supplementary webappendix€¦ · guideline of ich q2r1 to fulfil the requirements of european...

Supplementary webappendixThis webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors.

Supplement to: Schwameis M, Roppenser B, Firbas C, et al. Safety, tolerability, and immunogenicity of a recombinant toxic shock syndrome toxin (rTSST)-1 variant vaccine: a randomised, double-blind, adjuvant-controlled, dose escalation first-in-man trial. Lancet Infect Dis 2016; published online June 10. http://dx.doi.org/10.1016/xxxx.

rTSST-1v_appendix 11-05-2016

1

I METHODS

Inclusion criteria

• Signed informed consent obtained before any trial-related activities

• Ability to comprehend the full nature and purpose of the study, including possible risks and

side effects; ability to co-operate with the investigator and to comply with the requirements

of the entire study

• Men or women aged >18 and <65 years

• In female subjects a negative urine pregnancy test during screening and the willingness not

to become pregnant during the entire study period by practicing reliable methods of

contraception

• Normal findings in the medical history and by physical examination or the investigator

considers all abnormalities to be clinically irrelevant

• Normal laboratory values or the investigator considers all abnormalities to be clinically

irrelevant

Exclusion criteria

• Treatment with an investigational drug within one month prior to this trial

•History of immunodeficiency or immunosuppressive therapy, known Human

Immunodeficiency Virus (HIV) infection or Hepatitis B/C infection

• Drug addiction including alcohol dependence

• Inability or unwillingness to avoid more than the usual intake of alcohol during the 48 hours

after vaccination

• Blood donations during the 1st month prior to this study

• Recent infection (within 1 week prior to visit 1)

•Relevant history of renal, hepatic, gastrointestinal, cardiovascular, respiratory, skin,


2

hematological, endocrine, inflammatory or neurological diseases, that in the opinion of the

investigator may interfere with the aim of the study

• Ascertained or presumed hypersensitivity to the active principle and/or formulations'

ingredients; history of anaphylaxis to drugs or major allergic reactions in general, which the

investigator considers may compromise the safety of the volunteers

• Clinically relevant abnormal laboratory values indicative of physical illness or signs and

symptoms of relevant autoimmunity

• Use of medication during 2 weeks before the visit 1, which the investigator considers may

affect the validity of the study except hormonal contraception in female subjects; prior to

taking any medication during 72 h prior to visit 1, the study center should be consulted.

• Pregnancy (positive pregnancy test at screening or during study phase), lactation or

unreliable contraception in female subjects with child-bearing potential.

• Subjects with any condition, which in the opinion of the investigator makes the subject

unsuitable for inclusion

• Inability or unwillingness to provide informed consent and to abide by the

requirements of the study

• Baseline TSST-1 Ab titer > 1:2000


3

Production, Purification and Control of rTSST-1v

Production, purification, and quality control of the vaccine have been carried out adhering to

GMP protocols1 implemented and controlled by MM Eibl, JG Graus, and Bio Products & Bio

Engineering.

The level of lipopolysaccharides was measured by using the kinetic chromogenic version of

the Limulus Amoebocyte Assay method, which is established in our laboratory since 2007. A

ready-to-use product by Lonza (Product Code: 50-650U) was validated according to the

guideline of ICH Q2R1 to fulfil the requirements of European Pharmacopoeia 2.6.14

Bacterial Endotoxins and the FDA Guideline on “Validation of the Limulus Amoebocyte

Lysate test as an end-product test for human and animal parenteral drugs, biological products

and medical devices”. We participated in inter-laboratory testing (LAL Proficiency Testing

Program, C. River Laboratories International, Inc.) four times per year since 2011. In the

current trial, all tests were performed according actual standard operation procedures and

documented with the corresponding performance protocol. All devices used are part of a

calibration and monitoring program and therefore in valid status. The two lowest doses

(100ng and 300ng) were given in smaller volumes. 0.1 µg rTSST-1v was given as 0.1 ml

having 0.2 mg of adjuvant, and 0.3 µg rTSST-1v was given as 0.3 ml having 0.6 mg of

Al(OH)3. All higher doses were administered with 1 mg adjuvant.

Reference:

1ICH Harmonised Tripartite Guideline. Guidance on nonclinical safety studies for the

conduct of human clinical trials and marketing authorization for pharmaceuticals M3 (R2).

http://www.fda.gov/downloads/drugs/guidancecomplianceregulatoryinformation/guidances/u

cm073246.pdf


4

Isolation and stimulation of Peripheral blood mononuclear cells (PBMCs)

PBMCs were isolated from heparinized blood of healthy human adults using density gradient

centrifugation with Lymphoprep TM (Axis-Shield PoC, Oslo, Norway) as previously

described.1 PBMC were cultured in complete medium (RPMI 1640 medium (Gibco), 10 %

FCS (HyClone, Logan, UK), 2 mM L-glutamine (Invitrogen, Paisley, UK), 100 U/ml

penicillin, and 100 µg/ml streptomycin (Invitrogen). For Real time PCRs, we used the cells at

a concentration of 5x106/ml in 24-well flat-bottom tissue culture plates (Sarstedt, Newton,

NC, USA) and stimulated with a final concentration of 1ng/ml wild type recombinant TSST-

1 (rTSST-1) in humidified atmosphere (37 °C, 5 % CO2) for 5h. For cell proliferation assays,

we used cells at a concentration of 1x106/ml in 96-well flat-bottom tissue culture plates

(Sarstedt, Newton, NC, USA) and stimulated with a final concentration of 0.1ng/ml wild type

recombinant TSST-1. As a positive control for the assay, the mitogens phytohaemagglutinin

(PHA), phorbol myristate acetate (PMA), and ionomycin (Iono) were used (data not shown).

Sera from trial participants were added to PBMCs at final dilutions of 1:1000 and 1:3000 to

assess stimulation of rTSST-1. For analysis of cell proliferation, on day four 0.5 µCi/well 3H-

thymidine (ICN, Irvine, U.S.A.) was added and cells were incubated for 18 hours. Cells were

frozen at –20°C until harvested onto glass fiber filters. Incorporated radioactivity was

measured with a MicroBeta Trilux 1450 scintillation counter (Wallac, Turku, Finland).

RNA extracting and reverse transcription

For Real time PCR analysis, PBMC cells were transferred to Eppendorf tubes after

stimulation followed by centrifugation at 4°C and 2000 x g for 5min. Cell pellets were frozen

at –20°C before extracting RNA. RNA was extracted from frozen PBMC pellets using an

RNA Isolation kit (Roche). RNA was then reversely transcribed into cDNA using a 2xRT Kit

(Invitrogen, Paisley, UK).


5

Primer design

Gene-specific oligonucleotide primers were designed by hand and by primer design Primer

Express® v2.0 software from Applied Biosystems (Foster City, CA). Primer pairs were

synthesized at MWG/Eurofins Biotech (Heidelberg, Germany) and at Invitrogen. Here, for

the assessment of interleukin 2 gene expression, we used AAACCTCTGGAGGAAGTG as

IL-2 forward primer, and GTTCAGAAATTCTACAATGG as IL-2 reverse primer.

Hypoxanthin-Guanin-Phosphoribosyl-Transferase (HPRT) was chosen as standard house-

keeping gene, using the primer pair AGGCCATCACATTGTAGCCC (hprt forward) and

GTTGAGAGATCATCTCCACCG (hprt reverse). cDNA standards were prepared as

previously described.

Quantitative Real time PCR (QRT-PCR)

QRT-PCR was described previously.1 In short, cDNA from samples and standards were

simultaneously amplified on the same plate (MicroAmp, Applied Biosystems, Vienna,

Austria) using an ABI Prism 7500-FAST (Applied Biosystems, Vienna, Austria) with the

KAPA SYBR FAST Super Mix from PEQLAB (Erlangen, Germany) and ROX as reference

dye. At the end of the amplification, a melting curve analysis was performed. The number of

target cDNA copy numbers in cellular samples was calculated by creating a standard curve

where cycles at threshold (CT) were plotted against logarithmic values of the cDNA standard

copy number. The house-keeping gene HPRT served as an internal standard. Fold induction

of mRNA expression was assessed from values normalized for the expression of HPRT and

then related to the mean values derived from unstimulated PBMCs of three human donors.


6

Safety assessment

Vital sign checks including heart rate, blood pressure, oxygen saturation and oral temperature

measurements, blood samples for safety analysis, and local side effects were assessed at

baseline and at four predefined time points: at six hours, 2 days,7 days and 14 days after each

vaccination (Table 1). Additionally, participants were required to keep a study diary to

record any adverse events. Safety monitoring was carried out by the sponsor at the study site.

Safety assessment at screening visit included:

• Medical history

• Concomitant medication

• Body weight and height

• Vital signs

• Hematology: red blood cell count (RBC), white blood cell count (WBC), leukocyte

differential count (neutrophils, basophils, eosinophils, monocytes and lymphocytes),

platelet count, hemoglobin, hematocrit

• Clinical chemistry (renal and hepatic function): Alanine transaminase (ALT), Blood

urea nitrogen (BUN), creatinine, and C-reactive protein

• C-reactive protein

• Cytokines: Interleukin (IL)-2 receptor alpha, IL-6, tumor necrosis factor (TNF)-alpha

and interferon (IFN)-gamma

• TSST-1 antibody titer

• Serology: HIV Ab, HCV Ab, HBs Ag

• Pregnancy test


7

Safety laboratory parameters were assessed at baseline, 6h, 48 h, 7d, and 14 d after each

immunization included:

• Vital signs

• Hematology: red blood cell count (RBC), white blood cell count (WBC), leukocyte

differential count, platelet count, hemoglobin, hematocrit

• Clinical chemistry (renal and hepatic function)

• C-reactive protein

• Cytokines

• TSST antibody titer

Pregnancy tests were assessed at least three times during the study, first at the screening visit

and then prior to every immunization.

Local skin reactions and tolerability were monitored at 6 h, 48 h, 7 days and 14 days after

each immunization.


8

Table 1. Safety assessment profile

PERIODS Name SCREENING TREATMENT FOLLOW-UP AFTER EACH IMMUNIZATION

Duration 25 days 4 – 16 weeks 14 days VISITS Number 0 1 1-1 2-1 3-1 1-2

2-2 3-2

1-3 2-3 3-3

1-4 2-4 3-4

1-5 2-5 3-5

Name Screening Randomi-

zation

Immuni-zation 1

Immuni-zation 2

Immuni-zation 3 1

Follow-up 1

Follow-up 2

Follow-up 3

Follow-up 4

Time -28 to -3 days Day 0 Day 0 Weeks 4-8 Weeks 8-12

6 h

48 h ± 2 h

7 days ± 1 day

14 days ± 2 days

Informed consent X Inclusion/exclusion criteria X Medical history X Concomitant medication X X X X X X X X Physical examination X Body weight and height X Vital Signs (BP, HR, oral temperature)

X X X X X X X X

Hematology X X X X X X X X Clinical Chemistry X X X X X X X X C-reactive Protein X X X X X X X X Cytokines X X X X X X X X TSST-1 Ab titer X X X X X X X X Local reactions/ Adverse events

X X X X X X X


9

Randomization X HIV Ab, HCVAb, HBsAg X Pregnancy test X X X X

1 If there was no immune response in any dose group after the second immunization, a third immunization using ≥1 µg rTSST-1 was administered 4-8 weeks thereafter.


10

Dose escalation – safety requirements

A positive safety analysis was required before escalating doses of rTSST-1 and Al(OH)3 at a

1-week interval. Participants were followed for a period of 14 days for the assessment of

adverse events (and immunogenicity) at four predefined time points (see above; 6h, 48 h, 7d,

and 14 d after each immunization after each vaccination).

No more than two participants per day were allowed to receive the first vaccination at a 1 h

interval. After vaccination, each participant was medically observed for adverse events over a

period of 1 hour. Prior to discharge participants were instructed about how to proceed in case

of an emergency and a pocket emergency pass was dispensed including information about the

trial site, the investigational drug and a telephone number of an on-call physician. After all

participants in the 100ng group had been vaccinated once, a safety analysis was performed by

the principal investigator and transition to higher dose vaccinations required a positive safety

assessment by the principal investigator. The same procedure was applied for subsequent

escalation to higher-dose groups.

Study visits

- Screening visit.

A screening visit had to be performed four weeks to three days before study enrolment. All

subjects considered eligible underwent a full physical examination including height and

weight measurement, assessment of heart rate and systolic/diastolic blood pressure

measurement and oral temperature evaluation. Blood and urine samples were collected for

clinical laboratory assays, i.e. complete blood count, coagulation parameters, liver and kidney

function tests, electrolytes, virology (hepatitis B, C and HIV). A urine pregnancy test was

performed in women of child-bearing potential. Subjects were informed about the study aims,


11

procedures and possible risks of the study and were asked to read and sign an Informed

Consent Form.

- Treatment phase.

Trial day 0 (1st immunization). The urine pregnancy test was repeated in women of child-

bearing potential. In supine position, vital parameters were monitored (blood pressure, heart

rate, oral body temperature). A baseline blood sample was drawn from an i.v. catheter

inserted into an antecubital vein.

The study medication (investigational rTSST-1v vaccine or adjuvant placebo comparator)

was injected intramuscularly (M. deltoideus, maximum volume of 0.5mL), preferably into the

non-dominant arm. Blood samples were obtained on day 0 at six hours after vaccination and

assessed for hematology, clinical chemistry, C-reactive protein, cytokines and TSST-1 Ab. In

parallel, vital parameters (oral temperature, heart rate and systolic/diastolic blood pressure)

were determined 6 hours after the first immunization. Any adverse events/local reactions and

concomitant medications were recorded.

Week 4 - 8 (2nd immunization). Safety assessment was performed as on trial day 0

Week 8 - 12 (3rd immunization). If there was no immune response in any dose group after the

second immunization, a third immunization was administered 4 - 8 weeks thereafter. Safety

assessment as on trial day 0.

- Follow-up period after each immunization.

Safety evaluations were performed at four different time points after each vaccination (6 h,

48 h, 7 days and 14 days). At each of these time points, vital signs were determined, blood

samples were obtained and assessed for hematology, clinical chemistry, C-reactive protein,


12

cytokines and TSST-1 Ab. Concomitant medications were documented. Any adverse

events/local reactions were documented.

- Patient diary (Figure 1).

All participants were required to keep a study diary between visits for the documentation of

local or systemic adverse events. At each visit diaries were reviewed by a physician to verify

the accuracy of reported symptoms by interviewing the participants for any adverse events.

Safety monitoring was carried out by the sponsor at the study site.

rTSST-1v_appendix

13

Figure 1. Patient diary sample pages

rTSST-1v_appendix

14

II RESULTS

Figure 2. Increase in geometric mean titers from baseline to 14 days after second immunization in the per-protocol population according to rTSST-

1v treatment cohorts (n=33; groups 1-3, top layers; groups 4-6, mid layers; n=12 placebo group, bottom layer). Titers below 20 were set to 1.

rTSST-1v_appendix

15

Table 2. Antibody titer, in-vitro neutralization of T cell activation (%) and IL-2 gene expression (%) by sera of study participants who had < 4-fold

titer increase after the second vaccination.

Elisa titer Inhibition of proliferation % IL-2 fold induction Study subject

Day 0 Day 14

Day 42

Day 56

before Imm.

1:1000

before Imm.

1:3000

after Imm.

1:1000

after Imm.

1:3000

before Imm.

1:1000

before Imm.

1:3000

after Imm.

1:1000

after Imm.

1:3000 1 279 413 409 700 3 0 25 0 41 165 16 40 8 367 408 510 825 0 0 32 0 277 334 49 124 12 716 764 740 885 60 2 57 35 9 41 9 34 22 0 0 0 0 0 18 9 0 285 354 196 194 49 0 0 0 0 0 0 2 0 152 136 68 72

Five participants vaccinated with rTSST-1v did not show a 4-fold titer increase at the end of the study. Two of them (#1+8) had pre-existent

antibody titers but were boosted <4-fold by the second vaccination. One (#12) had a pre-existent antibody titer, but did not show a no significant

increase after any vaccination. In the remaining two subjects (#22+49) no humoral immune response was observed.

rTSST-1v_appendix

16

Table 3. Cytokine levels before and after immunization of participants.

Cytokine ELISA

before immunization 14d after 2nd Immunization Participant Dose group IL-61 TNFα1 IL-2R1 IFNγ2 IL-6 TNFα IL-2R IFNγ

1 100ng < Min3 < Min 876 < Min < Min < Min 812 < Min

2 100ng < Min < Min 1644 < Min < Min < Min 1513 < Min

3 Placebo 3,5 < Min 916 < Min < Min < Min 980 < Min

4 Placebo < Min < Min 872 < Min < Min < Min 979 < Min



8 1µg < Min < Min 1132 < Min < Min < Min 1092 < Min










18 Placebo 7 < Min 1012 < Min 50 < Min 1995 < Min


20 Placebo < Min < Min 736 < Min 8 < Min 1604 < Min

21 30µg < Min 9,8 1128 < Min < Min < Min 769 < Min

22 30µg < Min < Min 900 < Min 2 < Min 1301 < Min


24 3µg < Min < Min 1695 < Min < Min 7 1804 0,12




rTSST-1v_appendix

17

1 units: pg/ml 2 units: IU/ml 3 < Min: minimum detectable concentration is defined in the manufacturer‘s protocols





33 3µg < Min < Min 897 < Min 24 < Min 898 < Min


35 10µg < Min 7 1089 < Min < Min < Min 1048 < Min

36 10µg < Min 7,2 1656 < Min < Min < Min 1582 < Min

37 10µg 11 < Min 1378 < Min < Min < Min 1509 < Min










49 30µg 23,79 < Min 1263 < Min < Min < Min 1119 < Min

18

III PRECLINICAL STUDIES

The BioMed r-TSST-1v and vaccine

Based on information on the structure and functional relationship of S. aureus TSST-1, mutants

have been established with the objective of eradicating the toxic and superantigenic properties,

while leaving specific immunogenicity and protectivity unimpaired (Roggiani 2000, Ulrich

1998, Gampfer 2002). After molecular characterization and thorough biological and

immunological testing, a TSST-1 double mutant (G31R-H135A) has been chosen for the

rTSST-1v vaccine (Gampfer 2002). Amino acid changes in position 31 have been shown to

result in impaired interaction with MHC class II molecules (Kum 1996), whereas mutation of

histidine 135 to alanine negatively affects the binding of TSST-1 to the T cell receptor

(McCormick 2003). The double mutant has been expressed in E. coli BL21, purified by

chromatography and formulated with Al(OH)3.

Proof of concept (Investigator’s Brochure abstract)

A non-clinical, prospective, controlled, randomized open Immunogenicity and Protection Study

(Study Bio&Bio 031114) was conducted in conformity with GLP to evaluate the

immunogenicity and protection of the BioMed rTSST-1v vaccine in a rabbit model.

Design: Prospective, controlled, randomised, open study. TSST-1 antibody negative rabbits

were randomized and immunized with the test or the reference item four times at three-week

intervals. Blood samples were drawn prior to entry (baseline), one day prior to the second,

third, and fourth immunizations, and three weeks after the fourth immunization to determine

TSST-1 antibody levels. Thereafter, animals in both groups were challenged with TSST-1 and

four hours later with lipopolysaccharide (LPS) and observed for survival for five days.

19

Results: 20 female rabbits weighing 1,672 g on average with TSST-1 antibody titers of < 20

were randomly assigned to Group 1 (adjuvanted vaccine) or Group 2 (adjuvant alone). TSST-

1 antibody titers in the immunized group rose to a GM of 624 as early as three weeks after the

2nd immunization and reached a GM of 22,328 and 37,217 three weeks after the third and

fourth, respectively. In controls, TSST-1 antibody titers remained < 20 throughout. All

vaccinated animals seroconverted (i.e. had > 4-fold increases in TSST-1 antibody titer with

respect to baseline) after the third immunization. None did so in the control group (p < 0.001).

All vaccinated animals survived the challenge with TSST-1 and LPS, while all control

animals succumbed (p < 0.001).

Regulatory Status: The study was conducted in compliance with OECD Principles on GLP

and applicable European and Austrian regulations.

No evidence of superantigenicity

Non-clinical experiments in vivo have shown that rTSST-1v lacks super-antigen activity and

does not lead to T-cell activation or induce an increase in IL-2 gene activation in the spleen of

rabbits. Lack of super-antigen activity has also been demonstrated in mice. IL-2

concentrations remained at background level after injection of rTSST-1v.

Non-clinical experiments in vitro have shown r-TSST-1v not to induce IL-2 gene activation

up to concentrations of 1000 ng/ml in human mononuclear cells proving rTSST-1v to be

detoxified. Lack of activation and release of inflammatory cytokines could be proven. rTSST-

1v lost its super-antigen property by the detoxifying mutations. rTSST-1v does not induce T-

cell proliferation of human mononuclear cells as estimated by H3 thymidin incorporation. It

lacks the characteristics of a super-antigen and behaves as a normal antigen.

20

No evidence of toxicity

The rTSST-1v vaccine was tested in rabbits in doses up to 1 mg per rabbit, and such high

doses were well tolerated.

In vivo experiments in rabbits have shown that the rTSST-1v vaccine antigen does not induce

fever, leukopenia or lympohopenia. Studies performed in mice and rabbits have demonstrated

that super-antigen activity and toxicity with respect to activation and release of the

inflammatory cytokines TNFα, INF-γ, and IL6 have been eliminated due to the mutations in

rTSST-1v. Superantigen toxins are known to increase the lethal effect of endotoxin (LPS) up

to over 1000-fold. rTSST-1v has been extensively tested in rabbits and mice and did not

increase LPS lethality.

A prospective, controlled, randomized, open repeated dose toxicity and local tolerance study

of the BioMed rTSST-1v vaccine (Study Bio & Bio 101115) was conducted in conformity

with GLP to evaluate the toxicity and local tolerance of the Biomed rTSST-1v vaccine after

repeated applications in a rabbit model.

Ten male and ten female rabbits were randomly assigned to one of two groups: Group 1

received 1 ml 30 µg of rTSST-1v vaccine, group 2 was given 1 ml of adjuvant (Al(OH)3) four

times at intervals of three weeks. Blood was drawn prior to the first immunization and at

specified time points during the study for hematology, coagulation, clinical chemistry,

electrolytes, C-reactive protein, antibody against antigenic substances that can cross react with

human tissue, and immune complexes. TSST-1 antibody levels were determined prior to the

fourth immunization. Vital signs, body weight, and intake of food and water was monitored.

Clinical and physical observations were made on scheduled days. General health was assessed

daily. Local tolerance was determined by visual inspection before and at several time points

21

after each vaccination for indications of reactogenicity. Moribundity/mortality, clinical and

physical observations and general health were monitored throughout the treatment and

observation periods.

Two to three days after the last immunization, the animals were euthanized. Ophthalmoscopy

was performed prior to sacrifice. Post mortem examinations included gross pathology and

histopathology of a number of organs, including the injection site tissue.

There were a few differences between groups, most of them small and gender specific and

within the variability of the normal range. These variations were considered as clinically

irrelevant. The study revealed that rTSST-1v vaccine does not have any toxicity at the human

dose in this animal model after four immunizations.

In vitro experiments have shown that rTSST-1vdoes not induce the release of TNFα, INF-γ,

and IL6 in cultures of human mononuclear cells.

Summarizing, the safety of rTSST-1vhas been shown in numerous pre-clinical studies, both

non-GLP and GLP. rTSST-1 did not enhance LPS activity up to dose levels 10 times the dose

intended to be used in humans.

22

CLINICAL STUDY PROTOCOL

Study Name:

Phase 1 Clinical Trial of the BioMed rTSST-1 Variant Vaccine in Healthy Adults

Study identifying number:

BioMed 0713

Version 1.3 / December 17, 2013

Confidentiality Statement The information contained in this document, especially unpublished data, is the property of the sponsor of this study. It is therefore provided to you in confidence as an investigator, potential investigator, or consultant, for review by you, your staff, and an Independent Ethics Committee or Institutional Review Board. It is understood that this information will not be disclosed to others without written authorization from the Biomedizinische Forschungs Ges.m.b.H, except to the extent necessary to obtain informed consent from those persons to whom the study test or reference preparation may be administered.

23

Test drug (IMP) and

Pharmaceutical Company

rTSST-1 Variant Vaccine

Biomedizinische Forschungs Ges.m.b-H. Lazarettgasse 19, 1090 Vienna Austria

Protocol authors Prof. Martha Eibl, MD, Marianne Kunschak, SM

Investigator Prof. Bernd Jilma, MD Clinical Pharmacology University of Vienna Medical School Währinger Gürtel 18-20 1090 Vienna

Document type Clinical study protocol

Study phase 1

Document status Final

Date December 17, 2013

Number of pages 53

24

1. SPONSOR, INVESTIGATOR, MONITOR AND SIGNATURES Sponsor/or representative (AMG §§ 2a, 31,32) Biomedizinische Forschungs GmbH Lazarettgasse 19 1090 Vienna represented by Prof. Martha Eibl, MD ________________ ___________ Signature Date Investigator (AMG §§ 2a, 35,36) Prof. Bernd Jilma, MD Clinical Pharmacology University of Vienna Medical School Währinger Gürtel 18 - 20 1090 Vienna _________________ ___________ Signature Date Monitor/ or Representative of CRO (AMG §§ 2a, 33,34) Ines Mader, MD Creta - cancer research & trial agency GmbH Kirchengasse 4 7202 Bad Sauerbrunn

25

Clinical Trial Center: Clinical Pharmacology University of Vienna Medical School Währinger Gürtel 18 - 20 1090 Vienna Associated Departments Clinical Institute of Medical and Chemical Laboratory Diagnostics Head: Prof. Oswald Wagner, MD Währinger Gürtel 18 - 20 1090 Vienna

26

2. PROTOCOL SYNOPSIS TITLE Phase 1 Clinical Trial of the BioMed r-TSST-1 Variant Vaccine in

Healthy Adults OBJECTIVES Primary Objective

To demonstrate the safety and tolerability of the BioMed rTSST-1 Variant Vaccine in healthy adults Secondary Objective To assess the immunogenicity of the BioMed rTSST-1 Variant Vaccine in healthy adults

DESIGN / PHASE Prospective, single center, randomized, parallel group, double-blind,

adjuvant controlled, phase I study. STUDY PLANNED DURATION First patient

First visit 1Q

2014 Last patient First visit

1Q 2014

Last patient Last visit

3Q 2014

CENTER(S) / COUNTRY(IES)

One Austria

PATIENTS / GROUPS Dose escalations study comprising the treatment and control groups below:

Treatment : rTSST-1 Variant Candidate Vaccine

Control : Al(OH)3 Adjuvant

Group Strength No. of

Subjects Strength No. of

Subjects 1 100 ng 2 0.2 mg 1 2 300 ng 2 0.6 mg 1 3 1µg 3 1 .0 mg 1 4 3µg 9 1.0 mg 3 5 10 µg 9 1.0 mg 3 6 30 µg 9 1.0 mg 3

In the absence of adverse events classified as clinically relevant, interval between dose escalations 1 week. Immunization to be repeated at the same dose level 1 - 2 months later. If immunogenicity can be shown after the second administration of 1 µg, the sample size will be increased from 3 + 1 to 9 + 3. Otherwise, the sample size of 3 + 1 will continue until immunogenicity is seen at a higher dose level. If there is no immune response in any dose group after the second immunization, a third injection will be given 4 -8 weeks thereafter in dose groups of 1 µg and above. Immunogenicity is defined by seroconversion from a TSST-1 Ab titer of < 20 to > 40 or a 4-fold increase in TSST-1 Ab titer . Patients 3 µg or more will be randomized.

SCREENING In the period from -28 to - 3 days prior to first vaccination, subjects will be screened for eligibility using the criteria below, plus HIV Ab, HCV Ab, HBs Ag, and TSST-1 Ab..

INCLUSION CRITERIA • male and female • 18 - 64 years • written informed consent

27

• physical exam: no abnormal findings unless considered irrelevant by the investigator

• uneventful medical history • females: adequate contraception

EXCLUSION CRITERIA • pregnancy • positive virology markers • signs and symptoms of relevant autoimmunity • TSST-1 Ab titer > 1:2000

STUDY PERIODS • Screening: 1 month • Immunization: 1-4 months • Follow-up: 2 - 3 weeks • Total: 3 - 6 months

INVESTIGATIONAL DRUG rTSST-1 variant vaccine initial dose: 100 ng target dose: 30 µg

COMPARATIVE DRUG /CONTROL CONDITION

Al(0H)3

CONCOMITANT MEDICATION

No concomitant medication allowed that would interfere with the assessment of trial specific results as assessed by the investigator.

TOLERABILITY / SAFETY (PRIMARY) ENDPOINTS

Adverse events Abnormal laboratory findings

EFFICACY ENDPOINT TSST-1 Ab response (to be monitored and described) EXPLORATORY OBJECTIVE Selected cytokines PARAMETERS Vital Signs: BP, PR, body temperature

Hematology: RBC WBC Leukocyte differential count (absolute

values of neutrophils, basophils, eosinophils, monocytes, and lymphocytes) platelet count hemoglobin hematocrit

Clinical Chemistry: ALT BUN Creatinine C-Reactive Protein Cytokines TSST-1 Ab Local Reactions Tests to be performed at time 0, and 6 h, 48 +2 h, 7 + 1d, 14 + 2 d after each immunization. In the case of abnormal findings, the respective tests will be repeated in between.

Primary Endpoint: Descriptive Other Endpoints: Antibody and cytokine determinations will be monitored and

28

described. Where appropriate, antibody titers will be analyzed by one-way or repeated measures ANOVA . Mann-Whitney-U test will be used post hoc to determine statistical significance. Chi square test to determine a statistical difference, if any, in the rate of seroconsion and/or Ab response between treatment and control groups. Data from the controls will be pooled.

3. LIST OF ABBREVATIONS Ab antibody Ag antigen AE adverse event AGES Österreichische Agentur für Gesundheit und Ernährungssicherheit GmbH AMG Arzneimittelgesetz ALT alanine aminotransferase BASG Bundesamt für Sicherheit im Gesundheitswesen

BP blood pressure BUN blood urea nitrogen b.w. body weight C centigrade, Celsius CA competent authority CBC complete blood count CRF case report form CSR clinical study report DOH Declaration of Helsinki d day EC Ethics Committee ECG electrocardiogram ELISA enzyme-linked immunosorbent assay EOS End of Study EudraCT European Clinical Trial Database GCP Good Clinical Practice h hour (s) HBsAg hepatitis B virus surface antigen HCV hepatitis C virus HIV human immune deficiency virus IB Investigator's Brochure IEC Institutional Ethics Committee ICH International Conference on Harmonization ID identification IgG immunoglobulin G i.m. intramuscular(ly) IMP Investigational Medicinal Product

29

IRB Institutional Review Board kg kilogram LLT lower level term n.a. not applicable ng nanogram µg microgram mg milligram MedRA Medical Dictionary for Regulatory Activities MHC major histocompatibility complex min minute (s) ml milliliter MNC mononuclear cells n.a. not applicable neg negative PBS phosphate buffered saline PI principal investigator PR pulse rate RBC red blood count RT room temperature rTSST-1 recombinant TSST-1 SAE serious adverse event S.aureus Staphylococcus aureus SmPC Summary of Product Characteristics SOP Standard Operating Procedure SUSAR suspected unexpected serious reaction TCR T cell receptor TSS toxic shock syndrome TSST-1 toxic shock syndrome toxin –1 Vβ chain Variable beta chain WBC white blood count WMA World Medical Association

30

4. TABLE OF CONTENTS

CLINICAL STUDY PROTOCOL 22

1. SPONSOR, INVESTIGATOR, MONITOR AND SIGNATURES 24

2. PROTOCOL SYNOPSIS 26

3. LIST OF ABBREVATIONS 28

4. TABLE OF CONTENTS 30

TABLE 1. DOSE ESCALATION AND SAMPLE SIZES 33

TABLE 2. VISIT AND ASSESSMENT SCHEDULE FOR ANY OF THE FOUR DOSE GROUPS 34

5. BACKGROUND INFORMATION 35

5.1 BACKGROUND 35 5.2 STUDY RATIONALE 38

6. STUDY OBJECTIVES (HYPOTHESIS) 38

6.1 PRIMARY OBJECTIVE 38 6.2 SECONDARY OBJECTIVES (HYPOTHESIS) 38

7. STUDY DESIGN 39

7.1 STUDY POPULATION 40 7.1.1 STUDY POPULATION 40 7.1.2 INCLUSION CRITERIA 40 7.1.3 EXCLUSION CRITERIA 40 7.1.4 FEMALES OF CHILDBEARING AGE 40 7.1.5 STUDY DURATION 40 7.1.6 WITHDRAWAL AND REPLACEMENT OF SUBJECTS 40 7.1.7 PREMATURE TERMINATION OF THE STUDY 41

8. METHODOLOGY 42

8.1 STUDY MEDICATION 42

31

8.1.1 DOSAGE AND ADMINISTRATION 43 8.1.2 STUDY-DRUG UP- AND DOWN TITRATION 44 8.1.3 STUDY DRUG INTERRUPTION OR DISCONTINUATION 44 8.1.4 STUDY DRUG INTERRUPTION 45 8.1.5 STUDY DRUG PREMATURE PERMANENT DISCONTINUATION 45 8.1.6 STUDY-DRUG DELIVERY & DRUG STORAGE CONDITIONS 45 8.1.7 STUDY DRUG PACKAGING AND LABELING 45 8.1.8 IMP ADMINISTRATION & HANDLING 46 8.1.9 DRUG ACCOUNTABILITY 46 8.1.10 PROCEDURES TO ASSESS SUBJECTS COMPLIANCE 46 8.1.11 CONCOMITANT MEDICATION 46 8.2 RANDOMIZATION AND STRATIFICATION 46 8.3 BLINDING 46 8.3.1 EMERGENCY PROCEDURE FOR UNBLINDING 46 8.3.2 UNBLINDING AT THE END OF THE STUDY. 47 8.4 BENEFIT AND RISK ASSESSMENT 47 8.5 STUDY PROCEDURES 47 8.5.1 GENERAL RULES FOR TRIAL PROCEDURES 47 8.5.2 SCREENING INVESTIGATION 47 8.5.3 LABORATORY TESTS 48 8.5.4 OTHER TESTS 49 8.5.5 ENDPOINTS 49

9. SAFETY DEFINITIONS AND REPORTING REQUIREMENTS 49

9.1 AVERSE EVENTS (AES) 49 9.1.1 SUMMARY OF KNOWN AND POTENTIAL RISKS OF THE STUDY DRUG 49 9.1.2 DEFINITION OF ADVERSE EVENTS 50 9.2 SERIOUS ADVERSE EVENTS (SAES) 50 9.2.1 HOSPITALIZATION – PROLONGATION OF EXISTING HOSPITALIZATION 50 9.2.2 SAES RELATED TO STUDY-MANDATED PROCEDURES 50 9.2.3 SUSPECTED UNEXPECTED SERIOUS ADVERSE REACTIONS (SUSARS) 51 9.2.4 PREGNANCY 51 9.3 SEVERITY OF ADVERSE EVENTS 51 9.4 RELATIONSHIP TO STUDY DRUG 52 9.5 REPORTING PROCEDURES 52 9.5.1 REPORTING PROCEDURES FOR SAES 53 9.5.2 REPORTING PROCEDURES FOR SUSARS 54 9.5.3 ANNUAL SAFETY REPORT 54

10. FOLLOW-UP 55

10.1 FOLLOW-UP OF STUDY PARTICIPANTS INCLUDING FOLLOW-UP OF ADVERSE EVENTS 55 10.2 TREATMENT AFTER END OF STUDY 55

32

11. STATISTICAL METHODOLOGY AND ANALYSIS 55

11.1 ANALYSIS SETS 55 11.2 SAMPLE SIZE CONSIDERATIONS 55 11.3 RELEVANT PROTOCOL DEVIATIONS 55 11.4 STATISTICAL ANALYSIS PLAN 55 11.5 MISSING, UNUSED AND SPURIOUS DATA 56 11.6 ENDPOINTS ANALYSIS 56 11.6.1 PRIMARY ENDPOINT ANALYSIS 56 11.6.2 SECONDARY ENDPOINT ANALYSIS 56 11.6.3 EXPLORATORY OBJECTIVE 56 11.6.4 BASELINE PARAMETERS AND CONCOMITANT MEDICATIONS 56 11.7 INTERIM ANALYSIS 56 11.8 SOFTWARE PROGRAM(S) 57

12. DOCUMENTATION AND DATA MANAGEMENT 57

12.1 STUDY DOCUMENTS AND CASE REPORT FORMS 57 12.1.1 CASE REPORT FORM (CRF) 57 12.2 DIRECT ACCESS TO SOURCE DATA/DOCUMENTS 57 12.3 RETENTION OF CLINICAL TRIAL DOCUMENTATION 58 12.4 QUALITY CONTROL AND QUALITY ASSURANCE 58 12.4.1 PERIODIC MONITORING 58 12.4.2 UNBLINDED MONITORING AND IMP HANDLING 58 12.4.3 AUDIT AND INSPECTIONS 59 12.5 REPORTING AND PUBLICATION 59 12.5.1 PUBLICATION OF STUDY RESULTS 59

13. ETHICAL AND LEGAL ASPECTS 60

13.1 INFORMED CONSENT OF SUBJECTS 60 13.2 ACKNOWLEDGEMENT / APPROVAL OF THE STUDY 60 13.2.1 CHANGES IN THE CONDUCT OF THE STUDY 60 13.3 INSURANCE 61 13.4 CONFIDENTIALITY 61 13.5 ETHICS AND GOOD CLINICAL PRACTICE (GCP) 61

14. REFERENCES 62

15. APPENDICES 64

33

TABLE 1. DOSE ESCALATION AND SAMPLE SIZES

GROUPS: TREATMENT : CONTROL : DOSES

Adjuvanted rTSST-1 Variant Vaccine containing antigen below

VOLUME SAMPLE SIZES1

Subjects Adjuvant containing Al(0H)3

as shown below

VOLUME SAMPLE SIZES Subjects

1 100 ng 0.1 ml 2 0.2 mg 0.1 ml 1 2 300 ng 0.3 ml 2 0.6 mg 0.3 ml 1 3 1 µg2 0.5 ml 3 1.0 mg 0.5 ml 1 4 3 µg 0.5 ml 9 1.0 mg 0.5 ml 3 5 10 µg 0.5 ml 9 1.0 mg 0.5 ml 3 6 30µg 0.5 ml 9 1.0 mg 0.5 ml 3

1 In the absence of adverse events classified as clinicaly relevant, doses to be escalated at 1- week intervals. 2 If immunogenicity can be shown after the second administration of 1 µg, the sample size will be increased from 3 + 1 to 9 + 3. Otherwise, the sample size of 3 + 1 will continue until immunogenicity is seen at a higher dose level.

34

TABLE 2. VISIT AND ASSESSMENT SCHEDULE FOR ANY OF THE FOUR DOSE GROUPS PERIODS Name SCREENIN

G TREATMENT FOLLOW-UP AFTER EACH IMMUNIZATION

Duration 25 days 4 - 16 weeks 14 days VISITS Number 0 1 1-1 2-1 3-1 1-2

2-2 3-2

1-3 2-3 3-3

1-4 2-4 3-4

1-5 2-5 3-5

Name Screening Randomization Immunization 1

Immunization 2

Immunization

34

Follow-up 1

Follow-up 2

Follow-up 3

Follow-up 4

Time -28 to - 3 days

Day 0 Day 0 Weeks 4 -84 Weeks 8-124 6 h

48 h + 2 h

7 days + 1 day

14 days + 2 days

Informed Consent X Inclusion Exclusion Criteria X Medical History X Concomitant Medication X X X X x x x x Physical Examination X Body Weight and Height X Vital Signs (BP, PR, temperature) X X X X x x x x Hematology X X Clinical Chemistry X X X X x x x x C-reactive Protein X X X X x x x x Cytokines X X X X x x x x TSST-1 Ab X X X X x x x x Local Reactions/Adverse Events X X X X X X x Randomization X3 HIV Ab, HCVAb, HBsAg X Pregnancy Test X X X X 3 Subjects to receive 3 µg or more (Groups 4 - 6) will be randomized 4 If there is no immune response in any dose group after the second immunization, a third injection will be given 4 - 8 weeks thereafter in dose groups of 1 µg and above.

35

5. BACKGROUND INFORMATION

5.1 Background The incidence of community or hospital acquired infections is about 500 000 in each, Europe and the U.S.A. Some 20 % of the patients with such infections require intensive care either immediately or after some time. Of the patients in intensive care, about 50% - 70% can be saved, however, many of them suffer from late sequelae, persisting for years. About 10% to 20% of the hospital or community acquired infections are caused by S.aureus. Most strains of S. aureus produce toxins, such as superantigens, including the Toxic Shock Syndrome Toxin-1 (TSST-1). These toxins cause significant illnesses, including pneumonia, acute kidney injury, infective endocarditis, and toxic shock syndrome (TSS) (Salgado-Pabon 2013). TSST-1 alone or in combination with other S.aureus virulence factors (such as SEA, SEB, and SEC) leads to toxic shock sydrome (TSS). TSST-1 belongs to the pyrogenic toxin class of superantigens and plays a pivotal role as a causative agent in TSS and septic shock (Dinges et al.2000; McCormick et al.2001). Superantigens are produced by both methicillin-resistant and sensitive S.aureus strains (Hu et al 2008). It has been estimated that TSST-1 is involved in 50 % of nonmenstrual-associated TSS cases due to S. aureus and essentially all cases of menstrual-associated TSS (Dinges et al.2000). Experimental application of superantigens leads to an overwhelming inflammatory response (Hopkins et al.2005; Krakauer 2003; Dauwalder et al.2006) with uncontrolled release of inflammatory cytokines resulting in shock and multi organ failure (Miethke et al.1993; Faulkner et al.2005; Krakauer et al.2010; Dinges et al.2001; Stich et al.2010). Treatment of infections with antibiotics has become increasingly difficult due to the widespread occurrence of antibiotic-resistant S. aureus strains (Chambers 1997; McCormick et al. 2001; Foster et al.2005; Zetola et al., 2005). The prevalence of multiresistant organisms such as Methicillin-resistant S. aureus is strongly increasing (Zetola et al. 2005). This being the case, it is generally agreed upon that it is desirable to develop a vaccine and specific immunoglobulin for active and passive immunization which could be used also in combination with antibiotics to save a greater number of patients and/or shorten the persistence of severe sequelae shortening patients´ lives. Therapies have included the application of intravenous immunoglobulin (IVIG) which have been useful also in clinical trials (Kaul et al. 1998). Numerous efforts have been undertaken to develop a specific therapy (Krakauer 2013). In a rabbit model, animals were immunized with atoxicTSST-1 mutants three times. Immunization protected them when challenged one week after the last immunization with otherwise lethal doses of native TSST-1 in miniosmotic pumps (Spaulding et al., 2012). In another model, 83% of mice that were vaccinated three times with mutant TSST-1 survived when challenged with viable S. aureus (Hu et al., 2003). Other experiments in mice showed that immunizations three times with mutants of the superantigens SEA, SEB, SEC1, or TSST-1 led to protection of the mice upon subsequent challenge with native superantigens plus endotoxin (Bavari et al, 1999). The BioMed r-TSST-1 Variant and Vaccine: Based on information on the structure and functional relationship of S. aureus TSST-1, mutants have been established with the objective of eradicating the toxic and superantigenic properties,

36

while leaving specific immunogenicity and protectivity unimpaired (Roggiani et al.2000; Ulrich et al 1998; Gampfer et al.2002). After molecular characterization and thorough biological and immunological testing, a TSST-1 double mutant (G31R-H135A) has been chosen for the rTSST-1 Variant Vaccine (Gampfer et al.2002). Amino acid changes in position 31 have been shown to result in impaired interaction with MHC class II molecules (Kum et al.1996), whereas mutation of histidine 135 to alanine negatively affects the binding of TSST-1 to the T cell receptor (McCormick et al.2003). The double mutant has been expressed in E. coli BL21, purified by chromatography and formulated with Al(OH)3 as a vaccine, this being referred to as the BioMed rTSST-1 Variant Vaccine. Proof of concept: A non-clinical, prospective, controlled, randomized open Immunogenicity and Protection Study (Study Bio&Bio 031114) was conducted in conformity with GLP to evaluate the immogenicity and protection of the BioMed rTSST-1 Variant Vaccine in a rabbit model. TSST-1 antibody negative rabbits were randomized and immmunized with the test or the reference item four times at three-week intervals. Blood samples were drawn prior to entry (baseline), one day prior to the second, third, and fourth immunizations, and three weeks after the fourth immunization to determine TSST-1 antibody levels. Thereafter, animals in both groups were challenged with TSST-1 and four hours later with lipopolysaccharide (LPS) and observed for survival for five days. Results: 20 female rabbits weighing 1,672 g on average with TSST-1 antibody titers of < 20 were randomly assigned to Group 1 (adjuvanted vaccine) or Group 2 (adjuvant alone). TSST-1 antibody titers in the immunized group rose to a GM of 624 as early as three weeks after the 2nd immunization and reached a GM of 22,328 and 37,217 three weeks after the third and fourth, respectively. In Group 2, TSST-1 antibody titers remained < 20 throughout. All animals in Group 1 seroconverted (i.e. had > 4-fold increases in TSST-1 antibody titer with respect to baseline) after the third immunization. None did so in Group 2 (p < 0.001). All animals in Group 1 survived the challenge with TSST-1 and LPS, while all animals in Group 2 succumbed (p < 0.001). No evidence of superantigenicity: Non-clinical experiments in vivo have shown that rTSST-1 variant lacks super-antigen activity and does not lead to T-cell activation or induce an increase in IL-2 gene activation in the spleen of rabbits. Lack of super-antigen activity has also been demonstrated in mice. IL-2 concentrations remain at background level after injection of rTSST-1 variant. Non-clinical experiments in vitro have shown r-TSST-1 variant not to induce IL-2 gene activation up to concentrations of 1000 ng/ml in human mononuclear cells proving rTSST-1 variant to be detoxified. Lack of activation and release of inflammatory cytokines could be proven. rTSST-1 variant lost its super-antigen property by the detoxifying mutations. rTSST-1 variant does not induce T-cell proliferation of human mononuclear cells as estimated by H3thymidin incorporation in concentrations up to 01 to 1µg. It lacks the characteristics of a super-antigen and behaves as a normal antigen. No evidence of toxicity: rTSST-1 variant was tested in rabbits in doses up to 1 mg per rabbit , and doses this high were well tolerated

37

in vivo experiments in rabbits have shown that the rTSST-1 Variant Vaccine antigen does not induce fever, leukopenia or lympohopenia . Studies performed in mice and rabbits have demonstrated that super-antigen activity and toxicity with respect to activation and release of the inflammatory cytokines TNFα , INF-γ, and IL6 have been eliminated due to the mutations in rTSST-1 variant. Suprantigen toxins are known to increase the lethal effect of endotoxin (LPS) up to over 1000-fold. rTSST-1 variant has been extensively tested in rabbits and mice and did not increase LPS lethality. A prospective, controlled, randomized, open repeated dose toxicity and local tolerance study of the BioMed rTSST-1 Variant Vaccine (Study Bio & Bio 101115) was conducted in conformity with GLP to evaluate the toxicity and local tolerance of the Biomed rTSST-1 Variant Vaccine after repeated applications in a rabbit model. Ten male and ten female rabbits were randomly assigned to one of two groups: Group 1 received 1 ml 30 µg of rTSST-1 Variant Vaccine, Group 2 was given 1 ml of adjuvant (Al(OH)3) four times at intervals of three weeks. Blood was drawn prior to the first immunization and at specified time points during the study for hematology, coagulation, clinical chemistry, electrolytes, C-reactive protein, antibody against antigenic substances that can cross react with human tissue, and immune complexes. TSST-1 antibody was determined prior to the fourth immunization. Vital signs, body weight, and intake of food and water was monitored. Clinical and physical observations were made on scheduled days. General health was assessed daily. Local tolerance was determined by visual inspection before and at several time points after each vaccination for indications of reactogenicity. Moribundity/mortality, clinical and physical observations and general health were monitored throughout the treatment and observation periods. Two to three days after the last immunization, the animals were euthanized. Opthalmoscopy was performed prior to sacrifice. Post mortem examinations included gross pathology and histopathology of a number of organs, including the injection site tissue.

Results and Conclusion: This repeated dose toxicity study investigated a number of parameters including hematology, clinical chemistry, coagulation, induction of autoantibodies, CRP, local tolerance, vital signs, ophthamology, gross pathology, and histopathology. There were a few differences between groups, most of them small and gender specific and within the variability of the normal range. These variations are considered as clinically irrelevant. The study reveals that rTSST-1 Variant Vaccine does not have any toxicity at the human dose in this animal model after four immunizations.

in vitro experiments have shown that rTSST-1 variant does not induce the release of TNFα , INF-γ, and IL6 incultures of human mononuclear cells. Summarizing, the safety of rTSST-1 variant has been shown in numerous state-of-the art experiments and non-clinical studies. Innocuity with respect to increasing LPS activity has also been demonstated up to dose levels of 10 times the intended dose to be used in humans. With these results, the rTSST-1 Variant Vaccine is proposed to be tested in clinical trials to define, study, and demonstrate its safety and immunogenicity in healthy individuals. Residual risk Despite the favorable results obtained in the non-clinical experiments and studies, there remains a potential risk based on the following deliberation:

38

The animals included in the non-clinical studies were animals naive to the TSST-1 Ag, i.e. they had not had contact with staphylococci previously. They developed antibodies of different levels against this Ag. Although in the repeated dose toxicity study this has been taken into account and there was no indication of an increased toxicity in the animals which had pre-existing antibodies (in the course of immunization) and no toxicity whatsoever could be observed, the situation is different in humans who will have had contact with the antigen at different times at different levels. This means that the first injection in humans might induce a booster response. Even though no signs or symptoms of toxicity were observed after booster immunization in the rabbit, an extremely low dose of < 1/100 of the planned human dose will be used to begin with. Study subjects will be monitored thoroughly for adverse events and doses will be escalated in the absence of adverse events considered clinically relevant by the investigator (such as temperature > 39°C, hives, vomiting, signs of anaphylactoid reactions, drop in WBC or increase in creatinine by 50%). Caution should be used when the vaccine is given for the first time and attention be paid to even minimal symptoms. Respective warnings are contained in the Investigator's Brochure and the Informed Consent. As the response to vaccination might depend on the subject's prior contact with the antigen, differences among subjects are to be expected. This will also have to be taken into consideration when increasing the dose and in the assessment of the antibody response in the course of the study. In the opinion of the Sponsor and the Investigator, all experiments and non-clinical studies have been performed that are scientifically feasible and recommended by relevant regulatory guidelines to demonstrate the innocuity of the r-TSST-1 Variant Vaccine and minimize a residual risk for the subject.

5.2 Study Rationale The BioMed rTSST-1 Variant Vaccine has been developed by Biomedizinische Forschungsgesellschaft m.b.H. as one component of a polyvalent staphylococcal vaccine for the prevention of toxic shock and hyperimmunization of donors for the production of TSST-1 immunoglobulin.

6. STUDY OBJECTIVES (HYPOTHESIS)

6.1 Primary Objective Primary objective of the study is to demonstrate the safety and tolerability of the BioMed rTSST-1 Variant Vaccine in healthy adults.

6.2 Secondary Objectives (Hypothesis) Secondary objective of the study is to monitor and assess the immunogenicity of the BioMed rTSST-1 Variant Vaccine in healthy adults.

39

The hypothesis is that subjects in the treatment groups will seroconvert from an TSST-1 Ab titer of < 20 to > 40 or have a four-fold increase in TSST-1 Ab titer after one to three immunizations with the BioMed rTSST-1 Variant Vaccine, whereas subjects in the control groups will not.

7. STUDY DESIGN This is a prospective, partly randomized, parallel control, dose escalation study of the safety and immunogenicity of the BioMed rTSST1 Variant Vaccine compared to adjuvant in healthy adults. 28 - 3 days prior to entry into the study, 50 male and female subjects 18 - 64 years in age will be screened for eligibility , screening criteria to include physical examination, medical history, pregnancy/ adequate contraception in females, HIV Ab, HCV Ab, HBs Ag and TSST-1 Ab. 46 of these subjects will be entered into the study. In a first step, two subjects will receive the adjuvanted Vaccine containing 100 ng rTSST-1 Ag and one subject will receive the adjuvant containing 0.2 mg Al(0H)3 only (Group 1). The subjects will be seen four times after immunization in a period of 14 days (6 h, 48 h + 2 hrs, 7 + 1 days and 14 + 2 days).Tests and examinations will include vital signs, hematology and clinical chemistry parameters, C-reactive protein, cytokines, TSST-Ab , local reactions and adverse events. In the absence of clinically relevant adverse events , another three subjects will be entered into the study one week later, two of them to receive the adjuvanted Vaccine containing 300 ng rTSST-1 Ag, one receiving the adjuvant containing 0.6 mg Al(0H)3 (Group 2) and be followed for a period of 14 days as described above. In the absence of clinically relevant adverse events , four more subjects will be entered into the study one week thereafter, three of them to receive the adjuvanted Vaccine containing 1 µg rTSST-1 Ag , one to receive adjuvant containing 1 mg Al(0H)3 alone (Group 3), and be followed for a period of 14 days in the manner described above. Immunization will be repeated at the same dose level in each group one to two months after the first. Follow-up will be the same. If immunogenicity can be shown after the second administration of the Vaccine containing 1 µg of rTSST-1 Ag, doses and sample sizes will be increased to Vaccine containing 3 µg , 10 µg, and 30 µg and adjuvant cotaining 1 mg Al(0H)3 in nine and three subjects in Groups 4 - 6, respectively. Otherwise, the sample size of 3 + 1 will continue until immunogenicity is seen at a higher dose level. Subjects in Groups 4 – 6 will receive a second immunization at the respective dose level one to two months after the first, follow-up being the same as in Groups 1 – 3. If there is no immune response in any dose group after the second immunization, a third injection will be given 4 - 8 weeks thereafter in dose groups of 1 µg (Groups 3 - 6) and above.

40

Immunogenicity is defined by seroconversion from a TSST-1 Ab titer of < 20 to > 40 or a 4-fold increase in TSST-1 Ab titer. Subjects to receive vaccine containing 3 µg rTSST-1 Ag or more will be randomized. See Table 1.

7.1 Study population

7.1.1 Study population healthy male or female subjects

7.1.2 Inclusion criteria male or female 18 - 64 years written informed consent physical exam: no abnormal findings unless considered irrelevant by the investigator uneventful medical history females: adequate contraception

7.1.3 Exclusion criteria females: pregnancy positive HIV Ab positive HCV Ab positive HBsAg signs and symptoms of autoimmunity TSST-1 Ab > 2000

7.1.4 Females of childbearing age Females of childbearing age will be required to perform pregnancy tests at screening and prior to each immunization.

7.1.5 Study duration Each participant will be in the study for 11 to 23 weeks.

7.1.6 Withdrawal and replacement of subjects

41

Criteria for withdrawal Subjects may prematurely discontinue from the study at any time. Premature discontinuation from the study is to be understood when the subject did not undergo End of Study (EOS) examination and / or all pivotal assessments during the study. Subjects must be withdrawn under the following circumstances:

• at their own request • if the investigator feels it would not be in the best interest of the subject to continue • if the subject violates conditions laid out in the consent form / information sheet or

disregards instructions by the study personal • if a female subject becomes pregnant • if laboratory tests turn abnormal • in the case of adverse reactions

In all cases, the reason why subjects are withdrawn will be recorded in detail in the CRF and in the subject’s medical records. Should the study be discontinued prematurely, all study materials (complete, partially completed and empty CRFs) will be retained. Follow-up of patients withdrawn from the study In case of premature discontinuation of the study, the investigations scheduled for the EOS visit will be performed at least one week after the last immunization. The subjects will be advised that participation in these investigations is voluntary. Furthermore, they may request that from the time point of withdrawal no more data will be recorded and that all biological samples collected in the course of the study will be destroyed. Replacement policy Drop outs may be replaced by a subject next in line for recruitment. The replacement subject will be allocated to the same group the drop-out was in. All available data on the drop-out will be evaluated.

7.1.7 Premature termination of the study The sponsor has the right to close this study at any time. The IEC and the competent regulatory authority must be informed within 15 days of early termination. The trial or single dose steps will be terminated prematurely in the following cases:

• If adverse events occur which are so severe that the benefit-risk ratio is not acceptable. • If the number of dropouts is so high that proper completion of the trial cannot realistically be

expected.

42

8. METHODOLOGY

8.1 Study medication Test preparation Active agent and characteristics: TSST-1 is a staphylococcus toxin with the characteristics of superantigens. Toxicity of TSST-1 is brought about by cross-linking of MHC class II molecules on the antigen presenting cell with the Vβ chain and the T-cell receptor on the T-cell. This way, 5 to 30% of the entire T-cell population may be activated. The Toxin was cloned from S. aureus and is genetically modified to lose its toxic properties. Specific amino acids that determine the binding sites for the MHC and the T-cell receptor have been changed so that TSST-1 cannot bind to either receptor, and the toxic characteristics are lost. Mutagenesis of the TCR binding site is performed by exchange of histidine 135 to alanine. The MHC class II binding site is mutated by exchanging amino acid 31 from glycine to arginine. While the application of TSST-1 is followed by fever, leukopenia and lymphopenia in rabbits, and an increase of inflammatory cytokines in human mononuclear cells as well as in the serum of mice, these toxic charactristics are lost in the rTSST-1 variant vaccine antigen. The recombinant detoxified toxin is used as the vaccine antigen. Trade name of the agent: BioMed rTSST-1 Variant Vaccine Manufacturer: Bio-Products & Bio-Engineering AG Lazarettgasse 19 A 1090 Vienna Austria Drug supply: The final pharmaceutical product is presented in 2.0 ml single dose vials containing the following ascending quantities of rTSST-1 variant and 1.0 mg Al(OH)3 in 0.5 ml PBS with 0.02 % polysorbate 80 (with overfill) : Group 1 0.5 µg rTSST-1 variant Group 2 0.5 µg rTSST-1 variant Group 3 1.0 µg rTSST-1 variant

Group 4 3.0 µg rTSST-1 variant

43

Group 5 10.0 µg rTSST-1 variant Group 6 30.0 µg rTSST-1 variant

Dosage Form: Suspension for i.m. injection. Storage Instructions: 2 - 8ˆC protected from light Route of administration: i.m. Reference preparation: Aluminum hydroxide suspension in phosphate buffered saline (vaccine adjuvant). Trade name: BioMed Aluminumhydroxide Suspension 1 mg Manufacturer: : Bio-Products & Bio-Engineering AG Lazarettgasse 19 A 1090 Vienna Austria Drug supply: The reference preparation is presented in 2.0 ml single dose vials containing 1.0 mg Al(OH)3 in 0.5 ml PBS and 0.02 % and polysorbate 80 (with overfill) . Dosage form: Suspension for i.m. injection Storage conditions: 2 - 8° C Route of administration: i.m.

8.1.1 Dosage and administration Test preparation (Treatment Groups) Initial dose: Group 1: rTSST-1 Variant Vaccine containing 100 ng rTSST-1 Escalating doses: Groups 2 - 6: rTSST-1 Variant Vaccine containing 300 ng, 1 µg, 3 µg, 10 µg, 30 µg rTSST-1 . See below Preparation of doses for administration: Group 1: draw 0.1 ml from a vial containing Vaccine with 0.5 µg rTSST-1 Variant into a disposable syringe

44

Group 2: draw 0.3 ml from a vial containing Vaccine with 0.5 µg rTSST-1 Variant into a disposable syringe Group 3: draw 0.5 ml from a vial containing Vaccine with 1.0 µg rTSST-1 Variant into a disposable syringe Group 4: draw 0.5 ml from a vial containing Vaccine with 3.0 µg rTSST-1 Variant into a disposable syringe Group 5: draw 0.5 ml from a vial containing Vaccine with 10.0 µg rTSST-1 Variant into a disposable syringe Group 6: draw 0.5 ml from a vial containing Vaccine with 30.0 µg rTSST-1 Variant into a disposable syringe Route of administration: i.m. Duration: 2 - 3 times, 4 - 8 weeks apart See Tables 1 and 2. Reference Preparation (Control Groups) Initial dose: Group 1: Adjuvant containing 0.2 mg Al(0H)3

Escalating doses: Group 2 : Adjuvant containing 0.6 mg Al(0H)3

Groups 3 - 6: Adjuvant containing 1 mg Al(0H)3

Preparation for administration: Group 1: draw 0.1 ml from a vial containing Adjuvant into a disposable syringe Group 2: draw 0.3 ml from a vial containing Adjuvant into a disposable syringe Group 3: draw 0.5 ml from a vial containing Adjuvant into a disposable syringe Group 4: draw 0.5 ml from a vial containing Adjuvant into a disposable syringe Group 5: draw 0.5 ml from a vial containing Adjuvant into a disposable syringe Group 6: draw 0.5 ml from a vial containing Adjuvant into a disposable syringe Route of administration: i.m. Duration: 2 - 3 times, 4 - 8 weeks apart See Tables 1 and 2.

8.1.2 Study-drug up- and down titration In the absence of adverse events, doses to be escalated at 1 week intervals. If immunogenicity can be shown after the second administration of Vaccine containing 1 µg rTSST-1, the sample size will be increased from 3 + 1 to 9 + 3. Otherwise, the sample size of 3 + 1 will continue until immunogenicity is seen at a higher dose level. See Table 1.

8.1.3 Study drug interruption or discontinuation

45

The investigator must temporarily interrupt or permanently discontinue the study drug if continued administration of the study drug is believed to be contrary to the best interests of the patient. The interruption or premature discontinuation of study drug might be triggered by an AE, a diagnostic or therapeutic procedure, an abnormal assessment (e.g., laboratory abnormalities), or for administrative reasons, in particular withdrawal of the patient’s consent. The reason for study drug interruption or premature permanent discontinuation must be documented in the CRF.

8.1.4 Study drug interruption See 8.1.3. above.

8.1.5 Study drug premature permanent discontinuation See 8.1.3. above Study drug premature permanent discontinuation due to an adverse event If the reason for premature permanent discontinuation of study treatment is an AE, the patient will have a “Premature End of Study (EOS)” visit with all the assessments performed before the study drug discontinuation, whenever possible. Study drug premature permanent discontinuation due to another reason than adverse event The investigator may discontinue a subject if he feels it is in his best interest. If the reason for premature permanent discontinuation of study treatment is not an AE, the patient will be withdrawn from the study (withdrawal of consent) and have the end of study (EOS) visit with all the assessments performed before the study drug discontinuation, whenever possible.

8.1.6 Study-drug delivery & drug storage conditions Test and reference preparations will be delivered in 2 ml vials containing 05. ml of Vaccine or adjuvant. Store at 2 - 8° C.

8.1.7 Study drug packaging and labeling Study drug and reference preparations will be delivered to the study pharmacist labeled as shown below: Inner label: See Appendix 1.

46

See Outer label: See Appendix 1.

8.1.8 IMP administration & handling Bring to RT before injection. Invert before use. Draw up 0.1 ml, 0.3 ml, or 0.5 ml into 1ml graduated syringe depending on group assignment. See Section 8.1.1.

8.1.9 Drug Accountability Drug accountability will be recorded on an ongoing basis in paper form.

8.1.10 Procedures to assess subjects compliance A diary will be used for the subject to record any adverse events between visits to the clinic.

8.1.11 Concomitant medication No concomitant medication will be allowed that would interfere with the assessment of trial specific results as assessed by the investigator.

8.2 Randomization and stratification Subjects to receive vaccine containing 3 µg rTSST-1 Ag or more (Groups 4 - 6) will be randomized to receive either the rTSST-1 variant candidate vaccine or Al(OH)3 control. Envelopes will be prepared with consecutive subject numbers containing the group allocation.

8.3 Blinding Study drug and reference preparations will be delivered to the study pharmacist open label. Since the study is to be conducted in a double blinded manner, they will be prepared by a pharmacist or other member of the study team not otherwise involved in the trial and be delivered in ready-to use syinges to the investigator blinded.

8.3.1 Emergency procedure for unblinding In the case of serious adverse events, the investigator will have access to the individual code.

47

Sealed envelopes containing true treatment assigned will be stored in the investigator’s study file. The premature breaking of the code should be confined to emergency cases in which knowledge of the administered drug is necessary for adequate treatment. Breaking of the code must be recorded in the subject file, the CRF and on the envelope (date and reason). The CRA and the sponsor will be notified of each unblinding event by PI.. Should any code be broken by accident, the respective subject will be withdrawn from further participation in the study and a written explanation must be given by the PI. Open and sealed envelopes must be returned to the monitor at the close out visit.

8.3.2 Unblinding at the end of the study. Unblinding will take place after data base lock.

8.4 Benefit and risk assessment At present, immediate benefits cannot be expected for study participants. The aim of the research project is to develop a vaccine against a potentially fatal disease, and the study will help to gain knowledge and contribute toward that end. Extensive studies in vitro and in experimental animals have shown the vaccine to be safe and tolerable. However, there are no data at this point about the safety and tolerability of the investigational product in humans. Risks mayl be related to the administration of the investigational product and are expected to be comparable to the ones associated with the administration of any vaccine, such as local reactions and/or fever and/or severe adverse events that might make immediate medical intervention necessary . For that reason, study subjects will be closely monitored during the study by the investigator and his team.

8.5 Study procedures

8.5.1 General rules for trial procedures

• All study measures like blood sampling and measurements will be documented with date (dd:mm:yyyy).

• In case several study procedures are scheduled at the same time point, there is no specific sequence that should be followed.

• The dates of all procedures will be according to the protocol. The time margins will be + 2 h for the 48 h visit, 1 day for the 7-day visit, and 2 days for the 14-day visit. If for any reason, a study procedure is not performed within scheduled margins, a protocol deviation will be noted, and the procedure will be performed as soon as possible or as adequate.

8.5.2 Screening investigation

48

28 to 3 days prior to entry into the study, subjects will be screened for the parameters shown in Table 2., i.e. Inclusion criteria: male or female 18- 64 years physical exam: no abnormal findings unless considered irrelevant by the investigator uneventful medical history females: adequate contraception Exclusion criteria: females: pregnancy positive HIV Ab positive HCV Ab positive HBsAg TSST-1 Ab ≥ 2000 Medical history Concomitant medication Body weight and height Vital signs (BP, PR, temperature) Hematology (see 8.5.3. below) Clinical chemistry (see 8.5.3. below) C-reactive protein Cytokines TSST-1 Ab HIV Ab HCV Ab HBsAg Pregnancy test Informed consent will be invited.

8.5.3 Laboratory Tests The following laboratory tests will be performed on blood taken at times 0, and 4h, 48 h, 7d, and 14 d after each immunization: Hematology: RBC WBC Leukocyte differential count ( absolute values of neutrophils, basophils, eosinophils, monocytes, and lymphocytes) Platelet count Hemoglobulin Hematocrit

49

Clinical Chemistry: ALT BUN Creatinine C-reactive Protein Cytokines TSSTAb Tests will require 3 ml of EDTA blood and 9 ml of serum or plasma on each occasion. Tests for TSST-1 Ab and cytokines will be performed by Biomedizinische Forschungsgesellschaft m.b.H.

8.5.4 Other Tests At the times indicated under 8.5.3., vital signs (BP, PR and temperature) will be monitored. Local reactions will be monitored at 6 h, 48 h, 7 days and 14 days after each immunization (with the windows described under 8.5.1.) Subjects will be required to keep a diary for adverse events after leaving the clinic.

8.5.5 Endpoints Primary Endpoints: Adverse events Abnormal laboratory findings Local reactions Secondary (Efficacy) Endpoint: TSST-1 Ab response Exploratory Objective: Selected cytokines

9. SAFETY DEFINITIONS AND REPORTING REQUIREMENTS

9.1 Averse events (AEs)

9.1.1 Summary of known and potential risks of the study drug This being a first-in man study of the investigational product, the potential risks in humans are not known. It is expected that they will be comparable with the administration of any vaccine, such as local reactions and fever.

50

Adverse events preventing dose escalation will include temperature > 39 ° C, hives, vomiting, signs of anaphylactoid reaction, drop in WBC, increase in creatinine by 50 %

9.1.2 Definition of adverse events An AE is defined as any untoward medical occurrence in a subject administered vaccine or reference preparation that does not necessarily have a causal relationship with the treatment. An AE can therefore be any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease temporally associated with the administration of the vaccine or adjuvant. An AE includes any event, regardless of the presumed casuality between the event and the preparationa administered.

9.2 Serious Adverse Events (SAEs) A Serious Adverse Event (SAE) is defined by the International Conference on Harmonization (ICH) guidelines and WHO GCP guidelines as any AE fulfilling at least one of the following criteria:

Results in deaths. Life-threatening – defined as an event in which the subject was, in the judgment of the investigator, at risk of death at the time of the event; it does not refer to an event that hypothetically might have caused death had it been more severe. Requiring subject's hospitalization or prolongation of existing hospitalization – inpatient hospitalization refers to any inpatient admission, regardless of length of stay. Resulting in persistent or significant disability or incapacity (i.e., a substantial disruption of a person’s ability to conduct normal life functions). Congenital anomaly or birth defect. Is medically significant or requires intervention to prevent at least one of the outcomes listed above.

Life-threatening refers to an event in which the subject was at risk of death at the time of the event. It does not refer to an event that hypothetically might have caused death if it were more severe. Important medical events that may not immediately result in death, be life-threatening, or require hospitalization may be considered as SAEs when, based upon appropriate medical judgment, they may jeopardize the subject and may require medical or surgical intervention to prevent one of the outcomes listed in the definitions above.

9.2.1 Hospitalization – Prolongation of existing hospitalization Hospitalization is defined as an overnight stay in a hospital unit and/or emergency room. An additional overnight stay defines a prolongation of existing hospitalization. The following reasons for hospitalizations are not considered AEs, and therefore not SAEs:

• Hospitalizations for cosmetic elective surgery, social and/or convenience reasons.

9.2.2 SAEs related to study-mandated procedures

51

Such SAEs are defined as SAEs that appear to have a reasonable possibility of causal relationship (i.e., a relationship cannot be ruled out) to study-mandated procedures (excluding administration of study drug) such as discontinuation of subject's previous treatment during a washout period, or complication of a mandated invasive procedure (e.g., blood sampling), or car accident on the way to the hospital for a study visit, etc.

9.2.3 Suspected unexpected serious adverse reactions (SUSARs) SUSARs are all serious adverse reactions with suspect causal relationship to the study drug that is unexpected (not previously described in the Investigator’s brochure) and serious.

9.2.4 Pregnancy Any pregnancy that occurs during study participation must be reported to the investigator/sponsor. To ensure subject safety, each pregnancy must be reported to the investigator/sponsor immediately. The pregnancy must be followed up to determine outcome (including premature termination) and status of mother and child. Pregnancy complications and elective terminations for medical reasons must be reported as an AE or SAE. Spontaneous abortions must be reported as an SAE. Any SAE occurring in association with a pregnancy brought to the investigator’s attention after the subject has completed the study and considered by the investigator as possibly related to the investigational product, must be promptly reported to the principal investigator/sponsor. In addition, the investigator must attempt to collect pregnancy information on any female partners of male study subjects who become pregnant while the subject is enrolled in the study. Pregnancy information must be reported to the investigator/sponsor as described above.

9.3 Severity of adverse events The severity of clinical AEs is graded on a three-point scale: mild, moderate, severe, and reported on specific AE pages of the CRF. If the severity of an AE worsens during study drug administration, only the worst intensity should be reported on the AE page. If the AE lessens in intensity, no change in the severity is required. If an AE occurs during a washout or placebo run-in phase and afterwards worsens during the treatment phase, a new AE page must be filled in with the intensity observed during study drug administration. Mild Event may be noticeable to subject; does not influence daily activities; the AE resolves spontaneously or may require minimal therapeutic intervention; Moderate Event may make subject uncomfortable; performance of daily activities may be influenced; intervention may be needed; the AE produces no sequelae. Severe

52

Event may cause noticeable discomfort; usually interferes with daily activities; subject may not be able to continue in the study; the AE produces sequelae, which require prolonged therapeutic intervention. A mild, moderate or severe AE may or may not be serious. These terms are used to describe the intensity of a specific event (as in mild, moderate, or severe myocardial infarction). However, a severe event may be of relatively minor medical significance (such as severe headache) and is not necessarily serious. For example, nausea lasting several hours may be rated as severe, but may not be clinically serious. Fever of 39°C that is not considered severe may become serious if it prolongs hospital discharge by a day. Seriousness rather than severity serves as a guide for defining regulatory reporting obligations.

9.4 Relationship to study drug For all AEs, the investigator will assess the causal relationship between the study test or reference preparation and the AE using his/her clinical expertise and judgment according to the following algorithm that best fits the circumstances of the AE:

Definitely: Temporal relationship to the administration of the study test or reference preparation

and course following a known reaction pattern;

Probably: Good reasons and sufficient documentation to assume a causal relationship;

Possibly: A causal relationship is conceivable and cannot be dismissed;

Unlikely: The event is most likely related to an etiology other than the trial treatment;

Not Related: No temporal relationship to the administration of the drug or other factors have caused

the event;

For reporting purposes, the categories “Definitely”, “Probably” and “Possibly” will be summarized as

“Suspected” Adverse Reactions.

9.5 Reporting procedures All events meeting the definition of an adverse event must be collected and reported from the first trial-related activity after the subject signs the informed consent until the end of the protocol required post-treatment follow-up period. All adverse events, either observed by the investigator or reported by the subject, must be recorded by the investigator and evaluated. A special section is designated to adverse events in the case report form. The following details must thereby be entered:

• Type of adverse event (The investigator should record the diagnosis, if available. If no diagnosis is available the investigator should record each sign and symptom as individual Adverse Events.)

• Start (date and time)

53

• End (date and time) • Severity (mild, moderate, severe) • Serious (no / yes) • Unexpected (no / yes) • Outcome (recovering/resoving, resolved, resolved with sequelae, ongoing at final

examination, fatal) • Relation to study drug (definitely, probably, posssible, unlikely, unrelated).

Adverse events are to be documented in the case report form in accordance with the above mentioned criteria.

9.5.1 Reporting procedures for SAEs In the event of serious AEs, the investigator has to use all supportive measures for best patient treatment. If there is any doubt about whether or not an adverse event has to be considered serious, the sponsor should be contacted. All serious adverse events must be reported to Biomedizinische Forschungs GmbH irrespective of causality or expectedness. The reporting time period for serious adverse events begins with the day signed informed consent was given and ends within 14 days after discontinuing study medication. However, if the termination visit takes place more than 14 days after the patient has discontinued study medication, the reporting time has to be extended until the termination visit. Serious adverse events have to be documented on the Serious Adverse Reporting Form and reported by fax or e-mail to Biomedizinische Forschungs GmbH Attention: Prof. Martha Eibl, MD Fax: 01/408 10 91 -13 Telephone: 01/408 10 91 Email: " [email protected]" with copy to " [email protected]" The following details should at least be available:

• Patient initials and number • Patient: date of birth, sex, ethical origin • The suspected investigational medical product (IMP) • The adverse event assessed as serious • Short description of the event and outcome

If applicable, the initial report should be followed by the Follow up report, indicating the outcome of the SAE. Reporting time-frame for the Investigator is 24 h of learning of its occurrence, even if it is not felt to be treatment-related or at the latest the following working day. The Monitor must be informed

54

accordingly. The original copy of the SAE form and the fax confirmation sheet must be kept with the documentation at the study site. Please note: Each SAE has also be documented in the CRF as an adverse event.Follow-up information about previously reported SAE must also be reported within 24 hours of the investigator receiving it. A new SAE form is sent, stating that this is a follow-up to the previously reported SAE and giving the date of the original report. The follow-up report should describe whether the event has resolved or continues, if and how it was treated, and whether the subject continued or discontinued study participation.The original of the SAE form with the follow-up information and the fax confirmation sheet must be kept with the documentation at the study site.

9.5.2 Reporting procedures for SUSARs It must be remembered that the regulatory authorities, and in case of SUSARs which could possibly concern the safety of the study participants, also the Institutional Review Board / Independent Ethics Committee (IRB / IEC) are to be informed. Such reports shall be made by the sponsor and the following details should be at least available:

• Patient initials and number • Patient: date of birth, sex, ethical origin • Name of investigator and investigating site • Period of administration • The suspected investigational medical product (IMP) • The adverse event assessed as serious and unexpected, and for which there is a reasonable

suspected causal relationship to the IMP • Concomitant disease and medication • Short description of the event:

• Description • Onset and if applicable, end • Therapeutic intervention • Causal relationship • Hospitalization of prolongation of hospitalization • Death, life-threatening, persistent or significant disability or incapacity

Electronic reporting should be the expected method for reporting of SUSARs to the competent authority. In that case, the format and content as defined by Guidance (28) should be adhered to. The latest version of MedDRA should be applied. Lower level terms (LLT) should be used.

9.5.3 Annual Safety Report The Annual Safety Report will be provided by the principal investigator at least once a year. This report will also be presented annually to the Independent Ethics (IEC) and to the competent authorities by the sponsor.

55

10. FOLLOW-UP

10.1 Follow-up of study participants including follow-up of adverse events Subjects will be immunized at the outpatient clinic of the Clinical Pharmacology Department of the University of Vienna Medical School and be followed there for 6 h. Thereafter, they will be released and allowed to return home with a patient diary. They will be expected to return to the clinic at 48 hours, 7 days, and 14 days (with the windows described under 8.5.1.). At those time points, the examinations shown in Table 2 will be performed and adverse events will be noted. Between visits, they will be expected to enter adverse events in the patient diary.

10.2 Treatment after end of study There will not be any treatment after the end of the study.

11. STATISTICAL METHODOLOGY AND ANALYSIS

11.1 Analysis sets Each dose group will be analyzed separately. Data from each dose level in the control groups will be pooled. Per-protocol anaysis will be used.

11.2 Sample size considerations Sample sizes in this study are arbitrary

11.3 Relevant protocol deviations Non-compliance in this study will be limited to clinic visits and the keeping of a diary. All protocol deviations will be listed in the study report.

11.4 Statistical analysis plan This being a first in-man phase I study, analyses of the primary endpoints will be limited to descriptive statistics and narratives.

56

The efficacy endpoint of TSST- Ab response will be monitored and described. Only if immunogenicity is seen, will further analyses be performed. These to include one-way or repeated measures ANOVA and Mann-Whitney-U test to determine statistical significance post hoc. Immunogenicity is defined by seroconversion from a TSST-1 Ab titer of < 20 to >40 or a 4-fold increase in TSST-1 Ab titer. The rate of seroconversions and/or antibody response among groups will be compared and tested for significance by chi square test. Cytokines will be monitored and described.

11.5 Missing, unused and spurious data No data imputation is planned for missing and spurious data.

11.6 Endpoints analysis See 11.4.

11.6.1 Primary endpoint analysis See 11.4.

11.6.2 Secondary endpoint analysis See 11.4.

11.6.3 Exploratory objective See 11.4.

11.6.4 Baseline parameters and concomitant medications At baseline, antibody titers will be assessed for comparison with the efficacy endpoint.

11.7 Interim analysis Blinded immunogenicity and safety data will be monitored on an ongoing basis and will determine the dose and sample size of the next higher dose. Criteria for the termination of the trial

57

n.a.

11.8 Software program(s) to be determined

12. DOCUMENTATION AND DATA MANAGEMENT

12.1 Study Documents and Case Report Forms The investigator will maintain complete and accurate study documentation in a separate file (i.e., Investigator Site File). Documentation includes the clinical protocol as well any amendments, the agreement(s) between the Sponsor and the Investigator, and all other documents related to the study (e.g., medical records, records detailing the progress of the study for each subject, signed informed consent forms, drug disposition records, correspondence with the EC and the study monitor/sponsor, enrolment and screening information, CRFs, SAE-Reports, laboratory reports (if applicable), and data clarifications requested by the sponsor).

The investigator will comply with the procedures for data recording and reporting. Any corrections to study documentation must be performed as follows: 1) the first entry will be crossed out entirely, remaining legible; and 2) each correction must be dated and initialed by the person correcting the entry; the use of correction fluid and erasing are prohibited.

12.1.1 Case report form (CRF) For each subject enrolled, regardless of study test or reference preparation initiation, a CRF will be completed and signed by the investigator or a designated sub-investigator. This also applies to those subjects who fail to complete the study. If a subject withdraws from the study, the reason will be noted on the CRF. Case report forms are to be completed on an ongoing basis. CRF entries and corrections will only be performed by study site staff, authorized by the investigator. In a “Paper-CRF” all forms should be completed and must be legible. Errors should be crossed out but not obliterated, the correction inserted, and the change initialed and dated by the investigator, co-investigator or study nurse.The entries will be checked by trained personnel (Monitor) and any errors or inconsistencies will be checked immediately. The monitor will collect original completed and signed CRFs at the end of the study. A copy of the completed and signed CRFs will remain on site. Original CRFs to be passed to Prof. Martha Eibl, MD, at Biomedizinische Forschungs GmbH.

12.2 Direct access to source data/documents The investigator/study site will cooperate and provide direct access to study documents and data, including source documentation for monitoring by the study monitor, audits by the sponsor or sponsor’s representatives, review by the EC, and inspections by competent regulatory authorities, as

58

described in the Clinical Study Agreement. If contacted by an applicable regulatory authority, the investigator will notify the sponsor of contact, cooperate with the authority, provide the sponsor with copies of all documents received from the authority, and allow the sponsor to comment on any responses.

12.3 Retention of clinical trial documentation Subject notes must be kept for the maximum time period as permitted by the hospital, institution or private practice. Other source documents and the investigator’s site file must be retained for at least 15 years or longer in accordance with local regulation. However, the Subject Identification Codes must be kept for at least 15 years. The investigator must agree to archive the documentation pertaining to the trial in an archive after completion or discontinuation of the trial, if not otherwise notified. If any modifications become necessary or desirable, these will be documented in writing; major changes require the approval of all investigators and the ethics committee.

12.4 Quality Control and Quality Assurance

12.4.1 Periodic Monitoring The study monitor is responsible for ensuring and verifying that each study site conducts the study according to the protocol, standard operating procedures, other written instructions/agreements, ICH GCP, and applicable regulatory guidelines/requirements. The designated monitor will contact and visit the investigator regularly and will be allowed to have access to all source documents needed to verify the entries in the CRFs and other protocol-related documents provided that subject confidentiality is maintained in agreement with local regulations. It will be the monitor's responsibility to inspect the CRFs at regular intervals according to the SOP throughout the study, to verify the adherence to the protocol and the completeness, consistency and accuracy of the data being entered on them. The monitoring standards require full verification for the presence of informed consent, adherence to the inclusion/exclusion criteria, documentation of SAEs and the recording of the main efficacy, safety, and tolerability endpoints. The monitor will be working according to SOPs and will provide a monitoring report after each visit for the Sponsor. The investigator will resolve discrepancies of data. Source data verification will be 100%

12.4.2 Unblinded Monitoring and IMP Handling As complete blinding of the IMP in use is not possible for all parties involved in the study and to ensure that blinding is kept during ongoing study an unblinded person for study coordination at site and an unblinded monitor will be nominated for this study.

59

The unblinded study coordinator at site is responsible for all the ministration/handling/accountabliity and storage procedures and preparation of the IMP. Unblinded Monitoring visits will be done to ensure that all handling/storage/accountability and dispensing of IMP has been done according protocol and to do Source Data Verfication to ensure that all subjects are treated according their randomization arm.

12.4.3 Audit and Inspections Upon request, the investigator will make all study-related source data and records available to a qualified quality assurance auditor mandated by the sponsor or to competent authority inspectors. The main purposes of an audit or inspection are to confirm that the rights and welfare of the subjects have been adequately protected, and that all data relevant for assessment of safety and efficacy of the investigational product have appropriately been reported to the sponsor.

12.5 Reporting and Publication

12.5.1 Publication of study results The findings of this study will be published jointly by the investigator and the sponsor in a scientific journal and presented at scientific meetings. The manuscript will be circulated to all co-investigators before submission. Confidentiality of subjects in reports/publications will be guaranteed.

60

13. ETHICAL AND LEGAL ASPECTS

13.1 Informed consent of subjects Following comprehensive instruction regarding the nature, significance, impact and risks of this clinical trial, the subject must give written consent to participation in the study. During the instruction the trial participants are to be made aware of the fact that they can withdraw their consent – without giving reasons – at any time without their further medical care being influenced in any way. In addition to the comprehensive instructions given to the trial participants by the investigator, the trial participants also receive a written patient information sheet in comprehensible language, explaining the nature and purpose of the study and its progress. The subjects must agree to the possibility of study-related data being passed on to relevant authorities. The subjects must be informed in detail of their obligations in relation to the trial participants insurance in order not to jeopardize insurance cover.

13.2 Acknowledgement / approval of the study The principal investigator will submit this protocol and any related document provided to the subject (such as subject information used to obtain informed consent) to the Ethics Committee (EC) . Approval from the committee must be obtained before starting the study. The clinical trial shall be performed in full compliance with the legal regulations according to the Drug Law (AMG - Arzneimittelgesetz) of the Republic of Austria. An application must also be submitted to the Austrian Competent Authorities (Bundesamt für Sicherheit im Gesundheitswesen (BASG) represented by the Agency for Health and Food Safety (AGES PharmMed) and registered to the European Clinical Trial Database (EudraCT) using the required forms. The timelines for (silent) approval set by national law must be followed before starting the study.

13.2.1 Changes in the Conduct of the Study Protocol amendments Proposed (substantial) amendments must be submitted to the appropriate CA and ECs. Substantial amendments may be implemented only after CA/EC approval has been obtained. Amendments that are intended to eliminate an apparent immediate hazard to subjects may be implemented prior to

61

receiving CA/EC approval. However, in this case, approval must be obtained as soon as possible after implementation. Study Termination If the sponsor or the investigator decides to terminate the study before it is completed, they will notify each other in writing stating the reasons of early termination. In terminating the study, the sponsor and the investigator will ensure the adequate consideration is given to the protection of the subject interests. The investigator, sponsor or (designated CRO on behalf of the sponsor) will notify the relevant CA and EC. Documentation will be filed in the Trial Master and Investigator Files. Clinical Study Report (CSR) Within one year after the final completion of the study, a full CSR will be prepared by the sponsor and submitted to the EC and the competent authority. The Investigator will be asked to review and sign the final study report.

13.3 Insurance During their participation in the clinical trial the subjects will be insured as defined by legal requirements. The investigator of the clinical trial will receive a copy of the insurance conditions of the 'subjects insurance'. The sponsor is providing insurance in order to indemnify (legal and financial coverage) the investigator/center against claims arising from the study, except for claims that arise from malpractice and/or negligence. The compensation of the subject in the event of study-related injuries will comply with the applicable regulations. Details on the existing subjects insurance are given in the patient information sheet.

13.4 Confidentiality The information contained in this document, especially unpublished data, is the property of the Sponsor . It is therefore provided to you in confidence as an investigator, potential investigator, or consultant, for review by you, your staff, and an Ethics Committee or Institutional Review Board. It is understood that this information will not be disclosed to others without written authorization from the Sponsor.

13.5 Ethics and Good Clinical Practice (GCP) The investigator will ensure that this study is conducted in full conformance with the principles of the "Declaration of Helsinki" (as amended at the 56th WMA General Assembly, Tokyo, Japan, 2008) and with the laws and regulations of the country in which the clinical research is conducted. The investigator of the clinical trial shall guarantee that only appropriately trained personnel will be involved in the study. All studies must follow the ICH GCP Guidelines (June 1996) and the EU Directive embedded in the Austrian drug act.

62

14. REFERENCES

Bavari, S., Ulrich, R.G., LeClaire, R.D. (1999) Cross-reactive antibodies prevent the lethal effects of Staphylococcus aureus superantigens. J Inf Dis. 180, 1365-1369.

Chambers, H.F.(1997) Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implication. Clin Microbiol Reviews 10, 781-791. Chambers, H.F., DeLeo, F.R. (2009) Waves of resistance: Staphylococcus aureus in the antibiotic era. Nature Rev.Microbiol. 7, 629-641. Daum, R.S., Spellberg, B. (2012) Progress towards Staphylococcus aureus Vaccine. Clinical Infectious Disease 54, 560-567. Dauwalder, O., Thomas, D., Ferry, T., Debard, A.L., Badiou, C., Vandenesch, F., Etienne, J., Lina, G., Monneret, G. (2006) Comparative inflammatory properties of staphylococcal superantigenic enterotoxins SEA and SEG: implications for septic shock. J. Leukoc. Biol 80, 753-758. Dinges, M.M., Orwin, P.M., Schlievert, P.M. (2000) Exotoxins of Staphylococcus aureus. Clin. Microbio. Rev. 13, 16-34. Dinges, M.M., Schlievert, P.M. (2001) Comparative Analysis of Lipopolysaccharide-Induced Tumor Necrosis Factor Alpha Activity in Serum and Lethality in Mice and Rabbits Pretreated with the Staphylococcal Superantigen Toxic Shock Syndrome Toxin 1. Inf.Immun.69,7169-7172. Faulkner, L., Cooper, A., Fantino, C., Altmann, D.M., Sriskandan, S. (2005) The mechanism of superantigen-mediated toxic shock: not a simple Th1 cytokine storm. J. Immunol. 175, 6870-6877. Foster, T.J.-(2005) Immune evasion by staphylococci. Nat. Rev.Microbiol. 3,948-958. Gampfer, J.M., Samstag, A., Waclavicek, M., Wolf, H.M., Eibl, M.M., Gulle, H. (2002) Epitope mapping of neutralizing TSST-1 specific antibodies induced by immunization with toxin or toxoids. Vaccine. 20, 3675-3684.

Hopkins, P.A., Fraser, J.D., Pridmore, A.C., Russell, H.H., Read, R.C., Sriskandan, S.(2005) Superantigen recognition by HLA class II on monocytes up-regulates Toll-like receoptor 4 and enchances proinflammatory responses to endotoxin. Blood 105, 3655-3662. Hu, D.L., Omoe, K., Sasaki, S., Sashinami, H., Sakuraba, H., Yokomizo, Y., Shinagawa, K., Nakane, A. (2003) Vaccination with nontoxic mutant toxic shock syndrome toxin 1 protects against Staphylococcus aureus infection. J Inf Dis. 188,743-752.

63

Kaul, R., McGeer, A., Norrby-Tegelund, A., Kotb, M., Schwartz, B., O'Rourke, K., Talbot, J., Low, D., E. (1999) Intravenous Immunoglobulin therapy for streptococcal toxic shock syndrome - A comparative observational study. Clin Infect Dis. 28, 800-807.

Krakauer, T. (2003) Measurement of proinflammatory cytokines and T-cell proliferative response in superantigen-activated human peripheral blood mononuclear cells. Methods Mol.Biol.214,137-149. Krakauer T., Buckley M.J., Fisher D. (2010) Proinflammatory mediators of toxic shock and their correlation to lethality. Mediators Inflamm. 2010,517594. Krakauer, T. (2013)Update on staphylococcal superantigen-induced signaling pathways and therapeutic interventions. Toxins (Basel). 5, 1629-1654. Kum, W.W., Wood, J.A., Chow, A.W.(1996) A mutation at glycine residue 31 of toxic shock syndrome toxin-1 defines a functional site critical for major histocompatibility complex class II binding and SAgic activity. J.Infect.Dis.174,1261-1270. McCormick, J.K., Yarwood, J.M., Schlievert, P.M.(2001) Toxic shock syndrome and bacterial superantigens: an update. Ann.Rev.Microbiol.55,77-104. McCormick, J.K., Tripp, T.J., Llera, A.S., Sundberg, E.J., Dinges, M.M., Mariuzza, R.A., Schlievert,. P.M.(2003) Functional analysis of the TCR binding domain of toxic shock syndrome toxin-1 predicts further diversity in MHC class II/superantigen/TCR ternary complexes. J.Immunol.171,1385-1392.

Miethke, T., Wahl, C., Regele, D.,Gaus, H.,Heeg, K., Wagner, H. (1993) Superantigen mediated shock: a cytokine release syndrome. Immunobiology. 189,270-284. Roggiani M, Stoehr JA, Olmsted SB, Matsuka YV, Pillai S, Ohlendorf DH, Schlievert PM. (2000) Toxoids of streptococcal pyrogenic exotoxin A are protective in rabbit models of streptococcal toxic shock syndrome. Infect Immun.68(9), 5011-5017. Salgado-Pabon, W., Breshears, L., Spaulding, A.R., Merriman, J.A., Stach, C.S., Horswill, A.R., Peterson, M.L., Schlievert, P.M. (2013) Superantigens are critical for Staphylococcus aures infective endocarditis, sepsis, and acute kidney injury. mBio 4(4): e00494-13. Schlievert, P.M.(1982) Enhancement of Host Susceptibility to Lethal Endotoxin Shock by Staphylococcal Pyrogenic Exotoxin Type C. Infect Immun.36(1), 123-128. Schlievert, P.M.(2005) Staphylococcal toxic shock syndrome: still a problem. Med.J.Aust. 182:651-652. Spaulding, A.R., Ying-Chi L., Merriman, J.A., Brosnahan, A.J., Peterson, M.L., Schlievert, P.M. (2012) Immunity to Staphylococcus aureus secreted proteins protects rabbits from serious illnesses. Vaccine. 30, 5099-5109.

64

Stich, N., Waclavicek, M., Model, N., Eibl, M.M. (2010) Staphylococcal Superantigen (TSST-1) Mutant Analysis Reveals that T Cell Activation Is Required for Biological Effects in the Rabbit Including the Cytokine Storm . Toxins 2(9),2272-2288. Strandberg KL, Rotschafer JH, Vetter SM, Buonpane RA, Kranz DM, Schlievert PM (2010) Staphylococcal superantigens cause lethal pulmonary disease in rabbits. J Infect Dis. 202(11), 1690-1697. Ulrich RG, Olson MA, Bavari S. (1998) Development of engineered vaccines effective Against structurally related bacterial superantigens. Vaccine.1998 16(19), 1857-1864. Zetola, N., Francis, J.S., Nuermberger, E.L., Bishai, W.R. Community-acquired methicillin-resistant Staphylococcus aureus: an emerging threat. (2005) Lancet Infect. Dis. 5, 275-286.

15. APPENDICES

65

Appendix 1 Labels for Test (Treatment) and Reference (Control ) Preparations

66

TEST PREPARATION (Treatment Group 1): 0.1 µg rTSST-1 Variant Vaccine INNER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien rTSST-1 Variant Vakzine 0,5 µg rTSST-1 Variant in 0,5 ml, adjuvantiert mit 1 mg Al(OH)3 eine Einzeldosis (0,1 ml) enthält 0,1 µg rTSST-1 Variant adjuvantiert mit 0,2 mg Al(OH)3

Suspension zur i.m. Injektion Nur zur einmaligen Entnahme Ch. Bez.: 01XYYYZ Lagertemperatur: 2-8°C Proband #: _________

OUTER LABEL

Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Eudra CT: 2013-003716-50 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien rTSST-1 Variant Vakzine 0,5 µg rTSST-1 Variant in 0,5 ml, adjuvantiert mit 1 mg Al(OH)3 eine Einzeldosis (0,1 ml) enthält 0,1 µg rTSST-1 Variant adjuvantiert mit 0,2 mg Al(OH)3

Suspension zur i.m. Injektion Nur zur einmaligen Entnahme Ch. Bez.: 01XYYYZ verwendbar bis: XX.YY.ZZZZ Lagertemperatur: 2-8°C NICHT EINFRIEREN VOR GEBRAUCH SCHÜTTELN Nur zur klinischen Prüfung

67

TEST PREPARATION (Treatment Group 2) 0.3 µg rTSST-1 Variant Vaccine INNER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien rTSST-1 Variant Vakzine 0,5 µg rTSST-1 Variant in 0,5 ml, adjuvantiert mit 1 mg Al(OH)3 eine Einzeldosis (0,3 ml) enthält 0,3 µg rTSST-1 Variant adjuvantiert mit 0,6 mg Al(OH)3


OUTER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Eudra CT: 2013-003716-50 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien rTSST-1 Variant Vakzine 0,5 µg rTSST-1 Variant in 0,5 ml, adjuvantiert mit 1 mg Al(OH)3 eine Einzeldosis (0,3 ml) enthält 0,3 µg rTSST-1 Variant adjuvantiert mit 0,6 mg Al(OH)3


68

TEST PREPARATION (Treatment Group 3): 1.0 µg rTSST-1 Variant Vaccine INNER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien rTSST-1 Variant Vakzine 1 µg rTSST-1 Variant in 0,5 ml, adjuvantiert mit 1 mg Al(OH)3 eine Einzeldosis (0,5 ml) enthält 1 µg rTSST-1 Variant adjuvantiert mit 1 mg Al(OH)3


OUTER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Eudra CT: 2013-003716-50 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien rTSST-1 Variant Vakzine 1 µg rTSST-1 Variant in 0,5 ml, adjuvantiert mit 1 mg Al(OH)3 eine Einzeldosis (0,5 ml) enthält 1 µg rTSST-1 Variant adjuvantiert mit 1 mg Al(OH)3


69





70





71





72

REFERENCE PREPARATION (Control Group 1): 0.2 mg Aluminium Hydroxide INNER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien Placebo 1 mg Al(OH)3 in 0,5 ml eine Dosis (0,1 ml) enthält 0,2 mg Al(OH)3


OUTER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Eudra CT 2013-003716-50 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien Placebo 1 mg Al(OH)3 in 0,5 ml eine Dosis (0,1 ml) enthält 0,2 mg Al(OH)3


73

REFERENCE PREPARATION (Control Group 2): 0.6 mg Aluminium Hydroxide INNER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien Placebo 1 mg Al(OH)3 in 0,5 ml eine Dosis (0,3 ml) enthält 0,6 mg Al(OH)3


OUTER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Eudra CT 2013-003716-50 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien Placebo 1 mg Al(OH)3 in 0,5 ml eine Dosis (0,3 ml) enthält 0,6 mg Al(OH)3


74

REFERENCE PREPARATION (Control Groups 3-6): 1.0 mg Aluminium Hydroxide Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien Placebo 1 mg Al(OH)3 in 0,5 ml eine Dosis (0,5 ml) enthält 1 mg Al(OH)3


OUTER LABEL Prüfer: Prof. Dr. Bernd Jilma Prüfplan Code: BioMed 0713 Eudra CT 2013-003716-50 Sponsor: Biomedizinische Forschungsgesellschaft mbH Lazarettgasse 19, A 1090 Wien Placebo 1 mg Al(OH)3 in 0,5 ml eine Dosis (0,5 ml) enthält 1 mg Al(OH)3
