Supporting InformationMosinger et al. 10.1073/pnas.1302827110SI Materials and MethodsReagents. All chemicals were purchased from Sigma-Aldrichunless otherwise specified.

Experimental Animals. Tas1r3−/− null and Gnat3−/− null mice weredescribed previously (1, 2). Their genetic background is entirelyC57BL/6. Mice were bred at the Monell Chemical Senses Cen-ter’s animal facility. WT controls were littermates or C57BL/6mice purchased from the Jackson Laboratory. All mice weremaintained on a 12/12-h light/dark cycle and fed standard rodentchow. All experimental protocols and procedures were approvedby Monell’s Institutional Animal Care and Use Committee inaccordance with the National Institutes of Health Guide for theCare and Use of Laboratory Animals.

Transgenic Animals. Because fully human TAS1R3 does not di-merizeand/or signal effectivelywithmouseTAS1R1orTAS1R2(3–5), we engineered a humanized Tas1r3 gene (mhTas1r3) encodinga chimeric TAS1R3 protein, with the extracellular part of mouseorigin and the transmembrane and intracellular parts of humanorigin. This chimera has been shown to function in a heterologoussystem with mouse TAS1R2 (5, 6). The mhTas1r3 chimeric re-ceptor construct was created by joining the extracellular domain ofthemouse Tas1r3 gene (nt 1–568) with the transmembrane domainand C-terminal domain from the human TAS1R3 gene (nt 567–852) as previously described (5). The transgenic DNA construct(mhTas1r3-IRES-Gfp) contains, in order, the 12-kb mouse Tas1r3promoter region, cDNA of the mouse-human chimeric Tas1r3gene, internal ribosome entry site (IRES), and the Egfp gene (Fig.S1 A and B). Two transgenic lines were established independentlyin the Tas1r3−/− background: lines 7 and 9, with two and five copiesof the transgene, respectively. Thus, the humanized chimeric re-ceptor (mhTAS1R3) is the only TAS1R3 receptor expressed inthese animals. Line 7 (Tas1r3−/−, mhTas1r3-IRES-Gfp) was crossedwith Gnat3−/− KO mice to generate double KO mice with thetransgene used in our studies and are referred to herein asdouble KO-mhTas1r3mice and genotypically defined as Tas1r3−/−,Gnat3− /−, mhTas1r3-IRES-Gfp. Genotyping was performedby PCR.

Gustatory Measurements.Gustatory behavioral data were collectedduring short-access presentation with Davis rig gustometers (MS-160; Dilog Instruments). The gustometer quantifies preference foran aqueous solution by measuring the number of licks from sippertubes containing test solutions presented randomly by a computer,as previously described (7). Gustometer lick responses to sodiumcyclamate were measured in the presence of 0.1 mM amiloride toblock any salty taste from the sodium ion. Clofibric acid (1 and3 mM) was used to block mhTAS1R3 responses of the transgenicmhTas1r3 mice. Experiments were done three times.

Clofibrate Diet and Treatment. Clofibrate (Sigma) was dissolved in50% (vol/vol) ethanol and sprayed onto a regular mouse powderdiet while mixing, at a concentration of 1 g clofibrate in 200 gpowdered diet. Sufficient water was then added so that the powderbecame moist, but not wet. The material was then formed by handinto small balls and left to dry. While on the clofibrate diet, ani-mals had free access to water and to the clofibrate food pellets. Noadverse reactions were observed on the diet, and the quantitiesconsumed were comparable to those of animals on a regular chowdiet. In the clofibrate-induced infertility experiments, males werefirst exposed to the clofibrate diet for 3–4 wk. Females were on

a regular diet during that time and were exposed to the clofibratefood only after introduction into the males’ cages. Visibly pregnantfemales or females with pups were removed to separate cages andthen fed a regular diet. Fertility was evaluated by scoring forpregnancies for at least 3-mo duration. Mating behavior wasevaluated by observation of males after introduction of a femaleinto the cage.

Histological and Pathological Examinations. Reproductive organswere removed for gross and histological analysis. Tissues wereimmediately fixed in Davidson’s fixative for 24 h, transferred to10% buffered formalin, embedded in paraffin, sectioned (5 μm),and stained with H&E or periodic acid-Schiff (PAS) reagentsusing standard procedures.

Immunohistochemistry. Previously described immunohistochemi-cal techniques were used on frozen sections fixed in 4% para-formaldehyde (1). Rabbit polyclonal primary antibodies againstmouse TAS1R3 and α-gustducin were as previously described (1,2, 8). Secondary antibodies (FITC, Cy3, or HRP conjugated)were purchased from Jackson Immunoresearch. Negative con-trols omitted the primary antiserum.

In Situ Hybridization. Fresh sections were fixed for 10 min in 4%paraformaldehyde/1× PBS, permeabilized with 10 μg/mL pro-teinase K (Boehringer Mannheim), postfixed for 10 min in 4%paraformaldehyde in PBS, and then acetylated for 10 min. Slideswere then prehybridized for 1 h at room temperature in a mixturecontaining 50% (vol/vol) deionized formamide, 5× SSC, 5×Denhardt’s solution, 500 μg/mL salmon sperm DNA, 250 μL/mLyeast tRNA, and 2.5 M EDTA in diethyl pyrocarbonate-treatedwater, followed by hybridization with digoxigenin-labeled RNAprobes at 65 °C overnight. The probes consisted of the full-lengthTas1r2 and Tas1r3 cDNAs. A TSA Plus DNP (AP) kit [tyramidesignal amplification plus dinitro phenyl (alkaline phosphatase);Perkin-Elmer] was used according to the manufacturer’s protocolto amplify signals from the RNA probes. Alkaline phosphate la-beling was detected by incubation overnight at room temperaturein the dark with a nitroblue tetrazolium plus 5-bromo-4-chloro-3indolyl-phosphate mixture (Roche) with levamisole (Sigma).Positive controls with Tas1r3 or Tas1r2 antisense probes on tastetissue were done to ensure that in situ hybridization of these sameprobes to testes worked properly.

TUNEL Staining. TUNEL staining was done on paraffin sectionsusing the fluorescent method with the in situ cell death detectionkit #1684795 from Roche Applied Science.

Sperm Analysis. Spermatozoa quality was determined by light mi-croscopy, and quantity was measured by hematocytometry. Epidid-ymal sperm count was done as described in ref. 9. Both epididymideswere minced in Hanks’ balanced salt solution and incubated at37 °C, and all sperm were retrieved. After dilution and heatinactivation, sperm were counted in all 25 squares in a Neubauerhematocytometer.Sperm motility was determined from sperm isolated from vas

deferens using the wet-mount manual technique in a Neubauerhematocytometer. Under these conditions, therewas no differencein sperm motility between WT and double KO-mhTas1r3 males.For histological evaluation, sperm were smeared on glass mi-

croscope slides and dried. The slides were postfixed with 4% (wt/vol) paraformaldehyde and stained with either H&E or kernech-trot-picroindigocarmine (Christmas tree stain; Antec), according

Mosinger et al. www.pnas.org/cgi/content/short/1302827110 1 of 6

to the manufacturer’s protocol. Sperm abnormalities were coun-ted per 100 spermatozoa at least in duplicates for each sample.

Quantitative RT-PCR.RNAwas extracted from testis using PureLinkMiniColumns (LifeTechnologies) according to themanufacturer’sinstructions followed by on-columnDNaseI treatment (Invitrogen)and purification using the RNAClean and Concentrator kit (ZymoResearch). Individual cDNAs were synthesized per sample using200 ng of total RNA with the VILO kit (Invitrogen). cDNA qualityfor every sample was validated by running regular PCR using controlgene primers.Real-timePCRreactionswere carriedout ina96-well plateusing

thepreviously synthesizedcDNAas template.All primerswerefirstvalidated with regular PCR reactions before running quantitativereactions.Reactionswith diluted cDNAwere run in triplicate usingtheFast SYBRGreenprotocol, andmelting curveswere conductedfor every reaction using a StepOnePlus machine (Applied Bio-systems). Values (Ct) were normalized to control genes’ expressionlevels for each sample using the ΔCt method (Pfaffl).Eachquantitative PCR (qPCR)assaywas repeated three ormore

times using threedifferent control cDNAs fromWTmales.Relativeexpression data calculated from reactions with different controlgenes (9–25 data points) were combined and averaged. In general,reference control genes provided very similar results.Specific reverse and forward oligonucleotide primers for cAMP

response element modulator (CREM)-controlled genes were

designed using theNCBI Primer-Blast program. The sequences ofoligonucleotide primers used were as follows:

1. Damak S, et al. (2003) Detection of sweet and umami taste in the absence of tastereceptor T1r3. Science 301(5634):850–853.

2. Wong GT, Gannon KS, Margolskee RF (1996) Transduction of bitter and sweet taste bygustducin. Nature 381(6585):796–800.

3. Max M, Meyerhof W (2008) 4.09—Taste receptors. The Senses: A ComprehensiveReference (Elsevier, St. Louis, MO), 197–217.

4. Kinnamon SC, Vandenbeuch A (2009) Receptors and transduction of umami tastestimuli. Ann N Y Acad Sci 1170:55–59.

5. Jiang P, et al. (2005) Lactisole interacts with the transmembrane domains of humanT1R3 to inhibit sweet taste. J Biol Chem 280(15):15238–15246.

6. Maillet EL, Margolskee RF, Mosinger B (2009) Phenoxy herbicides and fibrates potentlyinhibit the human chemosensory receptor subunit T1R3. J Med Chem 52(21):6931–6935.

7. Glendinning JI, Gresack J, Spector AC (2002) A high-throughput screening procedurefor identifying mice with aberrant taste and oromotor function. Chem Senses 27(5):461–474.

8. Hoon MA, Northup JK, Margolskee RF, Ryba NJ (1995) Functional expression of thetaste specific G-protein, alpha-gustducin. Biochem J 309(Pt 2):629–636.

9. Wang Y (2003) Epididymal sperm count. Curr Protocols Toxicol, Ch16:Unit 16.6.

Prm1 forward CCAAGCCAGCACCATGGCCAPrm1 reverse TGGCGAGATGCTCTTGAAGTCTGGTTnp1 forward ATGTCGACCAGCCGCAAGCTTnp1 reverse TGGCAGTCCCCCTCTGATGTCCSmcp forward ACTGCTGAGGAAGACCCAGCATCTSmcp reverse GGGCAGCATGGGGATTTGGGACSpem forward GGCCTGGGTGGGCCTCGTATSpem reverse AGGTCTGCTTCCTCAAGGGCTGGGapdhs forward GCCTGGCCAAGCCTGCTTCTTAGapdhs reverse GGGGAGCAAGGAGGGGCCTTTAkap4 forward TGGTTCCAGGTCAGAAGGCGAGTAkap4 reverse TGTTTACAGCTAGAGGCTGAGGGGCAcrb forward TGCTCCCAGCCCGTCTCCATAcrb reverse TCCTGCTTGCGCTGCTCCTGL8 forward CCGTGGGCACCATGCCTGAGL8 reverse CTGCCCCCACCAGCCACAACβ-Actin forward CACATACCAGGGTGCTGTGAβ-Actin reverse GGCGTGTACTGGGGAATGTAG18S forward CGGCTACCACATCCAAGGAA18S reverse GCTGGAATTACCGCGGCTB2m forward ATTCACCCCCACTGAGACTGB2m reverse TGCTATTTCTTTCTGCGTGC

Mosinger et al. www.pnas.org/cgi/content/short/1302827110 2 of 6

Fig. S1. A humanized Tas1r3 transgene in the Tas1r3−/− null background restores taste function and is expressed in testes. (A) Schematic diagram of thetransgenic construct DNA, with 12-kb mouse Tas1r3 promoter, mouse-human (mh) chimeric Tas1r3 cDNA, IRES, and enhanced GFP gene. (B) Schematic diagramof heteromeric receptor formed by association of mouse TAS1R2 with mouse-human chimeric TAS1R3. Color coding indicates that the transmembrane (TM)segment is from human TAS1R3 and the extracellular amino terminal domain is from mouse TAS1R3. (C) Taste preferences for sucrose (30, 150, 300, and 600mM) of WT C57BL/6 control (blue), transgenic line 7 (red), transgenic line 9 (yellow), and Tas1r3−/− null (green) animals measured using a brief-access test. (D)Taste preference for 300 mM sucrose alone (defined as 100%) or in the presence of clofibric acid (CLO, 1 and 3 mM). (E–G) Frozen sections of germ cells intesticular tubules from male mice transgenically expressing mhTas1r3-IRES-Gfp displaying intrinsic fluorescence from the GFP transgene (E), along with GNAT3(detected by indirect immunofluorescent staining with anti-gustducin antibody) (F). The overlay (G) indicates that the transgene and gustducin are coexpressedin male germ cells.

Mosinger et al. www.pnas.org/cgi/content/short/1302827110 3 of 6

Fig. S2. In situ hybridization to sections of seminiferous tubules from WT C57BL/6 males. Detailed images with antisense probe to Tas1r3 (A–D) and Tas1r2(E–H). D and H are enlarged sections of indicated portions (rectangles) of C and F, respectively, showing expression of Tas1r3 and Tas1r2 primarily in elongatingand elongated spermatids, in contrast to round spermatids in their vicinity. Magnification: A and E, 20×; B, C, F, and G, 40×; D and H,100×.

Mosinger et al. www.pnas.org/cgi/content/short/1302827110 4 of 6

Fig. S3. H&E-stained paraffin sections. (A–D) Seminiferous tubules from WT (A), Tas1r3−/− (B), Gnat3−/− (C), and double KO-mhTas1r3 (D) males on a regulardiet. (E and F) Exfoliated spermatids in tubules of the rare Tas1r3−/−, Gnat3−/− male showing cell nuclei of germ cells in the same stage of development as insurrounding epithelium (E). Occasionally these cells include spermatocytes (F). Magnification: A–E, 20×; F, 40×.

Fig. S4. TUNEL staining of testis sections. Paraffin sections of testes from WT C57BL/6 males (A), double KO-mhTas1r3 males on clofibrate (B), and Tas1r3−/−,Gnat3−/− double-null males (C). There are very few apoptotic cells in tubules in any of the genotypes (arrowheads). Interstitial cells display relatively highnonspecific staining.

Mosinger et al. www.pnas.org/cgi/content/short/1302827110 5 of 6

Table S1. Fecundity, testis histology, and sperm parameters in experimental animals

Genotype (all in C57BL/6background)

Fertilitystatus* Litter size† Testis histology Sperm parameters

Tas1r3+/+, Gnat3+/+ (WT) Fertile 6.0 ± 1.8 No obvious pathology‡ 37 ± 2.4 million§

Tas1r3−/− Fertile 5.5 ± 0.9 No obvious pathology‡ 39 ± 1.4 million§

Tas1r3−/− w/clofibrate Fertile 7.0 ± 1.0 No obvious pathology N/DGnat3−/− Fertile 6.5 ± 1.4 No obvious pathology‡ 35 ± 2.9 million§

Gnat3−/− w/clofibrate Fertile N/D No obvious pathology N/DTas1r3−/−, Gnat3+/− Fertile N/D N/D Normal{

Gnat3−/−, Tas1r3+/− Fertile N/D N/D N/DGnat3−/−, Tas1r3−/−, mhTas1R3 Fertile 6.1 ± 1.1 No obvious pathology‡ 38 ± 1.44 million§ ∼16% head

abnormalitiesGnat3−/−, Tas1r3−/−, mhTas1R3

w/clofibrateInfertile 0 Giant and pyknotic cells,

exfoliated germinal epithelium‡

Oligospermia§: ∼11 ± 3 million/animal,>18% with head abnormalities

Gnat3−/−, Tas1r3−/− N/D N/D Giant and pyknotic cells,exfoliated germinal epithelium‡

Immotile spermatozoa with multipleabnormalities (>75%)k

All of the tested genotypes are fertile on regular diet. Only Gnat3−/−, Tas1r3−/−,mhTas1R3 (double KO-mhTas1r3) males become sterile within 3 wk on a dietsupplemented with clofibrate. These males regain fertility in 2 wk after switching to regular diet. Note that the Gnat3−/−, Tas1r3−/−, mhTas1R3 genotype isanalogous to the Gnat3−/− genotype; the difference is in expression of the humanized mhTas1r3 transgene vs. endogenous mouse Tas1r3. N/D, not done.*Males of all genotypes with or without clofibrate displayed normal mating behavior when introduced to young females.†The averages are calculated from 7 to 10 recorded litters (4 in Tas1r3−/− on clofibrate).‡Detailed images of H&E-stained sections from testis of the indicated genotypes are shown in Fig. S3.§Epididymal sperm from sexually rested males was counted in a Neubauer hematocytometer as described in Ref. 7. Sperm from both epididymides werecounted. Sperm abnormalities were counted per 100 spermatozoa at least in duplicates for each sample in dry smears fixed in paraformaldehyde. Spermmotility was determined from sperm isolated from vas deferens using the wet mount manual technique in a Neubauer hematocytometer. At least two males ofeach genotype were analyzed. Overall, sperm parameters did not differ significantly between indicated genotypes: average sperm count 37.6 ± 2.2 million/animal (n = 4), motility >60%, <8% total head abnormalities.{Sperm analysis of two males was performed at the Charles River laboratory. Based on their criteria they reported that one male had average spermparameters and one had slightly above average sperm parameters. Charles River normal sperm values for C57BL/6 males: concentration: ∼25–30 million/mL;motility: ∼60%; progressive movement: ∼46%; ∼68% of sperm were normal, ∼10% had no tail or head, ∼5% had head abnormalities, and <5% had eithercytoplasmic droplets (immature sperm), tail abnormalities or bent midpiece.kAbout 25% of the spermatozoa had normally looking heads, 30% had flipped heads,

Table S2. Quantitative PCR analysis of CREM-regulated genes

GeneRelative RNA expression in doubleKO-mhTas1r3 mice on clofibrate

Relative RNA expression in singleGnat3−/−, Tas1r3−/− male

Prm1 0.72 ± 0.06 0.78 ± 0.03Tnp1 0.86 ± 0.09 0.70 ± 0.15Akap4 0.78 ± 0.07 0.72 ± 0.05Gapdhs 0.78 ± 0.06 0.84 ± 0.04Smcp 0.41 ± 0.09 0.77 ± 0.05Spem1 0.47 ± 0.06 0.85 ± 0.08Acrbp* 0.99 ± 0.02 1.09 ± 0.04

Real-time SYBR Green qPCR assay on cDNA from various genotypes was carried out using the Applied Bio-systems StepOnePlus system in triplicates. Gene expression was normalized to β-actin, ribosomal L8, and 18Sreference genes. Relative gene expression in testis of experimental animals was compared with that of WTmales. Each assay was repeated three or more times using three different control cDNAs. Results are shown asaverage relative expressions ± SE.*Acrbp is not controlled by CREM and is expressed in testis from the spermatocyte stage. Here it serves as anadditional control gene.

Mosinger et al. www.pnas.org/cgi/content/short/1302827110 6 of 6