic nuclear extract was added to 100 ~1 of the ZE-Sepharose resin and mixed at 4°C for 1 hr. The protein bound to the resin was washed once with 500 ~1 of buffer 1 [25 mM HEPES (pH 7.6), 10% glycerol 100 mM KC1, 0.1 mM EDTA, 1 mM DTT] and eluted once with 200 ~1 of buffer 2 [25 mM HEPES (pH 7.6); 10% glycerol, 2 M KC1, 0.1 mM EDTA, 1 mM DTT]. The eluted protein was subsequently dialyzed against buffer C [25 mM HEPES (pH 7.6), 10% glycerol, 50 mM KC1, 0.1 mM EDTA, 1 mM DTT] and stored at -80°C.

Construction of ftz/lacZ fusion genes

The procedure for generating 5' and 3' deletion constructs is described in Dearolf et al. (1989b). Internal deletion constructs were generated by ligating XbaI-HindIII fragments from the 3' deletion series into the XbaI and HindIII sites in the polylinker of the 5' deletion series. Polylinker DNA was inserted between the 5' and 3' end points in the AfDE1 construct to restore the spacing to that of the endogenous promoter. Only 4 of the orig- inal 21 bp in that sequence were conserved.

To generate the reconstructed promoters, oligonucleotides were synthesized that contain either one (fAE3, fRE3) or two (fRE1, fDE1) copies of protein-recognition sequences found in the endogenous ftz promoter. Several base pairs located outside the DNase I-protected region were included on each end of the binding sites within the oligonucleotides. All of the oligonucleotides in the reconstructed promoters were directionally inserted so that the protein-recognition sites are in the orientation found in the endogenous ftz promoter. Two copies of the double sites and three copies of the single sites were ligated into the HindIII site of either 3'&-298 (for the repression assay) or 5'&-40 (for the activation assay). To directionally insert the oligonucleotides, a HindIII site was placed on the 5' end of each oligonucleotide, and a HindIII overhang was placed on the 3' end; liga- tions were conducted in the presence of excess HindIII. All oligonucleotide constructs were sequenced to check their orientation and to confirm that the proper recognition sites were inserted into the truncated ftz promoter regions. The oligonucleotides within the reconstructed promoters have the following sequence:

fAE3

5 ' -AGCTTGAGATCGGCTGAGAGTCGCGCCCTCTCGCTCTGCGCACCTCATAGGTAGGC

ACTCTAGCCGACTCTCAGCGCGGGAGAGCGAGACGCGTGGAGTATCCATCCGTCGA-5 '

fRE1

5 ' -AGCTTCATGGCCGTAATTACTGCAGCACCTCATGGCCGTAATTACTGCAGCACC

AGTACCGGCATTAATGACGTCGTGGAGTACCGGCATTAATGACGTCGTGGTCGA-5 '

fDE1

5 ' -AGCTTGCACCGTCTCAAGGTCGCCGAGTAGGAGAAGCGCACCGTCTCAAGGTCGCCGAGTAG

A C G T G G C A G A G T T C C A G C G G C T C A T C C T C T T C G C G T G G C A G A G T T C C A G C G G C T C A T C

GAGAAGC

CTCTTCGTCGA-5'

fRE3

5'-AGCTTGCAC CGTACGGATAAAGTTGCCAGGACCTCGGATAACTTCCCCTCTCC

ACGTGGCATGCC TATTTCAACGGTCCTGGAGCCTATTGAAGGGGAGAGGTCGA-5 '

oligo X

5 ' -AGCTTGCAC CCTCAAC CCTA-ACGGTAGTAGGAGAAGCGCA C C CT CAAC C CTAACGGTAGTAG

ACGTGGGAGTTGGGATTGCCATCATCCTCTTCGCGTGGGAGTTGGGATTGCCATCATC

GAGAAGC

CTCTTCGTCGA-5'





Topoi et al.

Germ-line transformation and analysis of expression patterns

The P-element-mediated transformation procedure, 13-galactosidase staining of embryos, quantitative measurements, and photography were performed as described previously (Dearolf et al. 1989b). To avoid the difficulties that may arise due to P- element insertional position effects (i.e., ectopic expression or low levels of activity) eight independent transformant lines were established for each construct. [As has been reported previously (Hiromi et al. 1985; Dearolf et al. 1989b), a fraction of the transformant lines exhibit ectopic staining, primarily in glial cells and in cells of the central nervous system.] All lines were made homozygous or balanced over FM6, CyO, or TM3 chromosomes. Because the constructs studied in this paper contain only a portion of the regulatory elements found in the complete ftz promoter, the resulting fusion gene expression is much lower than that of the endogenous ftz gene. Therefore, the expression patterns generated by fusion genes in cellular blastoderm embryos can best be observed after the [3-galactosidase protein has accumulated in the embryo, that is, during germ band extension. The embryos displayed in Figures 4 and 6 were stained for varying lengths of time (12-36 hr at 37°C); conse- quently, the intensities of the observed patterns are not neces- sarily a reflection of the overall levels of 13-galactosidase activity in the various transformant lines. The 13-galactosidase expression appearing anterior to the cephalic furrow appears to be due to regulatory sequences within the rosy gene of the injection vector (Doyle et al. 1989) and, therefore, is not considered in this study.

Analysis of expression in mutant embryos

Fly stocks were made homozygous or hemizygous for the inserted fusion construct, 3'fDE1, and heterozygous for the pair- rule gene mutation. The progeny of these stocks were stained for 13-galactosidase activity. Mutant alleles used include eve 12z, odd zL, odd m°36, prd zas, prd uB4e, and slp nMl°5 (described in Nusslein-Volhard et al. 1984); ftzgH3a,h ZHga, opal lC and opa sngz (described in Jiirgens et al. 1984); and run mB and run p6 (described in Wieschaus et al. 1984). Flies mutant for a pair-rule gene located on an autosome were crossed into a transformant stock carrying the ftz/lacZ fusion gene on the X chromosome; flies mutant for run were crossed into a transformant stock carrying the fusion gene on the second chromosome. Both of the transformant lines generate a similar highly resolved zebra- stripe pattern. Embryos homozygous for a pair-rule mutation were identified by morphological features at the transient parasegmental groove stage (Campos-Ortega and Hartenstein 1985).

A c k n o w l e d g m e n t s

We are grateful to Walter Soeller for supplying the purified GAGAG-recognition protein and to Mike Muhich for his assis- tance in the preparation of ZE- Sepharose beads. For fly stocks, we thank Sean Carroll, Steve DiNardo, David Ish-Horowicz, Mike Levine, Susan Parkhurst, Matt Scott, Terry Strecker, and the Bowling Green Drosophila stock center. We also thank our colleagues in the Lipshitz and Parker laboratories, as well as Nancy Bonini and Sue Celniker for helpful discussions during the course of this work and for comments on the manuscript. This work was supported by a predoctoral fellowship from the National Institutes of Health (NIH) to J.T., a California Division American Cancer Society Fellowship S-53-89 and an NIH post- doctoral fellowship to C.R.D., and a Lucille P. Markey Charita- ble Trust grant and NIH grant GM42671 to C.S.P.

The publication costs of this article were defrayed in part by

payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.

R e f e r e n c e s

Akam, M. 1987. The molecular basis for metameric pattern in the Drosophila embryo. Development 101: 1-22.

Biggin, M.D. and R. Tjian. 1988. Transcription factors that activate the Ultrabithorax promoter in developmentally staged extracts. Cell 53:699-711.

Campos-Ortega, J.A. and V. Hartenstein. 1985. The embryonic development of Drosophila melanogaster. Springer-Verlag, Berlin, Heidelberg, New York, Tokyo.

Carroll, S.B. 1990. Zebra patterns in fly embryos: Activation of stripes or repression of interstripes? Cell 60: 9-16.

Carroll, S.B. and M.P. Scott. 1986. Zygotically active genes that affect the spatial expression of the fushi tarazu segmentation gene during early Drosophila embryogenesis. Ceil 45:113-126.

Carroll, S.B. and S.H. Vavra. 1989. The zygotic control of Droso- phila pair-rule gene expression II. Spatial repression by gap and pair-rule gene products. Development 107: 673--683.

Carroll, S.B., A. Laughon, and B.S. Thalley. 1988. Expression, function, and regulation of the hairy segmentation protein in the Drosophila embryo. Genes & Dev. 2: 883-890.

Dearolf, C.R., J. Topoi, and C.S. Parker. 1989a. The caudal gene product is a direct activator of fushi tarazu transcription during Drosophila embryogenesis. Nature 341: 340-343.

1989b. Transcriptional control of Drosophila fushi tarazu zebra-stripe expression. Genes & Dev. 3: 384-398.

- - . 1990. Transcriptional regulation of the Drosophila segmentation gene fushi tarazu (ftz). BioEssays 12: 109-113.

Doyle, H.J., R. Kraut, and M. Levine. 1989. Spatial regulation of zerknullt: A dorsal-ventral patterning gene in Drosophila. Genes & Dev. 3: 1518-1533.

Driever, W., G. Thoma, and C. Niisslein-Volhard. 1989. Deter- mination of the spatial domains of zygotic gene expression in the Drosophila embryo by the affinity of binding sites for the bicoid morphogen. Nature 340: 363-367.

Edgar, B.A., M.P. Weir, G. Shubiger, and T. Kornberg. 1986. Repression and turnover pattern fushi tarazu RNA in the early Drosophila embryo. Cell 47: 747-754.

Gilmour, D., G.H. Thomas, and S.C.R. Elgin. 1989. Drosophila nuclear proteins bind to regions of alternating C and T residues in gene promoters. Science 245: 1487-1490.

Hafen, E., A. Kuroiwa, and W.J. Gehring. 1984. Spatial distribu- tion of transcripts from the segmentation gene fushi tarazu during Drosophila embryonic development. Cell 37: 833- 841.

Han, K., M.S. Levine, and J.L. Manley. 1989. Synergistic activation and repression of transcription by Drosophila ho- meobox proteins. Cell 56: 573-583.

Harding, K., C. Rushlow, H.J. Doyle, T. Hoey, and M. Levine. 1986. Cross-regulatory interactions among the pair-rule genes in Drosophila. Science 233: 953-959.

Harrison, S.D. and A.A. Travers. 1990. The tramtrack gene en- codes a Drosophila finger protein that interacts with the ftz transcriptional regulatory region and shows a novel embryonic expression pattern. EMBO J. 9: 207-216.

Hiromi, Y. and W.J. Gehring. 1987. Regulation and function of the Drosophila segmentation gene fushi tarazu. Ceil 50: 963-974.

Hiromi, Y., A. Kuroiwa, and W.J. Gehring. 1985. Control elements of the Drosophila segmentation gene fushi tarazu.






Cell 43: 603-613. Howard, K.R. and P.W. Ingham. 1986. Regulatory interactions

between the segmentation genes fushi tarazu, hairy, and engrailed in the Drosophila blastoderm. Cell 44: 949-957.

Ingham, P.W. 1988. The molecular genetics of embryonic pattern formation in Drosophila. Nature 335: 25-34.

Ingham, P.W. and P. Gergen. 1988. Interactions between the pair-rule genes runt, hairy, even-skipped and fushi tarazu and the establishment of periodic pattern in the Drosophila embryo. Development [suppl.) 104: 51-60.

Ingham, P.W., K.R. Howard, and D. Ish-Horowicz. 1985. Tran- scription pattern of the Drosophila gene hairy. Nature 318: 439-445.

Ish-Horowicz, D. and S.M. Pinchin. 1987. Pattern abnormalities induced by ectopic expression of the Drosophila gene hairy are associated with repression of ftz transcription. Cell 51: 405-415.

Jaynes, ].B. and P.H. O'Farrell. 1988. Activation and repression of transcription by homeodomain-containing proteins that bind a common site. Nature 336: 744-749.

]tirgens, G., E. Wieschaus, C. Niisslein-Volhard, and H. Kluding. 1984. Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. II. Zygotic loci on the third chromosome. Wilhelm Roux's Arch. Dev. Biol. 193: 283-295.

Levine, M. and J.L. Manley. 1989. Transcriptional repression of eukaryotic promoters. Cell 59: 405-408.

Maniatis, T., S. Goodbourn, and I.A. Fischer. 1987. Regulation of inducible and tissue-specific gene expression. Science 236: 1237-1245.

Mitchell, P.J. and R. Tjian. 1989. Transcriptional regulation in mammalian ceils by sequence-specific DNA binding proteins. Science 245: 371-378.

Niisslein-Volhard, C., E. Wieschaus, and H. Kluding. 1984. Mu- tations affecting the pattern of the larval cuticle in Droso- phila melanogaster. I. Zygotic loci on the second chromosome. Wilhelm Roux's Arch. Dev. Biol. 193: 267-282.

Prakash, K., 1. Topoi, C.D. Dearolf, and C.S. Parker. 1991. Tran- scriptional regulation during early Drosophila development. In Advances in developmental biochemistry (ed. P. Wassar- man), vol. I. JAI Press, Greenwich. (In press.)

Ptashne, M. 1988. How eukaryotic transcriptional activators work. Nature 335: 683-689.

Renkawitz, R. 1990. Transcriptional repression in eukaryotes. Trends Genet. 6: 192-197.

Scott, M.P. and S.B. Carroll. 1987. The segmentation and ho- meotic gene network in early Drosophila development. Cell 51: 689-698.

Scott, M.P. and P.H. O'Farrell. 1986. Spatial programming of gene expression in early Drosophila embryogenesis. Annu. Rev. Cell Biol. 2: 49-80.

Soeller, W.C., S.J. Poole, and T. Kornberg. 1988. In vitro transcription of the Drosophila engrailed gene. Genes & Dev. 2:68-81.

Struhl, G., K. Struhl, and P.M. Macdonald. 1989. The gradient morphogen bicoid is a concentration-dependent transcriptional activator. Cell 57: 1259-1273.

Topoi, I. 1990. Transcriptional control of the Drosophila segmentation gene [ushi tarazu. Ph.D. thesis. California Insti- tute of Technology, Pasadena.

Topoi, J-, G. Weiderrecht, and C.S. Parker. 1987. Biochemical analysis of the [-ushi tarazu and Ultrabithorax promoter regions. In Genetic regulation of development (ed. W. F. Loomis), pp 3-12. Alan R. Liss Inc., New York.

Ueda, H.S.S., L. Brown, M.P. Scott, and C. Wu. 1990. A sequence-specific DNA-binding protein that activates [ushi tarazu segmentation gene expression. Genes & Dev. 4: 624-

635. Weir, M.P. and T. Komberg. 1985. Patterns of engrailed and

fushi tarazu transcripts reveal novel intermediate stages in Drosophila segmentation. Nature 318: 433--439.

Wiederrecht, G., D.J. Shuey, W.A. Kibbe, and C.S. Parker. 1987. The Saccharomyces and Drosophila heat shock transcription factors are identical in size and DNA binding properties. Cell 48: 507-515.

Wieschaus, E., C. Niisslein-Volhard, and G. Jiirgens. 1984. Mu- tations affecting the pattern of the larval cuticle in Droso- phila melanogaster III. Zygotic loci on the X-chromosome. Wilhelm Roux's Arch. Dev. Biol. 193: 296--307.





10.1101/gad.5.5.855Access the most recent version at doi: 5:1991, Genes Dev.

J Topol, C R Dearolf, K Prakash, et al. zebra-stripe expression.Synthetic oligonucleotides recreate Drosophila fushi tarazu

References

http://genesdev.cshlp.org/content/5/5/855.full.html#ref-list-1

This article cites 40 articles, 12 of which can be accessed free at:

License

ServiceEmail Alerting

click here.right corner of the article or

Receive free email alerts when new articles cite this article - sign up in the box at the top

Copyright © Cold Spring Harbor Laboratory Press


http://genesdev.cshlp.org/lookup/doi/10.1101/gad.5.5.855

http://genesdev.cshlp.org/content/5/5/855.full.html#ref-list-1

http://genesdev.cshlp.org/cgi/alerts/ctalert?alertType=citedby&addAlert=cited_by&saveAlert=no&cited_by_criteria_resid=protocols;10.1101/gad.5.5.855&return_type=article&return_url=http://genesdev.cshlp.org/content/10.1101/gad.5.5.855.full.pdf

http://genesdev.cshlp.org/cgi/adclick/?ad=41173&adclick=true&url=https%3A%2F%2Fipaper.ipapercms.dk%2FEXIQON%2FMarketing%2Ftechnote%2FNGS-comparison-of-methods-for-microrna-profiling-from-plasma-and-plasma-derived-exosomes%3Futm_source%3DCSHL%26utm_medium



synthetic oligonucleotides recreate expression

Documents