supplementary information - nature · supplementary information ... ispa pyj335 derivative carrying...

1 / 28

Supplementary Information

Small molecule targeting of a diapophytoene desaturase inhibits S. aureus

virulence

Feifei Chena, Hongxia Di

a, Youxin Wang

c, Qiao Cao

a, Bin Xu

a, Xue Zhang

a, Nana

Yanga, Guijie Liu

a, Cai-Guang Yang

a, Yong Xu

d, Hualiang Jiang

a, Fulin Lian

b, Naixia

Zhangb, Jian Li

c*, Lefu Lan

a*

aState Key Laboratory of Drug Research, Shanghai Institute of Materia Medica,

Chinese Academy of Sciences, Shanghai 201203, China;

bShanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai

201203, China;

cShanghai

Key Laboratory of New Drug Design, School of Pharmacy, East China

University of Science and Technology, Shanghai 200237, China;

dHumanwell Healthcare (Group) Co. Ltd., Wuhan 430075, China.

F.C., H.D., and Y.W. contributed equally to this work.

*Address correspondence to Lefu Lan, [email protected], or Jian Li,

[email protected]

Nature Chemical Biology: doi:10.1038/nchembio.2003

mailto:[email protected]

mailto:[email protected]

2 / 28

Supplementary Results

TABLES

Supplementary Table 1. Plasmids and strains used in this study

Strains or plasmids Relevant genotype or characteristic Source

Plasmids

pYJ335 E. coli-S. aureus shuttle vector, Cmr,

Ermr

1

pCL-LacZ E. coli-S. aureus shuttle cloning vector,

single-copy integration vector in S.

aureus

2

pCL-crtO-lacZ pCL-lacZ derivative carrying crtO

promoter

3

pET28a Kmr, protein expression vector Novagen

pTX15 Xylose-inducible and glucose-repressible

expression vector, Tcr

4,5

pTXcrtMN pTX15 derivative carrying crtMN gene 4

pYJ335::crtN pYJ335 derivative carrying crtN gene of

S. aureus Newman in the downstream of

the xyl/tetO promoter

This study

pYJ335::ispA pYJ335 derivative carrying ispA gene of

S. aureus Newman in the downstream of

the xyl/tetO promoter

This study

pET28a::crtM pET28a derivative carrying crtM gene

of S. aureus Newman

This study

pET28a::crtN pET28a derivative carrying crtN gene

of S. aureus Newman

This study

pET28a::crtMN pET28a derivative carrying crtMN of S.

aureus Newman

This study

pET28a::ispA pET28a derivative carrying ispA of S.

aureus Newman

This study

pCL-crtN pCL-lacZ derivative carrying crtN gene

under control by the xyl/tetO promoter of

pYJ335

This study

Staphylococcus aureus

Newman Wild-type, S. aureus ATCC 25904 6

RN4220 Derivative of 8325-4 that accepts

plasmids

7

USA300 LAC A representative CA-MRSA isolate,

which was first isolated in Los Angeles,

8


3 / 28

Calif.

USA400 MW2 MW2 is PFGE type USA400, the

prototype CA-MRSA strain type endemic

in the U.S. Midwest.

8

NRS1 (Mu50) A HA-MRSA/VISA strain isolated in

Japan

9

Newman crtM A transposon insertion in the crtM gene

of Newman strain

10,11

Newman crtN A transposon insertion in the crtN gene of

Newman strain

10,11

LAC crtN Transduction of crtN::erm allele from

Newman crtN mutant into USA300 LAC

This study

MW2 crtN Transduction of crtN::erm allele from

Newman crtN mutant into USA400 MW2

This study

Newman::pCL Wild-type S. aureus Newman carrying an

empty integration vector pCL-lacZ

3

Newman crtN:: pCL Newman crtN mutant carrying an empty

integration vector pCL-lacZ

This study

Newman crtN::pCL-crtN crtN::C strain, Newman crtN mutant

carrying integration vector pCL-crtN

This study

LAC::pCL Wild-type S. aureus USA300 LAC

carrying an empty integration vector

pCL-lacZ

This study

LAC crtN:: pCL LAC crtN mutant carrying an empty


This study

LAC crtN::pCL-crtN crtN::C strain, LAC crtN mutant carrying

an integration vector pCL-crtN

This study

MW2::pCL Wild-type S. aureus USA400 MW2

carrying an empty integration vector

pCL-lacZ

This study

MW2 crtN:: pCL MW2 crtN mutant carrying an empty


This study

MW2 crtN:: pCL-crtN crtN::C strain, MW2 crtN mutant

carrying an integration vector pCL-crtN

This study

Newman:: crtO-lacZ Wild-type Newman carrying an

integration vector pCL-crtO-lacZ

This study

Newman/pYJ335 Wild-type Newman carrying plasmid

pYJ335

This study

Newman/pYJ335::crtN Wild-type Newman carrying plasmid

pYJ335::crtN

This study

crtN/pYJ335 Newman crtN mutant carrying plasmid

pYJ335

This study

crtN/pYJ335::crtN crtN-C strain, Newman crtN mutant

carrying plasmid pYJ335::crtN

This study


4 / 28

Newman ispA A transposon insertion in the ispA gene of

Newman strain

10,11

ispA/pYJ335 Newman ispA mutant carrying plasmid

pYJ335

This study

ispA/pYJ335::ispA ispA-C strain, Newman ispA mutant

carrying plasmid pYJ335::ispA

This study

Staphylococcus carnosus

TM300::pTX15 Staphylococcus carnosus TM300

carrying plasmid pTX15

4

TM300::pTXcrtMN Staphylococcus carnosus TM300

carrying plasmid pTXcrtMN

4

E. coli

BL21(DE3) F− ompT hsdSB (rB

− mB

−) gal dcm met

(DE3)

Laboratory

stock

DH5α

endA hsdR17 supE44 thi-1 recA1 gyrA

relA1Δ(lacZYA-argF)U169 deoR

(φ80dlacΔ(lacZ)M15)

Laboratory

stock

Cmr, chloroamphenicol resistance; Erm

r, erythromycin resistance; Tc

r, tetracycline

resistance; Kmr, kanamycin resistance.

Supplementary Table 2. Primers used in this study.

Primers Sequence (5′to 3′)

crtN-F TAAATATCATAGAATATAGGTGGTTG

crtN-R CCCTTATACTTTTCTCACATCT

IspA-F AAAGAAGAAGCTGAGGATGTAAAAA

IspA-R TTGCTTTTAGTGATCCCTGCTA

IspA-PF CGCGGATCCATGACGAATCTACCGATGAATAAAT

IspA-PR CCCAAGCTTTTAGTGATCCCTGCTATAAAATAAA

crtM-PF CGCGGATCCATGACAATGATGGATATGAATTTTAA

crtM-PR CCGCTCGAGCTATATTCTATGATATTTACTATTT

crtN-PF CGCGGATCCATGAAGATTGCAGTAATTGGTGCAG

crtN-PR CCGCTCGAGTTATACGCCCCGCTCAATATCTTTA

crtN-pCL-F CCGGAATTCCTTGGTTACCGTGAAGTTACCATCACGG

crtN-pCL-R CGGGGTACCCTTTCTCTTAGACTACTCCCTTATACG


5 / 28

FIGURES

Supplementary Figure 1. The proposed staphyloxanthin biosynthetic pathway

and the gene cluster organization of staphyloxanthin biosynthesis genes in S.

aureus. IPP, isopentenyl diphosphate; DMAPP, γ,γ-dimethylallyl pyrophosphate; OPP,

O-linked pyrophosphate; GPP, geranyl pyrophosphate; FPP, farnesyl diphosphate;

IspA, FPP synthase. The lines show the interaction between the players: hammerheads,


6 / 28

repression; solid line with arrow, a direct influence or direct connection; dotted line

with arrow, a putative or indirect connection. BPH652 is a known inhibitor of CrtM12

.


7 / 28

Supplementary Figure 2. Effect of naftifine on the bacterial growth and pigment

production of S. aureus. (a,b) Effect of naftifine on the bacterial growth of S. aureus

Newman. Data shown represent the mean SD from quadruplicate experiments. (c–e)

The dose-response curves and IC50 value of naftifine hydrochloride in the pigment

production of S. aureus USA300 LAC (c), USA400 MW2 (d), and Mu50 (e). Data

shown represent the mean SEM from triplicate experiments. The level of the

pigment production by untreated wild-type S. aureus bacteria are set to 100%,

respectively. Naftifine was used in the forms of hydrochloride salt.


8 / 28

Supplementary Figure 3. Effect of naftifine on crtOPQMN operon promoter

activity, pigment production, and the isoprenoids production of S. aureus

Newman. (a) Bacteria were cultured in Tryptone Soya Broth (TSB) medium at 37 C

for 6 h, and after that the bacterial cultures were treated with naftifine hydrochloride

(100 μM), and sampled at different time points thereafter. LacZ activity was

normalized by cell density at 600 nm (OD600). Data shown represent the mean SD

from triplicate experiments. (b) Photographs showed the pigmentation of S. aureus

cells (harvested by centrifugation) untreated or treated by naftifine hydrochloride (100

μM) for 12 h. (c–f) RP-HPLC chromatograms (absorption at 210 nm) of the


9 / 28

isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its

complementary strain ispA-C (e), and wild-type S. aureus Newman treated by

naftifine hydrochloride (f). Wild-type Newman and ispA mutant harbor plasmid

pYJ335. The details of the information of S. aureus strains are shown in

Supplementary Table 1. Inset photographs showed the pigmentation of indicated S.

aureus cells harvested by centrifugation. Arrows indicate two HPLC peaks, which are

absent from the HPLC profiles due to the inactivation of ispA involved in the

isoprenoid biosynthetic pathway.


10 / 28

Supplementary Figure 4. Fluorescence-based thermal shift assay and HPLC

analysis. (a) Thermal denaturation curves for purified 6His-ispA alone (3 μM,

approximately 2 μg) or in the presence of variable concentrations (30, 150, and 300

μM) of ibandronate sodium (Iban). (b) HPLC chromatogram (absorption at 210 nm)

of the isoprenoids sample prepared from S. aureus Newman treated with ibandronate

sodium (100 μM).


11 / 28

Supplementary Figure 5. HPLC analysis of carotenoids samples prepared from E.

coli expressing either crtM or crtMN. (a) HPLC chromatograms of the carotenoid

extracts derived from E. coli/pET28a. (b,c) HPLC chromatograms of the carotenoid

extracts derived from E. coli expressing either S. aureus crtM (b) or crtMN (c).

Bacteria were grown in LB medium for 24 h. The pigmentation of the indicated

bacteria cells harvested by centrifugation is illustrated. The inset shows the

absorbance spectrum of the indicated HPLC peak. mAu, milli absorbance units. Abs

(absorbance), representing the amount of light absorbed by the sample.


12 / 28

Supplementary Figure 6. Experiments show that CrtN is the target for naftifine

activity. (a) The dose-response curves and IC50 value of nafitine hydrochloride in the

pigment production of Newman/pYJ335::crtN strain (crtN+++

). (b,c) The

dose-response curves and IC50 value of BPH-652 in the pigment production of

Newman (harboring pYJ335) (b) and Newman/pYJ335::crtN strain (crtN+++

)(c). In

(a–c), data shown represent the mean SEM from triplicate experiments. The level of

the pigment production by untreated S. aureus bacteria is set to 100%. (d) Effect of

naftifine hydrochloride treatment on S. aureus Newman crtN mutant bacteria survival

in the kidneys, hearts, and livers of mice. BALB/c mice received mock (n = 11) or

naftifine hydrochloride (n = 8) treatment. Each symbol represents the value for an

individual mouse. Horizontal bars indicate observation means and dashed lines mark

limits of detection. n.s. indicates no significant difference determined by

Mann-Whitney Test (two-tailed).


13 / 28

Supplementary Figure 7. SDS-PAGE protein gel image. The purified 6His-crtN

protein, and the protein samples of lysates derived from either E. coli/pET28a or E.

coli/pET28a::crtN induced by IPTG were resolved on 8% polyacrylamide Tris-tricine

gel followed by Coomassie blue staining.


14 / 28

Supplementary Figure 8. CrtN enzyme activity assays. (a) The lysates of E.

coli/pET28a and E. coli/pET28a::crtN were incubated in an CrtN enzyme activity

reaction and extracted with methanol/chloroform. The yellow color in the aqueous

epiphase is FAD. (b) The absorption spectrum of the yellow-colored carotenoid.


15 / 28

Supplementary Figure 9. Lineweaver–Burk plots of CrtN activities in the

presence of the nafitine hydrochloride. A double reciprocal plot (1/V versus 1/[S])

where V is reaction velocity and [S] is the substrate concentration was plotted. Km is

the Michaelis-Menten constant, Vmax is the maximal velocity, [S] is the substrate

concentration, and V is the rate of reaction. Data shown represent the mean SEM

from triplicate experiments. Enzyme activity was determined as described in the

Methods.


16 / 28

Supplementary Figure 10. Effect of naftifine hydrochloride on the

ligand-induced destabilization of CrtN protein. SDS-PAGE protein gel image (a)

and thermal shift assay curves (b) illustrated that naftifine hydrochloride (100 μM)

decreases the Tm value of CrtN protein in the cell lysates of E. coli/pET28a::crtN

strain. Experiments were performed on two independent occasions with similar results

and shown is a representative profile.


17 / 28

Supplementary Figure 11. Western blot images. Uncut Western blot images

illustrated that naftifine hydrochloride (100 μM) decreases the Tm value of CrtN

protein in S. carnosus TM300 cells. Experiments were performed on five independent

occasions, as indicated. The uncut Western blot image in the uppermost portion of this

Figure has been cut for use in the Figure 3c within the main text.


18 / 28

Supplementary Figure 12. Naftifine inhibits the pigment production of S.

carnosus TM300::pTXcrtMN. Effect of naftifine hydrochloride (100 μM) on the

pigmentation of Staphylococcus carnosus expressing crtMN (TM300::pTXcrtMN, see

Supplementary Table 1). Bacteria were grown at 37 C in TSB medium without

glucose for 24 h and harvested by centrifugation.


19 / 28

Supplementary Figure 13. Ligand observed 1H NMR experiment implicates the

binding of naftifine hydrochloride to CrtN. T1ρ spectra were acquired by using

naftifine hydrochloride (200 M) alone (colored in maroon), naftifine hydrochloride

(200 M) in the presence of 1 M (colored in blue ), 2 M (colored in purple), and 5

M CrtN protein (colored in green). NMR resonances for protons in the structure of

naftifine hydrochloride were generally assigned (Supplementary Figure 14).


20 / 28

Supplementary Figure 14. Nuclear magnetic resonance spectroscopic data.

Nuclear magnetic resonance (NMR) spectroscopic data of nafitine hydrochloride in

D2O solution (a) or MeOD solution (b). NMR spectroscopy was performed on a

Bruker AMX-400 NMR with tetramethylsilane (TMS) as an internal standard.

Chemical shifts were reported in parts per million (ppm, δ) downfield from

tetramethylsilane. Proton coupling patterns, as well as the proton chemical shifts,

were in agreement with the structure of naftifine hydrochloride. *: solvent residual

peak of MeOD. **: solvent residual peak of D2O. Spectroscopic data was given as


21 / 28

below, and proton coupling patterns were described as singlet (s), doublet (d), triplet

(t), double triplets (dt), quartet (q), double quartets (dq), multiplet (m).

1H NMR (400 MHz, MeOD) δ 8.22 (d, J = 8.5 Hz, 1H), 8.09 (d, J = 8.2 Hz, 1H), 8.04

(d, J = 8.1 Hz, 1H), 7.80 (d, J = 7.0 Hz, 1H), 7.71 (t, J = 7.6 Hz, 1H), 7.68 – 7.59 (m,

2H), 7.55 (d, J = 7.6 Hz, 2H), 7.39 (dq, J = 13.6, 6.8 Hz, 3H), 6.99 (d, J = 15.8 Hz,

1H), 6.51 – 6.33 (m, 1H), 5.07 (s, 1H), 4.78 (s, 1H), 4.13 (d, J = 14.8 Hz, 2H), 2.88 (s,

3H).

1H NMR (400 MHz, D2O) δ 7.96 – 7.83 (m, 3H), 7.55 (t, J = 7.2 Hz, 1H), 7.54 – 7.43

(m, 3H), 7.40 (d, J = 7.4 Hz, 2H), 7.37 – 7.24 (m, 3H), 6.76 (d, J = 15.9 Hz, 1H), 6.20

(dt, J = 15.4, 7.5 Hz, 1H), 4.82 (d, J = 13.1 Hz, 1H), 4.46 (d, J = 13.4 Hz, 1H), 3.89 (t,

J = 7.3 Hz, 2H), 2.73 (s, 3H).


22 / 28


23 / 28

Supplementary Figure 15. The substrate and the amino acid sequence of either

squalene epoxidase (SE) or CrtN. (a) SE is an epoxidase13

while CrtN is capable of

desaturating squalene into dehydrosqualene14

and catalyzes the formation of the first

deep yellow-colored carotenoid intermediate product (4,4′-diaponeurosporene) which

is formed via successive three dehydrogenation reactions4,15,16

. (b) Sequence

alignment of S. aureus Newman CrtN, Saccharomyces cerevisiae S288c squalene

epoxidase (YGR175C), and Candida albicans SC5314 squalene epoxidase

(CaO19.406) using the ClustalW program. Stars indicate identical amino acids,

double dots (:) indicate conserved amino acids, and single dots (.) indicate that

residues are more or less similar.


http://en.wikipedia.org/wiki/Squalene_epoxidase




24 / 28

Supplementary Figure 16. Structure-activity relationship analysis of naftifine

analogs. Shown are analogue structures of naftifine and their pigment inhibition or

CrtN inhibition profiles. Four distinctive moieties were included in the chemical

structure of naftifine: naphthyl (yellow color), N-methyl substituent (blue color), allyl

(black color), and phenyl (red color). IC50 values represent the average of three

independent experiments. Naftifine (compound 1), terbinafine (compound 2),

butenafine (compound 3), JX04 (compound 4), and JX07–JX09 (compound 7–9) were

used in the forms of hydrochloride salt. JX05 (compound 5), JX06 (compound 6),

JX10 (compound 10), and JX11 (compound 11) were used in the forms of

1,5-naphthalene sulfonate. Compound 12 (JX07-a) was the key intermediate for the

synthesis of JX07-JX11 (Supplementary Note).


25 / 28

Supplementary Figure 17. Images illustrate that crtN is essential for the pigment

production of S. aureus Newman, USA300 LAC, and USA400 MW2 strains. S.

aureus bacteria were grown in TSB medium at 37 C with shaking, 250 rpm of

aeration for 24 h, and then harvested by centrifugation.


26 / 28

Supplementary Figure 18. Naftifine blocks the virulence of MRSA strains. (a)

Effect of naftifine in protecting mice (n = 15) from lethal S. aureus infection

challenged with 2.5 108 CFU MW2 bacteria. The statistical significance was

examined with the log-rank test (mock vs. naftifine, ***p< 0.001). (b) Effect of

naftifine on S. aureus survival in the kidneys, hearts, and livers of mouse (n = 13)

challenged with 1.2 108 CFU Mu50 bacteria. The statistical significance was

determined by Mann-Whitney Test (two-tailed): **p<0.01; n.s. indicates no

significant difference; each symbol represents the value for an individual mouse;

horizontal bars indicate observation means and dashed lines mark limits of detection.


27 / 28

SUPPLEMENTARY DATA SET

Supplementary Data Set 1 lists marked drugs used for the screening in this study.

References

1. Ji, Y., Marra, A., Rosenberg, M. & Woodnutt, G. Regulated antisense RNA eliminates

alpha-toxin virulence in Staphylococcus aureus infection. Journal of bacteriology 181,

6585-6590 (1999).

2. Sun, F., et al. In the Staphylococcus aureus two-component system sae, the response

regulator SaeR binds to a direct repeat sequence and DNA binding requires phosphorylation

by the sensor kinase SaeS. Journal of bacteriology 192, 2111-2127 (2010).

3. Ding, Y., et al. Metabolic sensor governing bacterial virulence in Staphylococcus aureus.

Proceedings of the National Academy of Sciences of the United States of America 111,

E4981-4990 (2014).

4. Pelz, A., et al. Structure and biosynthesis of staphyloxanthin from Staphylococcus aureus. The

Journal of biological chemistry 280, 32493-32498 (2005).

5. Wieland, K.P., Wieland, B. & Gotz, F. A promoter-screening plasmid and xylose-inducible,

glucose-repressible expression vectors for Staphylococcus carnosus. Gene 158, 91-96 (1995).

6. Duthie, E.S. & Lorenz, L.L. Staphylococcal coagulase; mode of action and antigenicity. Journal

of general microbiology 6, 95-107 (1952).

7. Kreiswirth, B.N., et al. The toxic shock syndrome exotoxin structural gene is not detectably

transmitted by a prophage. Nature 305, 709-712 (1983).

8. Bubeck Wardenburg, J. & Schneewind, O. Vaccine protection against Staphylococcus aureus

pneumonia. The Journal of experimental medicine 205, 287-294 (2008).

9. Kuroda, M., et al. Whole genome sequencing of meticillin-resistant Staphylococcus aureus.

Lancet 357, 1225-1240 (2001).

10. Bae, T., et al. Staphylococcus aureus virulence genes identified by bursa aurealis mutagenesis

and nematode killing. Proceedings of the National Academy of Sciences of the United States

of America 101, 12312-12317 (2004).

11. Lan, L., Cheng, A., Dunman, P.M., Missiakas, D. & He, C. Golden pigment production and

virulence gene expression are affected by metabolisms in Staphylococcus aureus. Journal of

bacteriology 192, 3068-3077 (2010).

12. Liu, C.I., et al. A cholesterol biosynthesis inhibitor blocks Staphylococcus aureus virulence.

Science 319, 1391-1394 (2008).

13. Belter, A., et al. Squalene monooxygenase - a target for hypercholesterolemic therapy.

Biological chemistry 392, 1053-1075 (2011).

14. Furubayashi, M., Li, L., Katabami, A., Saito, K. & Umeno, D. Construction of carotenoid

biosynthetic pathways using squalene synthase. FEBS letters 588, 436-442 (2014).

15. Kim, S.H. & Lee, P.C. Functional expression and extension of staphylococcal staphyloxanthin

biosynthetic pathway in Escherichia coli. The Journal of biological chemistry 287,

21575-21583 (2012).


28 / 28

16. Raisig, A. & Sandmann, G. 4,4'-diapophytoene desaturase: catalytic properties of an enzyme

from the C(30) carotenoid pathway of Staphylococcus aureus. Journal of bacteriology 181,

6184-6187 (1999).


supplementary information - nature · supplementary information ... ispa pyj335 derivative carrying...

Documents