Supporting InformationKondo et al. 10.1073/pnas.1218508110SI MethodsAntibodies. Monoclonal mouse anti-inducible nitride oxide syn-thase (iNOS) was from BD Transduction Laboratories. Biotin-conjugated monoclonal rat anti-mouse Toll-like receptor (TLR)4–myeloid differentiation factor (MD-2) complex and mono-clonal rat anti-mouse CD31 antibodies were from eBioscience.Polyclonal rabbit anti–flotillin-1 antibodies were from SantaCruz Biotechnology. Biotin-conjugated monoclonal mouse anti-lactosylceramide (LacCer)/CD17 antibody (Huly-M13) was fromAncell. Polyclonal goat anti-fluorescein isothiocyanate antibodywas from Rockland. Monoclonal mouse anti-globotriaosylcer-amide (Gb3) (k52) antibody was generated in our laboratory(1). Human monoclonal anti-globotetraosylceramide (Gb4) an-tibodies (HIRO34, HIRO61) were as described (2). Alexa488-conjugated anti-rabbit IgG and Alexa 568-conjugated anti-humanIgG antibodies were from Molecular Probes.

Primary Culture of Vascular Endothelial Cells. For primary culture ofvascular endothelial cells (mECs), thoracic aorta dissociated fromanesthetized mice were treated with type II collagenase (2 mg/mL) for 45 min at 37 °C, followed by flushing with RPMI con-taining 20% FBS. Collected cells were seeded on collagen typeI-coated 35-mm dishes. After incubation for 2 h at 37 °C, thesupernatant was removed and the appropriate culture mediumwas added. After a week, ECs became confluent.

Cell Culture and Incorporation of Glycosphingolipids. Mouse ECswere maintained in RPMI 1640 supplemented with 20% FBS,5 U/mL heparin, and 75–100 μg/mL endothelial cell growth sup-plement (ECGS) at 37 °C in a humidified atmosphere containing5% CO2. To incorporate exogenous glycolipids, plain RPMI 1640containing glycolipids (5–20 μM) was added and incubated for0.5 h at 37 °C. Before the addition of LPS, cells were cultured inRPMI 1640 containing 10% FCS for 1 h.

Reagents. [3H]UDP-GalNAc (ART0156) was from AmericanRadiolabeled Chemicals. Griess reagent (modified), LacCer,Gb4, UDP-GalNAc, LPS 0111:B4, FITC-LPS 0111:B4, Re595,hexadimethrine bromide (polybrene), lipid A from Re595, andHoechst 33342 were from Sigma. Gb4, ortho-phenylene diamine,andH2O2 were fromWako.Gb3was fromLarodan Fine Chemicals.Recombinant mouse IFN-γ was from R&D Systems. ECGS wasfrom BD Biosciences. Collagenase type II was from WorthingtonBiochemical. Twisted silk was from Natsume. The catheter (24-gauge 3/4 inch) was from Terumo. Novo-heparin was fromMochidaPharmaceutical. Purified recombinant human MD-2 proteins weregenerated from Sf9 cells as described previously (3). Purified re-combinant mouse TLR4–MD-2 complexes were prepared fromDrosophila S2 cells as described (4).

Quantitative RT-PCR. The RNAs from vascular ECs and varioustissues were reverse-transcribed into double-stranded cDNA withan oligo dT primer. Quantitative RT-PCR analysis was performedas described (5). Primers used for real-time RT-PCR were de-signed according to Primer3 Input as shown in Table S1.

Western Blotting. Cell lysates were applied to SDS/PAGE using7.5–12% gels. The separated proteins were transferred onto anImmobilon-P membrane (Millipore). Blots were blocked with3% BSA in PBS containing 0.1% Tween-20 (PBS/0.1%T), 3%(wt/vol) skim milk in PBS (or TBS)/0.1%T. The reaction ofmembranes with antibodies was performed as described (1), and

results were analyzed by Photoshop 6.0 (Adobe Systems) andImage 1.61 (National Institutes of Health).

Glycolipid Extraction, TLC, and TLC Immunostaining. Glycolipid ex-traction from mouse tissues and TLC immunostaining wereperformed as described previously (6).

Flow Cytometry. The cell-surface expression of GSLs was analyzedwith FACSCalibur (Becton Dickinson) as described previously (5).To analyze the expression of the TLR4–MD-2 complex or CD31/PECAM-1, cells were detached with 0.5 mM EDTA in PBS.Control samples were prepared using the same isotype antibody.

Construction of Mammalian Expression Vectors. Mouse α1,4-galactosyltransferase (A4galt), TLR4, MD-2, and CD14 cDNAswere obtained by reverse-transcription PCR using total RNA ex-tracted from C57BL/6 mouse peritoneal macrophages. For gen-eration of retrovirus vectors, A4galt cDNA was digested withBamHI/EcoRI and then inserted into modified versions of pMXs,pMXs-GFP, that contained GFP at the 5′ side of the cloning site.Mouse TLR4 cDNA with or without a His6 tag at the 3′ side wasdigested with BamHI/NotI and then inserted into pMXs-IG orpMXs-IB, which have GFP or blasticidin-resistant gene down-stream of the internal ribosomal entry site sequence, respectively.

Generation of Soluble Recombinant MD-2 Protein. To generaterecombinant soluble mouse MD-2, MD-2-V5-His6 that containsV5 and a His6 tag fused at the C terminus was generated by PCRand subcloned into pFastBac1 vector as described previously (3).

Gb4 Induction in mECs by LPS Stimulation. mECs (1 × 105) werestimulated with different doses of LPS 0111:B4 (or Re595) ona six-well plate for 3 d. Then, cells detached with trypsin weresubjected to extraction of lipids using Folch methods. Inductionof Gb4 in response to LPS was analyzed by TLC immunostainingusing anti-Gb4 mAb.

Retroviral Infection and Cell Sorting of Infected Cells. Platinum-E(PLAT-E) packaging cells were plated at 2 × 106 cells per 60-mmdish and incubated overnight. The next day, the cells weretransfected with pMX vectors containing GFP or GFP-fusedA4galt cDNA with Lipofectamine 2000 (Invitrogen) according tothe manufacturer’s protocol. mECs were seeded at 1 × 105 cellsper 35-mm dish 1 d before viral infection. The supernatant wascollected after 48 h and filtered through a 0.45-μm pore-sizefilter and supplemented with 2 μg/mL polybrene and thentransferred to the 35-mm dishes containing the cells. One weekafter the infection, GFP-positive cells were sorted usingFACSVantage SE (BD Biosciences).

MS Analysis of Glycosphingolipids Bound to Soluble MD-2-FLAG-His6in an mEC Cell Line. To examine the binding of endogenous gly-cosphingolipids (GSLs) to MD-2 from ECs, secreted MD-2proteins were purified and lipidomics analysis was performed.Briefly, cDNA encoding MD-2-FLAG-His6 was retrovirally in-troduced into the mEC cell line UV♀2 and transfectant cells wereselected by puromycin. The culture supernatants of these cellswere concentrated ∼20-fold using Amicon filters and then sub-jected to immunoprecipitation by anti-FLAG–conjugated beadsat 4 °C overnight. After elution of FLAG-Hisx6 tagged at the C-terminus of MD-2 by adding extra amounts of FLAG peptide, theeluates were collected and desalted and bound lipids were elutedwith chloroform/methanol (0:1, 2:1, 1:1) using Sep-Pak C18 fol-

Kondo et al. www.pnas.org/cgi/content/short/1218508110 1 of 10

lowed by analysis of chip-based nanoelectrospray ionization MS2.A 4000Q TRAP (AB SCIEX) with a TriVersa NanoMate ioni-zation source (Advion BioSystems) was used. In the positive-ionmode, MS2 and MS3 analysis was carried out with constant neu-tral loss of GalNAc-Gal at the nonreducing terminus and pre-cursor-ion scans for identification and profiling specific speciesof Gb4.

Synthetic Labeling of Gb4 and Binding Assay in Vitro. RadioactiveGb4 was synthesized as described (7). L cells were transfectedwith a GFP-fused B3galnt1 expression vector, and membranefractions were obtained by ultracentrifugation (100,000 × g).Radiolabeled products were visualized by autofluorography.MD-2 (1 μg) was incubated at 37 °C for 2 h with [3H]Gb4 withgentle rocking in the presence or absence of LPS in 100 μL ofPBS. Anti-V5 mAb–conjugated agarose (20 μL) or Ni-conju-gated beads were then added to the suspension (total volume,300 μL). The suspension was incubated at 37 °C for 1 h withgentle rocking. Then the agarose beads were washed with PBS.The radioactivities of the pellets were measured. In competitiveassay, cold GSLs were simultaneously added at 50 μM to themixture of MD-2 and [3H]Gb4.

Native PAGE. LPS 0111:B4, Re595 or Gb4 suspended in PBS wassonicated for 1 min and incubated with TLR4–MD-2 complexes(0.125 μg) in PBS in the presence of 0.1% Triton X-100 in a totalvolume of 5 μL in QSP 0.2-mL thin-wall PCR tubes (Porex BioProducts) at 37 °C for 3 h. After centrifugation of the sampletube at 2,300 × g for 1 min, the loading buffer containing 125mM Tris·HCl (pH 6.8), 20% (vol/vol) glycerol was added, andthe mixture was electrophoresed using a 7.5% native PAGE gel(pH 8.8) as described previously (8) and then transferred ontoa PVDF membrane. TLR4–MD-2 complexes were detected witha polyclonal rabbit antibody for mouse TLR4 and an HRP-la-beled goat anti-rabbit IgG using the ECL Detection System(Amersham).

Molecular Modeling. Molecular modeling and graphics preparationfor structural comparison were performed using TopMatch soft-ware. The following Protein Data Bank (PDB) ID codes were usedfor molecular modeling: 2E59 for human MD-2, 1NEP for cattleNPC2, 1WRF for dust mite Derf2, and 2AF9 for human GM2A.

Docking Simulation.All calculations were done using the programpackage Molecular Operating Environment (MOE; ChemicalComputing Group) and the “MMFF94×” molecular mechanicsforce field. All compounds were subjected to energy minimiza-tion. The molecular docking simulations were carried out usingMOE/Dock with the default setting as follows: The options:Rotate bond was selected. The rescoring function was LondondG with placement of the Alpha Triangle (9, 10). The Site Finderoption of MOE, which automatically identifies internal cavitieswithin a receptor protein, was used to locate possible ligand-binding sites in the MD-2 crystal structure (PDB ID code 2E59).The molecular visualization system PyMOL (open-source soft-ware published by DeLano Scientific) was used to depict thestructures in stereoview. In our in silico study, previously knownligands such as lipid A and eritoran were stably superimposed withMD-2, implying that our experimental settings of docking simu-lation could be used for further docking simulation using Gb4.

Competitive Native PAGE. LPS Re595 or Gb4 suspended in PBSwas sonicated for 1 min and simultaneously incubated withTLR4–MD-2 complexes (0.25 μg) in PBS in the presence of0.1% Triton X-100 in a total volume of 5 μL at 37 °C for 2 h.Inhibition of dimerization of TLR4–MD-2 was analyzed by na-

tive PAGE. Inhibitory modes of Gb4 for LPS binding to TLR4–MD-2 were demonstrated by Lineweaver-Burk plot analysis us-ing bands in native PAGE. Dimer formation of TLR4–MD-2 inthe absence or presence of Gb4 (100 μM) was compared, showinga pattern of noncompetitive inhibition.

Preparation of Glycolipid-Enriched Microdomain/Lipid Rafts. Glyco-lipid-enriched microdomain (GEM)/rafts were prepared usinga method previously reported (11). Briefly, mouse TLR4-His6–expressing mECs were plated on 10-cm dishes and cultured upto 90% confluency. After stimulation with LPS, cells were lysedwith 1% Lubrol WX (Serva) in TNE buffer (25 mM Tris·HCl,pH 7.5, 150 mM NaCl, 5 mM EDTA) containing a proteaseinhibitor mixture (Sigma) for 30 min at 4 °C, and homogenizedwith a stainless homogenizer for 10 strokes. The postnuclear su-pernatant was adjusted to 37.5% OptiPrep (2 mL) (Axis-Shield)and placed in the bottom of a centrifuge tube (Beckman). Thirtypercent OptiPrep (1.25 mL) and TNE buffer (0.75 mL) weresequentially layered. The tubes were spun at 200,000 × g for 3 hat 4 °C using a Beckman MLS50 rotor. Ten 0.4-mL fractions werecollected from the top.A portion (16.7 μL) of each was analyzed by SDS/PAGE

followed by Western blotting. For the detection of endogenousTLR4, proteins in each fraction were concentrated by adding100 μL of 100% trichloroacetic acid followed by incubation for1 h at 4 °C and subsequent centrifugation for 10 min at 20,400 ×g at 4 °C. After being washed with ice-cold acetone, the sampleswere dried at room temperature. Finally, 100 μL of SDS samplebuffer was added and subjected to further analysis.

Extraction of Glycolipids.The fractions were applied to Sep-Pak C18cartridges followed by intensive washes with water, and then gly-colipids were eluted usingmethanol and chloroform/methanol (2:1,1:1). One-fourteenth of the glycolipids extracted from each fractionwas developed on high-performance thin layer chromatography(TLC) silica plates. The bands of interest were visualized by TLCimmunostaining as described above.

ImmunofluorescenceAnalysis.At 24 h before stimulation, cells wereplated and cultured on collagen type I-coated (10 μg/mL) 12-mmdishes. Cells were fixed with 4% paraformaldehyde in PBS for20 min at room temperature. After being blocked in 2% BSA inPBS, the cells were incubated with primary antibodies (50 μg/mLof anti-mouse TLR4 antibody, or 20-fold–diluted supernatant ofanti-Gb4 antibody) for 1 h and then with Alexa 488-conjugatedanti-rabbit IgG and Alexa 568-conjugated anti-human IgG an-tibodies for 1 h. To detect endogenous TLR4 in primary mECs,we used a polyclonal antibody against mouse TLR4 (12).Counterstaining was performed using Hoechst 33342.

Administration of Gb4 to Prevent LPS-Elicited Mortality. Dried Gb4in a glass tube was dissolved in PBS/0.1%T and sonicated for 5min. Then, the same volume of PBS was added to the glass tubeto adjust the concentration of Gb4 to 100 μg/200 μL. At the ageof 6 wk, C57BL/6 mice were i.p. injected with LPS Re595 (0.2μg) together with D-GalN (Tokyo Kasei) (10 mg) in a totalvolume of 200 μL. After 4 h, PBS-T with or without Gb4 wasi.p. injected. The peak of death in the PBS-T control groupoccurred at 6–9 h after D-GalN/LPS injection.

Pathological Examination. For pathological analysis, tissues frommice at 6.5 or 72 h after D-GalN/LPS injection with or without Gb4were perfused with PBS and then fixed with 10% formaldehyde inPBS and embedded in paraffin. The sections were stained withhematoxylin-eosin and then observed under a microscope.

Kondo et al. www.pnas.org/cgi/content/short/1218508110 2 of 10

1. Kondo Y, et al. (2011) Efficient generation of useful monoclonal antibodies reactivewith globotriaosylceramide using knockout mice lacking Gb3/CD77 synthase.Glycoconj J 28(6):371–384.

2. Iwamura K, et al. (2003) The blood group P1 synthase gene is identical to theGb3/CD77 synthase gene. A clue to the solution of the P1/P2/p puzzle. J Biol Chem 278(45):44429–44438.

3. Hyakushima N, et al. (2004) Interaction of soluble form of recombinant extracellularTLR4 domain with MD-2 enables lipopolysaccharide binding and attenuates TLR4-mediated signaling. J Immunol 173(11):6949–6954.

4. Ohto U, Fukase K, Miyake K, Shimizu T (2012) Structural basis of species-specificendotoxin sensing by innate immune receptor TLR4/MD-2. Proc Natl Acad Sci USA109(19):7421–7426.

5. Ohmi Y, et al. (2012) Essential roles of gangliosides in the formation and maintenance ofmembranemicrodomains in brain tissues. Neurochem Res 37(6):1185–1191.

6. Furukawa K, et al. (1985) Analysis of the specificity of five murine anti-blood group Amonoclonal antibodies, including one that identifies type 3 and type 4 A determinants.Biochemistry 24(26):7820–7826.

7. Okajima T, et al. (2000) Expression cloning of human globoside synthase cDNAs.Identification of beta 3Gal-T3 as UDP-N-acetylgalactosamine:globotriaosylceramidebeta 1,3-N-acetylgalactosaminyltransferase. J Biol Chem 275(51):40498–40503.

8. Hailman E, et al. (1994) Lipopolysaccharide (LPS)-binding protein accelerates thebinding of LPS to CD14. J Exp Med 179(1):269–277.

9. Elsässer B, Fels G (2011) Nucleotide docking: prediction of reactant state complexesfor ribonuclease enzymes. J Mol Model 17(8):1953–1962.

10. Onufriev A, Case DA, Bashford D (2002) Effective born radii in the generalized bornapproximation: the importance of being perfect. J Comput Chem 23(14):1297–1304.

11. Boesze-Battaglia K (2006) Isolation of membrane rafts and signaling complexes.Methods Mol Biol 332:169–179.

12. Rumio C, et al. (2006) Activation of smooth muscle and myenteric plexus cells ofjejunum via Toll-like receptor 4. J Cell Physiol 208(1):47–54.

Fig. S1. No differences in LPS responses were observed in cells of various lineages other than endothelial cells. (A) Comparison of morphological changesbetween WT and A4galt−/− peritoneal macrophages in response to LPS. Peritoneal cells were recovered by injecting PBS into mice and then put on 6-cm dishesfollowed by washing the dishes twice with PBS to remove floating cells. After isolation of peritoneal macrophages, the cells were treated with LPS for theindicated times. Total RNAs prepared from each sample were subjected to reverse-transcription and quantitative PCR for nitric oxide synthase 2 (Nos2) andbeta-actin (Actb) genes. (B) To analyze cell populations in spleen, splenocytes were isolated from both types of mice and then stained with antibodies againstB- or T-cell markers such as B220 and CD3e, respectively. Finally, they were analyzed by flow cytometry (Left). n = 3. For proliferative reaction of splenocytes toLPS, 8 × 105 splenocytes were stimulated with LPS (0.1 or 1 μg/mL) for 2 d at 37 °C on 96-well round-bottom plates. Incorporated [3H]thymidine was counted todetermine the proliferative reaction to LPS (Right). Bars represent mean ± SD. Thus, no differences in the reaction to LPS were observed between WT andA4galt KO mice in cells other than endothelial cells. Consequently, no differences in the induction of Nos2 and in the morphological changes in response to LPSwere seen between A4galt-deficient peritoneal macrophages and WT counterparts, although monocytes were known to express a verotoxin receptor in re-sponse to LPS (1). The proliferation response of splenocytes to LPS was also equivalent between the A4galt-deficient and WT mice. Therefore, increased re-sponsiveness to LPS is specific to mECs from A4galt-deficient mice. These data were supported by the fact that LPS signaling in mECs is crucial for LPS-inducedmortality reported as endothelial cell-specific ablation of NF-κB signaling (2).

1. van Setten PA, Monnens LA, Verstraten RG, van den Heuvel LP, van Hinsbergh VW (1996) Effects of verocytotoxin-1 on nonadherent human monocytes: Binding characteristics, proteinsynthesis, and induction of cytokine release. Blood 88(1):174–183.

2. Ye X, Ding J, Zhou X, Chen G, Liu SF (2008) Divergent roles of endothelial NF-kappaB in multiple organ injury and bacterial clearance in mouse models of sepsis. J Exp Med 205(6):1303–1315.

Kondo et al. www.pnas.org/cgi/content/short/1218508110 3 of 10

Fig. S2. Human monoclonal anti-Gb4 antibody HIRO34 reacted equivalently with iGb4 and Gb4. L cells (5 × 105) were plated on six-well dishes and cultured for24 h. Cells were transfected with cDNA for catalytically dead GFP-fused A4galt (GFP-mtGb3S) (Left), GFP-fused A4galt (GFP-Gb3S) (Center), and GFP-fusedA3galt2 (GFP-iGb3S) (Right) together with GFP-fused B3galnt1 (GFP-Gb4S) by the DEAE-dextran method. After 48 h, binding of anti-Gb4 mAb (HIRO34) to cellstransfected with each cDNA set was examined by flow cytometry (black line). As a negative control, isotype-matched control antibody was used (gray his-togram).

Fig. S3. Introduction of A4galt to A4galt−/− vascular endothelial cells. (A) Efficiency of a retroviral vector expression in primary vascular endothelial cells wasdetermined as GFP signals in flow cytometry. (B) Localization of GFP and GFP-fused A4galt was examined using fluorescence microscopy. GM130 was used asa Golgi marker. In contrast with GFP (Left), GFP-fused A4galt was well-merged with GM130 (Right).

Kondo et al. www.pnas.org/cgi/content/short/1218508110 4 of 10

Fig. S4. Introduction of A4galt alleviated the reaction to LPS in A4galt-deficient cells to the level of WT cells, and exogenous Gb4 conferred LPS resistance tomECs. (A) Introduction of Gb3/CD77 synthase cDNA to A4galt−/− cells. Expression of Gb3 and Gb4 in retrovirus-infected cells was examined by flow cytometrywith k95 and HIRO34, respectively. GFP-positive fractions were sorted for the next step. (B) Suppression of LPS-inducible genes in GFP-fused A4galt-expressingcells. Total RNA prepared from retrovirus-infected cells after treatment with LPS (0.1 μg/mL) for the indicated times was subjected to reverse-transcription andquantitative PCR. Open circles represent GFP-A4galt–transfected cells, and closed ones represent GFP-transfected cells. Data are shown as mean values ± SD.Consequently, infected cells showed Gb4 expression at comparable levels to those of WT cells. When treated with LPS, expression of LPS-inducible genes wasextremely suppressed in A4galt-expressing cells. Cxcl10, chemokine (c-x-c motif) ligand 10; Irf1, interferon regulatory factor 1. These data strongly suggestedthat lack of Gb4 in mECs actually causes high sensitivity to LPS. (C) Uptake of exogenous GSLs into cells. Incorporation of exogenous glycolipids in vascularendothelial cells was examined by flow cytometry. Dashed lines indicate endogenously expressed GSLs; solid lines indicate endogenously plus exogenouslyincorporated glycolipids. (D) Suppression of LPS-inducible genes by exogenous Gb4. Total RNA prepared from cells treated with exogenous GSLs and sub-sequently with LPS (0.1 μg/mL) for the indicated times was subjected to reverse-transcription and quantitative PCR for Nos2, Ccl5, Cxcl10, and Actb genes. Ccl5,chemokine (c-c motif) ligand 5. Open circles represent Gb4-treated (10 μM), and x represents LacCer-treated (10 μM) cells. Closed circles are cells treated withmedium alone. Data are mean ± SD in B and D. A representative result of experiments repeated several times is shown. As expected, exogenous GSLs wereefficiently incorporated into the cell surface, resulting in the suppressed expression of LPS-inducible genes in Gb4-incorporated cells. These results suggestedthat increased responses in A4galt-deficient mECs were due to lack of Gb4, and that Gb4 might suppress inflammatory reactions.

Kondo et al. www.pnas.org/cgi/content/short/1218508110 5 of 10

Fig. S5. No differences in the expression of LPS-related receptors between WT and A4galt-deficient cells. (A) Cell-surface expression of the TLR4–MD-2complex was determined by flow cytometry. Detached cells by 0.5 mM EDTA in PBS were incubated with anti–TLR4–MD-2 antibody for 60 min at 4 °C. Aftertwo washes, the expression of TLR4–MD-2 was determined by flow cytometry. (B) Binding of FITC-labeled LPS to the cell surface was determined by flowcytometry. Detached cells by 0.5 mM EDTA in PBS were incubated with FITC-LPS (5 μg/mL) for 30 min at 37 °C. After two washes with PBS, the binding of FITC-LPS to the cell surface was determined by flow cytometry. (C) Total RNAs prepared from vascular endothelial cells were subjected to reverse-transcription andquantitative PCR for Tlr4 (toll-like receptor 4), Cd14, Ly96 (lymphocyte antigen 96), and Actb genes. n = 2. As a positive control for CD14, RNA extracted fromRAW264.7 was used. Data are mean ± SD. These results showed that the expression levels of the TLR4–MD-2 complex were equivalent between the two typesof cells. Similar binding of FITC-labeled LPS to the cell surface was also observed. Furthermore, there were also no differences in the expression levels of LPSreceptor genes between the two types of cells. Primary mECs were completely absent in the expression of Cd14 gene, as reported (1). mVECS, vascular en-dothelial cells.

1. Pugin J, et al. (1993) Lipopolysaccharide activation of human endothelial and epithelial cells is mediated by lipopolysaccharide-binding protein and soluble CD14. Proc Natl Acad SciUSA 90(7):2744–2748.

Kondo et al. www.pnas.org/cgi/content/short/1218508110 6 of 10

Fig. S6. Comparison of sequence alignments of MD-2 with the GM2 activator and superimposition of 3D structures of MD-2 and the GM2 activator. (A)Comparison of sequence alignment of human MD-2 with human GM2 activator was carried out by ClustalW. hMD-2, human MD-2; hGM2A, human GM2activator. (B) Superimposition of structures of human MD-2 and human GM2 activator was carried out by TopMatch. The following PDB codes were used formolecular modeling: 2E59 for human MD-2; 2AF9 for human GM2A. Note that comparison of GM2A and MD-2 in their primary structures revealed relativelylow similarity, and their 3D structures reported to date are not so similar. However, when they were overlapped, they showed well-matched 3D structures.

Kondo et al. www.pnas.org/cgi/content/short/1218508110 7 of 10

Fig. S7. Generation of recombinant soluble mouse MD-2 protein fused with V5-His6 tag in insect cells. (A) Production of mouse MD-2 fused with V5-His6 incell-culture supernatant collected from insect cells after infection of P3 baculovirus was confirmed by SDS/PAGE followed by Western blotting using anti-His6tag antibody (Left). Purification of mouse MD-2 fused with V5-His6 was performed using Ni-NTA column chromatography, and the efficiency was examined bySDS/PAGE followed by Western blotting using anti-His6 antibody (Center). The purity of mouse MD-2 fused with V5-His6 was confirmed by Coomassie brilliantblue (CBB) staining (Right). CL, cell lysates; CM, culture medium; FT, flow-through; Mr, molecular weight marker; purified, eluates by imidazole. mMD-2, mousemD-2. (B) Binding of the recombinant MD-2 protein to LPS was confirmed by coprecipitation. Briefly, recombinant MD-2 protein was incubated with FITC-labeled LPS and then immunoprecipitated with anti-FITC antibody followed by SDS/PAGE and Western blotting using anti-His6 antibody. (C) Binding of therecombinant MD-2 protein to LPS was also confirmed by ELISA. Consequently, generated recombinant MD-2 protein was shown to have an LPS-binding ca-pacity in both the liquid phase and solid phase, as reported (1).

1. Re F, Strominger JL (2002) Monomeric recombinant MD-2 binds Toll-like receptor 4 tightly and confers lipopolysaccharide responsiveness. J Biol Chem 277(26):23427–23432.

Kondo et al. www.pnas.org/cgi/content/short/1218508110 8 of 10

Fig. S8. Nanoelectrospray ionization MS of GSLs bound to secreted MD-2-FLAG-His6 from Gb4-positive UV♀2 cells. To examine whether the binding of en-dogenously expressed GSLs such as Gb4 are detected in secreted MD-2, neutral-loss (NL) scanning MS2 analysis was performed. We found three differentmolecular species of ceramide, d18:1-C16:0 (m/z 1249.8), d18:1-C24:1 (m/z 1359.9), and d18:1-C24:0 (m/z 1361.9), in Gb4 fractions extracted from UV♀2 cells,and questioned which specific species of Gb4 dominantly bound to MD-2. Two peaks corresponding to d18:1-C16:0 (m/z 1249.7) and d18:1-C24:0 (m/z 1362.0)were detected. (Upper) An m/z peak around 1360 corresponds to Gb4 (d18:1-C24:0, and d18:1-C24:1) in the sample derived from the UV♀2-neutral lipidfraction (Left), whereas the sample derived from eluates containing MD-2-FLAG-His6 (Center) showed mainly the d18:1-C24:0 peak. The sample derived fromcontrol eluates (Right) showed no significant peaks. (Lower) An m/z peak around 1250 corresponding to Gb4 (d18:1-C16:0).

Kondo et al. www.pnas.org/cgi/content/short/1218508110 9 of 10

Fig. S9. Transient colocalization of TLR4 with Gb4 in GEM/rafts after treatment with LPS. (A) Primary vascular endothelial cells treated with LPS 0111:B4 (0.1μg/mL) for the indicated times were fixed with 4% paraformaldehyde in PBS at room temperature for 20 min and then stained with rabbit anti-mouse TLR4antibody and human anti-Gb4 antibody followed by staining with Alexa 488-conjugated anti-rabbit IgG and Alexa 568-conjugated anti-human IgG antibodies,respectively. The resulting staining patterns were imaged using a confocal microscope (FV10i-DOC; Olympus). Red, Gb4; green, TLR4; blue, nucleus. Scale bars,10 μm. A representative result of experiments repeated several times is shown. (B) Each fraction from a sucrose gradient was subjected to the extraction ofglycolipids, and then the extracted GSLs were developed by TLC followed by transfer to PVDF membranes and TLC immunostaining. Western blotting wasperformed with specific antibodies. (C) TLR4 was immunoblotted with an anti–His6-tag antibody. iTLR4, immature form of TLR4; mTLR4, mature form of TLR4.

Table S1. Sequences of primers used for real-time RT-PCR

Gene Forward primer, 5′-3′ Reverse primer, 5′-3′ Product size, bp

Actb GATGGTGGGAATGGGTCAGA CAGAGGCATACAGGGACAGC 308Cd14 TCTTTCACTGGGCTGAAGCA ACGAGGACCCTCAGAAACCA 308Ly96 ATGTTGCCATTTATTCTCTTTTCGACG ATTGACATCACGGCGGTGAATGATG 426Tlr4 GGAAGCTTGAATCCCTGCAT TTTGTCTCCACAGCCACCAG 341Cxcl10 GGAGTGAAGCCACGCACAC ATGGAGAGAGGCTCTCTGCTGT 63Ccl5 TTTCTACACCAGCAGCAAGTGC CACACACTTGGCGGTTCCT 71Nos2 GAGGTACTCAGCGTGCTCCA AGAGCCTCGTGGCTTTGG 253A4galt CCTGTTCCCATCTGGAGGAG CCCTTTCATCAGCACAACCA 356B3galnt1 TCTTGACTGCCCTTCCCAAT GGAGCGTGAAGCGAAAGTCT 189Ifnb1 CCACCACAGCCCTCTCCATCAACTAT CAAGTGGAGAGCAGTTGAGGACATC 368Tnf CCACATCTCCCTCCAGAAAA AGGGTCTGGGCCATAGAACT 259Il6 TTCCATCCAGTTGCCTTCTT ATTTCCACCATTTCCCAGAG 170Il1b GCCCATCCTCTGTGACTCAT AGGCCACAGGTATTTTGTCG 230Irf1 CAGAGGAAAGAGAGAAAGTCC CACACGGTGACAGTGCTGG 208

Primers used for real-time RT-PCR were designed according to Primer3 Input (http://frodo.wi.mit.edu/).B3galnt, beta1,3-GalNAc-T; Irf1, interferon regulatory factor 1; Tnf, tumor necrosis factor.

Kondo et al. www.pnas.org/cgi/content/short/1218508110 10 of 10