survey for the presence of phytophthora cinnamomi on reclaimed mined lands in ohio chosen for...
TRANSCRIPT
SURVEY FOR THE PRESENCE OF PHYTOPHTHORA CINNAMOMI ON
RECLAIMED MINED LANDS IN OHIO CHOSEN FOR RESTORATION OF THE
AMERICAN CHESTNUT
Shiv Hiremath, Kirsten Lehtoma, and Jenise M. Bauman
Burnham 1988
*7/8
*15/16* Advanced 15/16
Chestnut in Ohio Coal Mine Reclamation:
• Fast growth rate
• Compliment native range
• Provides a venue for assessment
Early Reports: C. dentata mortality
Phytophthora species are causal agents of “ink disease”
Its presence in the Appalachian region, has been noticed on chestnut seedlings (Rhoades et al., 2003, 2009; James 2012).
Backcrossed chestnuts are not breed for resistance to chestnut ink disease.
Jeffers 2009
History of Chestnut Ink Disease
Prior to chestnut blight, several Phytophthoras were introduced to the U.S. (1700-1800s, Jeffers et al. 2009).
Castanea spp. reported dying of unknown causes as early as 1824 (Crandall et al. 1945)
Not reported until 1932 (Milburn and Gravatt 1932)
Found in all throughout N. America including 28 States of the U.S.
Crandall et al. 1945
Phytophthora: “Plant Destroyer”
• Crown Rot• Fruit Rot of Pumpkin• Rhododendron
Dieback (shoot rot)• Bleeding cankers• Citrus rot• Port-Orchard-Cedar
Root Rot
Phytophthora lateralis
Phytophthora capsici
Phytophthora citricola
Phytophthora cactorum
Phytophthora parasitica
Phytophthora palmivora
Infamous Phytophthoras…
P. ramorumP. infestans
Phytophthora cinnamomi
• Symptoms:
- Rot of fine feeder roots
- Wilts, stem cankers, collar rot
- decline in yield and decreased fruit size
• Host plants: 3000 species
Examples: Eucalyptus, Avocados, Pineapples, Rhododendron, Beech, Walnut, Oak, Chestnut
• Taxonomic Class: Oomycetes
• Stramenopiles = flagella hairs
• Geographic Origin:Southeast Asia Southern Africa
• First Described: Portugal in 1838
• Global Distribution
Phytophthora cinnamomi Rands
Hardham 2005
Infective Structures
• Sporangia
• Zoospores
• OosporesBar = 25m
Disease Cycle
Infection Mechanism
Zoospore finds host Encysts Direct Penetration
Balci et al. 2007
Range of Phytophthora in N. America
•A 2004-05 survey of soils associated with oak species for the occurrence of Phytophthora
• Soils sampled from bases of healthy and declining oak trees
• P. cinnamomi was the most frequently isolated species (69.4%) of the Phytophthoras
• The absence of P. cinnamomi above the 40ºN latitude
Range of P. cinnamomi in Ohio• Survey of Phytophthora
species in white oak decline in southern Ohio
• The most common species was P. cinnamomi
• P. cinnamomi was more commonly isolated with wet soils
• The population densities of P. cinnamomi were significantly with declining oaks
Balci et al. 2010
Study Objective:
• Survey reclaimed mine sites in southern Ohio for presence of P. cinnamomi
• Compared sites that were reclaimed under 5 years to those reclaimed 25 years prior
• Compared two Phytophthora sampling techniques: direct plating and leaf baiting
Study Sites
YEAR LOCATION SITES METHOD
2008 Greendale, Ohio, Ora Anderson Park 8 Direct platingIronton District, WNF 6 Direct plating
2009 The Wilds, International Road 4 Direct platingThe Wilds, Lake Trail 4 Direct platingThe Wilds, Site 2 4 Direct platingNelsonville, Ohio 5 Direct plating
2011 The Wilds, Site 1 7 Leaf baitingThe Wilds, Forest Site C07 2 Leaf baiting
New Straitsville, OH 10 Leaf baiting
Ironton District, WNF
Nelsonville, Ohio
The Wilds, International Road
The Wilds, Lake Trail
Methods: Direct PlatingSoil was collected at a depth of 4-5 inches
Ten grams of soil were diluted in 100 ml dH2O and plated onto PAR(PH)-V8 (Johnson and Curl 1972)
Plates were incubated in the dark at 22 oC and examined under a dissecting microscope for the presence hyphae
Subcultures were made on the same selective medium to obtain a pure culture.
The fungus was allowed to grow for 3 weeks and harvested
Methods: Leaf Baiting
http://www.forestryimages.org/browse/detail.cfm?imgnum=5408716
250 g of soil from each site was mixed with 1.25 L deionized water
American chestnut leaves were floated on the surface of the water
After 3-5 days, necrotic areas were examined for sporangia
These areas were plated onto PAR(PH)-V8 plates as described above to obtain a pure culture (Balci et al. 2007)
Methods: Molecular Identification
Primer SequenceYph1F 5’CGACCATKGGTGTGGACTTT3’Yph2R 5’ACGTTCTCMCAGGCGTATCT3’Ycin3F 5’GTCCTATTCGCCTGTTGGAA3’
Ycin4R5’GGTTTTCTCTACATAACCATCCTATAA3’
Phytophthora genus-specific(470bp)
P. cinnamomi –specific(243bp)
• Final identification of the fungus was made by sequencing the internal transcribed spacer region of the ribosomal DNA
• PCR reactions were analyzed on a 0.7% agarose gel
• Bands produced from the primer pair were isolated from the gel using the Geneclean (MP Biochemicals)
• Sequences were analyzed in the GENBANK using BLAST
Methods: Resulting Gels
M Neg OA-1
OA-6-1
OA-6-2
Pos 1
Pos 2
Neg OA-1
OA-6-1
OA-6-2
Pos 1
Pos 2
Kbp
1.00.6
0.2
Yph1F + Yph2R Ycin3F + Ycin4RPhytophthora genus-specific P. cinnamomi –specific
Results: Wayne National Forest
Year Location P. cinnamomi Phytophthora
2008 Ora Anderson Park 0 % 0 %Ironton District 0 % 0 %
2009 Nelsonville, Ohio 0 % 0 %
2011 New Straitsville, OH 0 % 10 %
P. cinnamomi was not detected. We found another species, P. citricola. In addition to Phytophthora, we also detected another plant pathogen belonging to the genus Pythium at one of the sites (Ironton District).
Results: The Wilds
Year Location P. cinnamomi Phytophthora
2009 The Wilds, Grassland 0 % 0 %The Wilds, Lake Trail 0 % 0 % The Wilds, Site 2 0 % 0 %
2011 The Wilds, Site 1 0 % 0 %The Wilds, Forest 0 % 50 %
We also found P. citricola in the forested site. This indicates that at least some of the Phytophthora species are present in these reclaimed lands. However, their presence was not common or widespread.
SummaryNorthern tip of the distribution of P. cinnamomi and the pathogen may have not be able to survive the freezing conditions.
Since these were reclaimed lands, fresh top soil layer would have been added and pathogen may not have had time to relocate to these soils.
It is not known how conducive the harsh soil conditions (low nutrients, pH extremes, toxic metals) are for the establishment of the pathogen.
If this pathogen cannot survive in the mined lands, they would make highly suitable locations for the American chestnut restoration (Barton, et al, 2010).
Future Studies:Continue to evaluate hybrid seedlings for resistance to P. cinnamomi.
Identify backcrossed lines with high levels of resistance
Difficulty is that resistance appears to be incompletely dominant and regulated by more than one gene (Jeffers et al. 2010).
Pre-screening for soils that do not harbor P. cinnamomi.
Proper site selection of areas that have proper drainage
Continue experimental plantings that identify methods that improve establishment and long-term survival of chestnut.