Swiss Grid Day, Bern, November 26 th 2009 Human migrations Adapted from Cavalli-Sforza & Feldman, 2003 [12,000] [55,000] Homo sapiens sapiens 1. Better understand human evolution Origin of modern human (when, where, how many?) Relationship with other members of the Homo genus 2. Distinguish between the effect of demography and those of selection (biomedical applications) Why aiming at a good demographic model Gene-specific factors mutations recombination selection A complex past demography fluctuation in effective pop. size substructure migrations Observed patterns of genetic diversity in contemporary populations A complex demography Adapted from Cavalli-Sforza & Feldman, 2003 [10,000] [55,000] demographic and spatial expansions population bottlenecks fast migration events population isolation secondary contacts SPLATCHE SPatiaL And Temporal Coalescences in Heterogeneous Environment (http://cmpg.unibe.ch/software/splatche) From environment to demography Spatial resolution: 100 km low high Carrying capacity low high Friction From environment to demography Demographic simulations stepping-stone model (cellular automata) Cell or deme Pop. size time Demography and spatial expansion Population density Genetic simulations Simulated genealogy Mutation Modle de mutation ACCTAGTACAATCGGTAATGCCATTGGT TCCTTGTAATTGGT ACCGAGTAGTTGGT Summary statistics Within population: S, Between populations Pairwise F ST Global F ST Globally S, 1-10 mio. Computer clusters UBELIX (>500 nodes) Zooblythii (~40 nodes) A PPROXIMATE B AYESIAN C OMPUTATIONS (ABC) C OMPUTATIONAL ISSUES Computational issues A fully spatially-explicit model using 500 loci in 800 individuals: 10 CPU-years Adding long-distance dispersal: 20 CPU-years SPLATCHE on the grid early 2005: joined the Biomed VO of the EGEE project mid 2005: tested on GILDA test bed, and deployed on the Grid since mid 2006: production mode and optimization Use of SPLATCHE on the grid N simulations Independent simulations: - the more CPUs, the better - job failures are not that bad GRID Posterior distribution of demographic/genetic parameters of interest Statistical tools Optimizations 5 mio. simulations GRID Reduction of the number of simulations (Daniel Wegmann) By MCMC. Promising results (~50 times less sims) Submission time multi-threaded application using up to 30 RBs (used for the WISDOM project) Fetching time of job outputs in-house multi-threaded solution for checking status and getting outputs Geographic origin of human dispersal Ray et al. (2005) Genome Research Interactions among populations Interaction between modern humans and Neanderthals in Europe Currat & Excoffier (2004), PLoS Biol. Cane toad invasion in Australia Estoup, A., Baird, S. J. E., Ray, N., Currat, M., Cornuet, J.-M., Santos, F., Beaumont, M. A. and L. Excoffier. Combining genetic, historical and geographic data to reconstruct the dynamics of the bioinvasion of cane toad Bufo marinus. Submitted Take-home message