supplementary materiallup.lub.lu.se/search/ws/files/2522147/3694098.pdf · 1 supplementary material...

1

SUPPLEMENTARY MATERIAL

Role of Gα(olf) in Familial and Sporadic Adult-Onset Primary Dystonia

Satya R. Vemula1, Andreas Puschmann2, Jianfeng Xiao1, Yu Zhao1, Monika Rudzińska3, Karen

P. Frei4, Daniel D. Truong4, Zbigniew K. Wszolek5 and Mark S. LeDoux1,*

1Departments of Neurology, and Anatomy & Neurobiology, University of Tennessee Health

Science Center, Memphis, TN 38163, USA, 2Department of Neurology, Skåne University

Hospital and Department of Neurology, Lund University, Sweden, 3Department of Neurology,

Jagiellonian University Medical College in Krakow, Krakow, Poland, 4Parkinson’s & Movement

Disorder Institute, Fountain Valley, CA, 92708, USA, 5Department of Neurology, Mayo Clinic

Jacksonville, Jacksonville, FL 32224, USA

Corresponding author:

Mark S. LeDoux, MD, PhD

University of Tennessee Health Science Center

Department of Neurology

855 Monroe Avenue, Link Building-Suite 415

Memphis, Tennessee 38163, USA

Phone: (901) 448-1662

Fax: (901) 448-7440

E-mail: [email protected]

2

Supplementary Figure S1. Multipoint LOD scores for Family A generated with SNP genotypes

under an autosomal dominant model. Marker positions are plotted on the x-axis and vertical

dashed lines delimit the 22 autosomes.

3

Supplementary Figure S2. Chr 18 Haplotype Analysis in Family A. SNP markers with distances from the 18p terminus and LOD scores from top to bottom are rs635269 (8,398,430 bp, -2.77), rs420905 (9,529,801 bp, -0.71), rs1378528 (9,699,480 bp, -0.77), rs1005930 (10,133,877 bp, -0.99), rs1013785 (10,697,433 bp, 1.12), rs906283 (10,918,706 bp, 1.12), rs1395610 (10,940,757 bp, 1.12), rs264234 (10,964,447 bp, 1.59), rs753639 (11,522,986 bp, 1.56), rs1471408 (11,531,255 bp, 1.56), rs693301 (13,087,206 bp, 2.82), rs879588 (13,173,503 bp, 2.90), rs872906 (13,367,698 bp, 2.71), rs1893495 (13,749,428 bp, 1.36), and rs8085654 (16,824,232 bp, 1.54). The c.682G>T GNAL mutation is demarcated with a rectangle which is located at position 11,868,544 on Chr. 18 (NC_000018).

4

Supplementary Figure S3. Heat map visualization of 111 significantly dysregulated probe sets

through a filter criterion of 1.5 fold change with p ≤ 0.05 (unpaired t-test).

1

SUPPLEMENTARY MATERIAL

Role of Gα(olf) in Familial and Sporadic Adult-Onset Primary Dystonia

Satya R. Vemula1, Andreas Puschmann2, Jianfeng Xiao1, Yu Zhao1, Monika Rudzińska3, Karen

P. Frei4, Daniel D. Truong4, Zbigniew K. Wszolek5 and Mark S. LeDoux1,*

1Departments of Neurology, and Anatomy & Neurobiology, University of Tennessee Health

Science Center, Memphis, TN 38163, USA, 2Department of Neurology, Skåne University

Hospital and Department of Neurology, Lund University, Sweden, 3Department of Neurology,

Jagiellonian University Medical College in Krakow, Krakow, Poland, 4Parkinson’s & Movement

Disorder Institute, Fountain Valley, CA, 92708, USA, 5Department of Neurology, Mayo Clinic

Jacksonville, Jacksonville, FL 32224, USA

Corresponding author:

Mark S. LeDoux, MD, PhD

University of Tennessee Health Science Center

Department of Neurology

855 Monroe Avenue, Link Building-Suite 415

Memphis, Tennessee 38163, USA

Phone: (901) 448-1662

Fax: (901) 448-7440

E-mail: [email protected]

2

Supplementary Table S1. SNP genotyping quality metrics

Subject IDa Parent ID Total calls Call Rate Reproducibility

Frequencyb

Parent to Child Heritability

c

A-II-03 NAd 5864 99.66% 100.00% 99.95%

A-III-08 A-II-03 5877 99.88% 100.00% 99.98%

A-III-05 A-II-03 5866 99.69% 100.00% 99.97%

A-III-02 A-II-03 5863 99.64% 100.00% 99.97%

A-IV-09 A-II-05 5872 99.83% 100.00% 99.98%

A-IV-10 A-II-05 5866 99.69% 100.00% 99.98% a18 subjects were genotyped, but only those samples subjected to technical replication (6) are included in the table. bReproducibility of the data from technical replicates of the same subject, replicated on the same chip. cParent to child heritability based on the genotype calls. dNo parental DNA was available for this subject.

Supplementary Table S2. SNP markers associated with the highest LOD scores SNP Marker Location LOD

a Dystonia

Associated Loci

rs262958 3p27.2 1.10 NA

rs13074297 3q27.2 1.09 NA

rs2048022 4q22.3 1.09 NA

rs1011495 4q22.3 1.09 NA

rs869417 3q27.2 1.09 NA

* * * *

* * * *

* * * *

rs879588 18p11.21 1.00 DYT7

rs2379107 1p36.32-36.13 0.65 DYT13

rs542617 2q14.3-21.3 0.38 DYT21 aAutosomal dominant model with penetrance of 0.5.

3

Supplementary Table S3. Summary of exome sequencing

Sample ID

a Phenotype Mapped

Reads Reads in

Exons +/- 18bp (% of mapped)

Read Depth (% of Exons

b)

Total # Variants

Total # Variants dbSNP Filter 2X 10X 20X

AA-III-8 Definite CD 65,176,741 51,608,122 (79.18%)

184,896 (99.60%)

182,980 (98.56%)

179,291 (96.58%)

2,977,330 2,503,785

AA-III-5 Definite CD 77,319,102 55,085,112 (71.24%)

185,045 (99.68%)

183,533 (98.86%)

180,737 (97.36%)

3,561,255 2,876,400

AA-III-6

Unaffected 59,187,832 46,244,356 (78.13%)

184,814 (99.55%)

182,636 (98.38%)

178,524 (96.16%)

3,498,651 2,849,914

aEach DNA sample was captured once with the Agilent SureSelectXT All Exon v4 Kit 51 Mb and

sequenced. bPercentage of exome coverage was based on exons targeted by the 51 Mb All

Exon Kit which incorporates CCDS, RefSeq and GENCODE annotations.

Supplementary Table S4. Post hoc linkage analysis of family A (c.682G>T, p.V228F)

SNP Marker Location LODa LOD

b

rs879588 18p11.2 2.90 4.03

rs693301 18p11.2 2.82 3.96

rs872906 18p11.2 2.71 3.85

rs12959039 18q11.2 2.28 2.90

rs1010800 18q11.2 2.27 2.88

rs1972602 18q11.2 2.20 2.82

rs984518 13q31.1 2.22 1.53

rs15720906 13q31.1 2.21 1.51

aAutosomal dominant model with penetrance of 0.5. aAutosomal dominant model with penetrance of 0.99.

4

Supplementary Table S5. In Silico analysis of sequence variants in GNAL

Family/ Proband

Phenotype Variant ClustalW2 Conservation

Polyphen-2

SIFT MutationTaster

Predictiona

Probabilityb

Prediction Scorec Prediction

d Probability

e

A CD p.V228F Exon 10

highly conserved

probably damaging

1 damaging 0 disease causing

0.99

B CD p.R198Tfs*13 Exon 8

highly conserved

NA NA NA NA disease causing

1

C CD p.R245* Exon 10

highly conserved


1

D CD p.M1_Q61del Exon 2

highly conserved


1

E CD p.E12G Exon 2

partially conserved

benign 0.45 tolerated 0.08 polymorphism 0.88

F Control p.N7S Exon 2

not conserved

benign 0.001 tolerated 0.78 polymorphism 0.99

aQualitative ternary classification (“benign”, “possibly damaging”, or “probably damaging”). bProbability of the variation being damaging. cSIFT scores range from 0 to 1. An amino acid substitution is predicted to be damaging if the score is ≤ 0.05, and tolerated if the score is > 0.05. dMutationTaster classifies the results as disease causing or polymorphism. eProbability ranges from 0 to 1.

5

Supplementary Table S6. GNAL mutation screening

Exon Cervical Dystoniab Controls

c

HRM Sanger Total Number of Subjects

HRM Sanger Total Number of Subjects

1a 0 144d 144 0 192

e 192

2a

0 144d 144 0 192

e 192

3 712 48 760 672 96 768 4 0 144

d 144 0 192

e 192

5 0 144d 144 0 192

e 192

6 0 144d 144 0 192

e 192

7 712 48 760 672 96 768 8

a 712 48 760 672 192

e 768

9 712 48 760 672 96 768 10

a 712 48 760 672 192

e 768

11 712 48 760 672 96 768 12 712 48 760 672 96 768 13 712 48 760 672 96 768

aExons harboring pathological variants. bM:F = 221:539; ethnicity = 714 Caucasian, 12 African-American, and 34 other; age: mean = 58.5 yrs, range = 20 - 92 yrs, SEM (standard error of the mean) = 13.7 yrs. Subjects with dystonia were divided in two groups for analysis. The first group included 48 probands with a positive family history of dystonia (M:F = 12:36; race = 41 Caucasian, 4 African-American, and 3 other; age: mean = 57.7 yrs, range = 29 - 85 yrs, SEM = 13.0 yrs; age of onset: mean = 41.3 yrs, range = 5 - 80 yrs, SEM = 15.6 yrs). The second group included 712 sporadic cases of cervical and segmental dystonia (M:F = 209:503, race = 673 Caucasian, 8 African-American, 7 Ashkenazi Jewish and 24 other; age: mean = 58.5 yrs, range = 20 - 92 yrs, SEM = 13.8 yrs; age of onset: mean = 48.1 yrs, range = 4 - 85 yrs, SEM = 14.6 yrs). cNormal controls were divided in two groups. The first group included 96 African-American subjects (M:F = 26:70; age: mean = 60.5 yrs, range = 21 - 86 yrs, SEM=16.7 yrs). The second group included 672 Caucasian subjects (M:F = 251:421, age: mean = 72.1 yrs, range = 28 - 96 yrs, SEM = 11.2 yrs. dIncludes 48 subjects from the first patient group and 96 subjects from the second patient group. eIncludes 96 subjects from the first control group and 96 subjects from the second control group.

6

Supplementary Table S7. Primers used for sanger sequencing, high resolution melting, and qRT-PCR

Primer Sequence (5’→3’)

Locus Usage Product (bp)

GNAL_E1aF aatgcaaaatgaccctctgg NC_000018 11689089-109 GNAL_E1aR ccggggcgtcagccgac NC_000018 11689973-957 Exon 1a Sanger

885 (with GNAL_E1aF)

GNAL_E2F cctgctctgaatcggaaaac NC_000018 11752280-299 GNAL_E2R atttcctacacgcgggttc NC_000018 11752751-733 Exon 2 Sanger 472 (with GNAL_E2F) GNAL_E3F ccggctagtggtgagagatg NC_000018 11752783-802 GNAL_E3R aagcacttttgggacgtctg NC_000018 11752995-976 Exon 3 Sanger

b 213 (with GNAL_E3F)

GNAL_E4F ggaaatttaaaatcccactcaa NC_000018 11753547-568 GNAL_E5R aaaatggttccatctttcact NC_000018 11753995-975 Exons 4 & 5 Sanger 449 (with GNAL_E4F) GNAL_E6F tttgcagtttctttttcctttt NC_000018 11824835-856 GNAL_E6R tgcatgcaatcatattcttcaa NC_000018 11825069-048 Exon 6 Sanger 235 (with GNAL_E6F) GNAL_E7F gggaaagtgggcagagaac NC_000018 11862344-362 GNAL_E7R tctcaaagtttctggtgtgtgg NC_000018 11862493-472 Exon 7 Sanger


GNAL_E8F atacccgggctttaccttga NC_000018 11864464-483 GNAL_E8R gaagcccccttaaacctcac NC_000018 11864687-668 Exon 8 Sanger


GNAL_E9F atgtgtgaacgctggaacct NC_000018 11867062-081 GNAL_E9R tgctgagtgttagaattcactcc NC_000018 11867278-256 Exon 9 Sanger


GNAL_E10F ctgagtagctgctgggtgtg NC_000018 11868457-476 GNAL_E10R cctggcctgagcgtatttt NC_000018 11868736-718 Exon 10 Sanger


GNAL_E11F ctatgttagaggcactttcatg NC_000018 11872201-222 GNAL_E11R aaacaattctattcctcaatcat NC_000018 11872443-421 Exon 11 Sanger


GNAL_E12F ccttctgtgttttcgtagagttg NC_000018 11876547-569 GNAL_E12R gaagggaggtagaaaaacaaagg NC_000018 11876727-705 Exon 12 Sanger


GNAL_E13F tccttccccagagtacatgc NC_000018 11880928-947 GNAL_E13R agagactctgcctcctaccat NC_000018 11881218-198 Exon 13 Sanger


GNAL_qr49Fa tgactacacacccacagacca NM_182978 1305-1325

GNAL_qr49R tggatccattttctcctctca NM_182978 1448-1428 QRT-PCR-1 (all isoforms) 144 (with GNAL_qr49F) GNAL_qr2F gcaaattatactgttcctgaagacg NM_182978 1687-1711 GNAL_qr2R gaacttggctcttgtaactttgg NM_182978 1758-1736 QRT-PCR-2 (all isoforms) 72 (with GNAL_qr2F) GNAL_qr18F aggaggcgaggaaagtgag NM_182978 836 - 854 GNAL_qr18R gcttttcccagactcaccag NM_182978 948 - 929 QRT-PCR (isoform 1) 113 (with GNAL_qr18F) GNAL_qr40F aagagcgcctggcttaca NM_001142339 438-455 GNAL_qr40R gcttttcccagactcaccag NM_001142339 505-486 QRT-PCR (isoform 2) 68 (with GNAL_qr40F)

aNumbers contained within QRT-PCR primer names refer to universal probe numbers for the Roche LightCycler® 480 System. bSome primer pairs used for HRM were also used for Sanger sequencing.

7

Supplementary Table S8. Clinical features and UPSIT scores from families A, B, C and D

Sample ID Age at Test

Sex Clinical Status GNAL mutation (Amino acid change)

UPSIT Score

Interpretation

A-II-03 80 F Affected c.682G>T (p.V228F) 15 Anosmia A-III-05 55 F Affected c.682G>T (p.V228F) 27 Moderate microsmia A-III-08 49 M Affected c.682G>T (p.V228F) 25 Severe microsmia A-IV-05 40 F Unaffected None 33 Mild microsmia A-IV-06 38 M Unaffected c.682G>T (p.V228F) 20 Severe microsmia A-IV-07 37 M Unaffected c.682G>T (p.V228F) 34 Normosmia A-IV-09 34 M Unaffected c.682G>T (p.V228F) 32 Mild microsmia A-IV-10 34 F Unaffected None 34 Mild microsmia A-IV-11 32 F Unaffected None 36 Normosmia A-V-01 25 F Unaffected None 29 Moderate microsmia A-V-04 20 F Unaffected None 33 Mild microsmia B-III-02 56 F Affected c.591dupA (p.R198Tfs*13) 36 Normosmia B-III-04 54 F Probable c.591dupA (p.R198Tfs*13) 35 Normosmia B-III-06 51 F Unaffected c.591dupA (p.R198Tfs*13) 37 Normosmia B-III-08 46 F Affected c.591dupA (p.R198Tfs*13) 40 Normosmia B-IV-01 30 F Unaffected c.591dupA (p.R198Tfs*13) 36 Normosmia B-IV-02 28 F Unaffected None 37 Normosmia B-IV-03 28 F Unaffected c.591dupA (p.R198Tfs*13) 39 Normosmia B-IV-04 29 F Unaffected c.591dupA (p.R198Tfs*13) 40 Normosmia B-IV-05 28 M Unaffected None 34 Normosmia B-IV-06 20 F Unaffected c.591dupA (p.R198Tfs*13) 37 Normosmia B-IV-07 21 F Unaffected c.591dupA (p.R198Tfs*13) 36 Normosmia B-IV-08 13 M Unaffected c.591dupA (p.R198Tfs*13) 25 Moderate microsmia B-IV-09 9 F Unaffected c.591dupA (p.R198Tfs*13) 30 Normosmia C-II-05 55 F Affected c.733C>T (p.R245*) 30 Moderate microsmia C-III-02 33 F Unaffected None 38 Normosmia C-III-03 25 F Unaffected None 39 Normosmia C-IV-01 8 M Unaffected None 39 Normosmia D-II-02 55 F Affected c.3G>A (p.M1_Q61del 38 Normosmia D-II-03 52 F Unaffected None 33 Mild microsmia D-III-01 25 F Unaffected c.3G>A (p.M1_Q61del 36 Normosmia D-III-02 22 M Unaffected c.3G>A (p.M1_Q61del 36 Normosmia

8

Supplementary Table S9. Normalized relative quantitative RT-PCR for analysis of GNAL expression in brain and leukocytes

Tissue All Isoforms

a Isoform 2/Isoform 1

b

Primer pair 1 Primer pair 2 Isoform 1b Isoform 2

Isoform 2/Isoform 1

Adult whole brain

1 1 1 5.55 5.55

Striatum

2.44 1.93 1.25 13.28 10.60

Substantia nigra

2.13 1.78 3.11 3.17 1.02

Cerebral cortex

1.98 1.93 1.85 12.25 6.64

Cerebellum

1.22 1.07 2.09 2.29 1.07

Fetal whole brain

7.74 7.07 14.98 19.06 1.27

Leukocyte (controls, N = 8)

0.03 ± 0.01 0.02 ± 0.01 0 0.16 ± 0.03 NA

Leukocytes (Subject B-III-2, c.591dupA)

0.02 0.01 0 0.08 NA

Leukocytes (Subjects D-II-2 and D-II-4, c.3G>A)

0.03 0.02 0 0.18 NA

aValues are referenced to adult whole brain. bValues are referenced to Isoform 1 of adult whole brain.

Supplementary Table S10. Antibodies for immunocytochemistry

Antigen Host Type Dilution Source

Gα(olf)

rabbit polyclonal 1:100 Novus Biologicals, Littleton, CO, USA

rabbit IgG

goat biotinylated polyclonal 1:500 Vector Laboratories, Burlingame, CA, USA

calbindin D-28K

mouse monoclonal 1:1000 Sigma-Aldrich, St. Louis, MO, USA

tyrosine hydroxylase (TH)

mouse monoclonal 1:1000 Millipore, Billerica, MA, USA

choline acetyltransferase (ChAT)

goat polyclonal 1:50 Millipore

rabbit IgG donkey polyclonal 1:250 Jackson ImmunoResearch, West Grove, PA, USA

mouse IgG donkey rhodamine red-X (RRX)-tagged polyclonal

1:250 Jackson ImmunoResearch, West Grove, PA, USA

CRH-RI/II

goat polyclonal 1:100 Santa Cruz, Santa Cruz, CA, USA

calcium-transporting plasma membrane ATPase 4 (PMCA4)

mouse monoclonal 1:100 Thermo Fisher Scientific, Rockford, IL, USA

mouse IgG

donkey Cy2-tagged polyclonal 1:250 Jackson ImmunoResearch

goat IgG donkey RRX-tagged polyclonal

1:250 Jackson ImmunoResearch

rabbit IgG donkey Cy5-tagged polyclonal 1:250 Jackson ImmunoResearch

9

Supplementary Table S11. Genes significantly Up-regulated in affected subjects from

family A

Gene Symbol Gene Name and Description Fold Change (FC≥1.5; p≤0.05)

IFITM3 Interferon Induced Transmembrane Protein 3 (1-8U) (Ifitm3), mrna. 6.17

F13A1 Coagulation Factor Xiii, A1 Polypeptide (F13A1), mrna. 5.56

IL17RB Interleukin 17 Receptor B (Il17Rb), mrna. 5.00

CCDC151 Coiled-Coil Domain Containing 151 (Ccdc151), mrna. 3.99

DBNDD1 Dysbindin (Dystrobrevin Binding Protein 1) Domain Containing 1 (Dbndd1), Transcript Variant 1, mrna.

3.83

CHDH Choline Dehydrogenase (Chdh), mrna. 3.33

ACTN1 Actinin, Alpha 1 (Actn1), mrna. 3.08

P2RY5 Purinergic Receptor P2Y, G-Protein Coupled, 5 (P2Ry5), mrna. 2.92

MSX1 Msh Homeobox 1 (Msx1), mrna. 2.76

STARD13 Start Domain Containing 13 (Stard13), Transcript Variant Delta, mrna. 2.62

MFF Mitochondrial Fission Factor (Mff), Nuclear Gene Encoding Mitochondrial Protein, mrna.

2.58

IFIT2 Interferon-Induced Protein With Tetratricopeptide Repeats 2 (Ifit2), mrna. 2.46

TSC22D1 Tsc22 Domain Family, Member 1 (Tsc22D1), Transcript Variant 2, mrna. 2.36

AKAP7 A Kinase (Prka) Anchor Protein 7 (Akap7), Transcript Variant Alpha, mrna.

2.22

STARD13 Start Domain Containing 13 (Stard13), Transcript Variant Alpha, mrna. 2.19

FXYD2 Fxyd Domain Containing Ion Transport Regulator 2 (Fxyd2), Transcript Variant A, mrna.

2.15

FHL3 Four And A Half Lim Domains 3 (Fhl3), mrna. 2.13

GALNTL4 Udp-N-Acetyl-Alpha-D-Galactosamine:Polypeptide N-Acetylgalactosaminyltransferase-Like 4 (Galntl4), mrna.

2.13

CLIP3 Cap-Gly Domain Containing Linker Protein 3 (Clip3), mrna. 2.10

CXCL10 Chemokine (C-X-C Motif) Ligand 10 (Cxcl10), mrna. 2.10

RENBP Renin Binding Protein (Renbp), mrna. 2.08

F12 Coagulation Factor Xii (Hageman Factor) (F12), mrna. 2.06

C22orf34 Chromosome 22 Open Reading Frame 34 (C22Orf34), mrna. 2.02

BEND4 Ben Domain Containing 4 (Bend4), mrna. 2.01

10

……..Continued


IFI6 Interferon, Alpha-Inducible Protein 6 (Ifi6), Transcript Variant 3, mrna. 1.99

OXTR Oxytocin Receptor (Oxtr), mrna. 1.91

ATF3 Activating Transcription Factor 3 (Atf3), Transcript Variant 4, mrna. 1.89

ENG Endoglin (Osler-Rendu-Weber Syndrome 1) (Eng), mrna. 1.88

FZD3 Frizzled Homolog 3 (Drosophila) (Fzd3), mrna. 1.88

EMR2 Egf-Like Module Containing, Mucin-Like, Hormone Receptor-Like 2 (Emr2), Transcript Variant 2, mrna.

1.85

LRP5 Low Density Lipoprotein Receptor-Related Protein 5 (Lrp5), mrna. 1.83

S100A9 S100 Calcium Binding Protein A9 (Calgranulin B) (S100A9), mrna. 1.82

LIN7A Lin-7 Homolog A (C. Elegans) (Lin7A), mrna. 1.81

SLC2A8 Solute Carrier Family 2 (Facilitated Glucose Transporter), Member 8 (Slc2A8), mrna.

1.80

MLLT11 Myeloid/Lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila); Translocated To, 11 (Mllt11), mrna.

1.80

ATHL1 Ath1, Acid Trehalase-Like 1 (Yeast) (Athl1), mrna. 1.79

TJP2 Tight Junction Protein 2 (Zona Occludens 2) (Tjp2), Transcript Variant 2, mrna.

1.77

ACCS 1-Aminocyclopropane-1-Carboxylate Synthase Homolog (Arabidopsis)(Non-Functional) (Accs), Transcript Variant 1, mrna.

1.76

CCDC4 Coiled-Coil Domain Containing 4 (Ccdc4), mrna. 1.73

TJP2 Tight Junction Protein 2 (Zona Occludens 2) (Tjp2), Transcript Variant 2, mrna.

1.73

TCF2 Transcription Factor 2, Hepatic; Lf-B3; Variant Hepatic Nuclear Factor (Tcf2), Transcript Variant A, mrna.

1.73

SFMBT2 Scm-Like With Four Mbt Domains 2 (Sfmbt2), mrna. 1.72

KLHL3 Kelch-Like 3 (Drosophila) (Klhl3), mrna. 1.72

DMD Dystrophin (Muscular Dystrophy, Duchenne And Becker Types) (Dmd), Transcript Variant Dp40, mrna.

1.69

LOC440345 Predicted: Hypothetical Protein Loc440345, Transcript Variant 6 (Loc440345), mrna.

1.69

NFIC Nuclear Factor I/C (Ccaat-Binding Transcription Factor) (Nfic), Transcript Variant 2, mrna.

1.68

Cdna Flj34428 Fis, Clone Hlung2000761 1.68

SAT1 Spermidine/Spermine N1-Acetyltransferase 1 (Sat1), mrna. 1.66

11

….Continued


TSC22D1 Tsc22 Domain Family, Member 1 (Tsc22D1), Transcript Variant 2, mrna. 1.66

TPST1 Tyrosylprotein Sulfotransferase 1 (Tpst1), mrna. 1.63

DLK2 Delta-Like 2 Homolog (Drosophila) (Dlk2), Transcript Variant 2, mrna. 1.61

PDE6G Phosphodiesterase 6G, Cgmp-Specific, Rod, Gamma (Pde6G), mrna. 1.61

LOC401321 Predicted: Hypothetical Loc401321 (Loc401321), mrna. 1.61

KRTAP17-1 Keratin Associated Protein 17-1 (Krtap17-1), mrna. 1.60

PRKCE Protein Kinase C, Epsilon (Prkce), mrna. 1.59

MIR155HG Mir155 Host Gene (Non-Protein Coding) (Mir155Hg), Non-Coding Rna. 1.59

LRRC1 Leucine Rich Repeat Containing 1 (Lrrc1), mrna. 1.59

CSTB Cystatin B (Stefin B) (Cstb), mrna. 1.59

TNFRSF14 Tumor Necrosis Factor Receptor Superfamily, Member 14 (Herpesvirus Entry Mediator) (Tnfrsf14), mrna.

1.59

LASS6 Lag1 Homolog, Ceramide Synthase 6 (Lass6),mrna. 1.58

Cdna Flj26188 Fis, Clone Adg04821 1.58

FAM134B Family With Sequence Similarity 134, Member B (Fam134B), Transcript Variant 1, mrna.

1.58

Av647906 Glc Cdna Clone Glcbdc04 3, mrna Sequence 1.57

RAB9A Rab9A, Member Ras Oncogene Family (Rab9A), mrna. 1.57

FTHL2 Ferritin, Heavy Polypeptide-Like 2 (Fthl2) On Chromosome 1. 1.55

HES1 Hairy And Enhancer Of Split 1, (Drosophila) (Hes1),mrna. 1.54

GGCT Gamma-Glutamyl Cyclotransferase (Ggct), mrna. 1.54

LOC646808 Predicted: Misc_Rna (Loc646808), miscrna. 1.54

C8orf16 Chromosome 8 Open Reading Frame 16 (C8Orf16), mrna. 1.54

LMNA Lamin A/C (Lmna), Transcript Variant 2, mrna. 1.54

TNFAIP2 Tumor Necrosis Factor, Alpha-Induced Protein 2 (Tnfaip2), mrna. 1.54

PLCB2 Phospholipase C, Beta 2 (Plcb2), mrna. 1.54

MGC39900 Predicted: Hypothetical Protein Mgc39900 (Mgc39900), mrna. 1.53

FTHL12 Ferritin, Heavy Polypeptide-Like 12 (Fthl12) On Chromosome 9. 1.53

SYT11 Synaptotagmin Xi (Syt11), mrna. 1.52

NOL12 Nucleolar Protein 12 (Nol12), mrna. 1.52

NT5C3 5'-Nucleotidase, Cytosolic Iii (Nt5C3), Transcript Variant 1, mrna. 1.51

TCF2 Transcription Factor 2, Hepatic; Lf-B3; Variant Hepatic Nuclear Factor (Tcf2), Transcript Variant B, mrna.

1.50

LOC100130598 Predicted: Hypothetical Protein Loc100130598 (Loc100130598), mrna. 1.50

12

Supplementary Table S12. Genes significantly down-regulated in affected subjects from family A


CKLF Chemokine-Like Factor 3.03

HLA-DRB4 Major Histocompatibility Complex, Class Ii, Dr Beta 4; Major Histocompatibility Complex, Class Ii, Dr Beta 1

2.52

TP63 Tumor Protein P63 2.45

IKZF1 Ikaros Family Zinc Finger 1 (Ikaros) 2.33

FLOT2 Flotillin 2 2.30

SHMT1 Serine Hydroxymethyltransferase 1 (Soluble) 2.28

PABPC3 Poly(A) Binding Protein, Cytoplasmic 3 2.25

TGFBR3 Transforming Growth Factor, Beta Receptor Iii 2.00

SP140 Sp140 Nuclear Body Protein 1.93

CITED2 Cbp/P300-Interacting Transactivator, With Glu/Asp-Rich Carboxy-Terminal Domain, 2

1.77

NTNG1 Netrin G1 1.75

ITGAL Integrin, Alpha L (Antigen Cd11A (P180), Lymphocyte Function-Associated Antigen 1; Alpha Polypeptide)

1.73

TRAF3IP3 Traf3 Interacting Protein 3 1.71

SIK3 Serine/Threonine-Protein Kinase Qsk 1.71

ARPC3 Similar To Actin Related Protein 2/3 Complex Subunit 3; Hypothetical Loc729841; Actin Related Protein 2/3 Complex, Subunit 3, 21Kda

1.67

CLINT1 Clathrin Interactor 1 1.63

EXOC6 Exocyst Complex Component 6 1.58

THOC3 Similar To Tho Complex 3; Tho Complex 3 1.58

CMTM6 Cklf-Like Marvel Transmembrane Domain Containing 6 1.54

MGC42105 Serine/Threonine-Protein Kinase Nim1 1.53

RPPH1 Ribonuclease P Rna Component H1 1.51

13

Supplementary Table S13. Enriched KEGG pathways

Pathway No. of Genes Enrichmenta raw P-value

b adj P-value

c

Up-regulated

Arrhythmogenic right ventricular cardiomyopathy (ACTN1, DMD, LMNA)

3 27.12 2.00E-04 2.00E-03

Wnt signaling pathway (LRP5, PLCB2, FZD3)

3 13.65 1.40E-03 6.00E-03

Tight junction (TJP2, PRKCE, ACTN1) 3 15.38 1.00E-03 6.00E-03

Cytokine-cytokine receptor interaction (IL17RB, TNFRSF14, CXCL10)

3 7.72 7.00E-03 1.50E-02

Dilated cardiomyopathy (DMD1, LMNA) 2 14.93 8.00E-03 1.50E-02

Complement and coagulation cascades (F12, F13A1)

2 19.91 4.60E-03 1.50E-02

Hypertrophic cardiomyopathy (HCM) (DMD, LMNA)

2 16.16 6.90E-03 1.50E-02

Melanogenesis (FZD3, PLCB2) 2 13.47 9.80E-03 1.60E-02

Vascular smooth muscle contraction (PRKCE, PLCB2)

2 11.95 1.23E-02 1.70E-02

Purine metabolism (PDE6G, NT5C3) 2 9.10 2.06E-02 2.60E-02

Calcium signaling pathway (OXTR, PLCB2)

2 7.72 2.79E-02 3.30E-02

Chemokine signaling pathway (CXCL10, PLCB2)

2 7.23 3.14E-02 3.40E-02

Down-regulated

Viral myocarditis (ITGAL, HLA-DRB4) 2 51.76 7.00E-04 2.10E-03

Cell adhesion molecules (CAMs) (ITGAL, HLA-DRB4)

2 28.20 2.30E-03 3.40E-03

Regulation of actin cytoskeleton (ITGAL, ARPC3)

2 17.49 5.80E-03 5.80E-03

aEnrichment relative to number of reference genes in the genome based on the hypergeometric

test. bHypergeometric test based. cBenjamini & Hochberg multiple test correction.

14

Supplementary Table S14. IPA top up-regulated biological functions and canonical

pathways

Top Biological Functions P valuea

No. of Molecules

Molecular and Cellular Functions

Cellular Development

7.40E-04 to 4.36E-02 14

Cellular Growth and Proliferation

7.40E-04 to 4.36E-02

21

Cell Death and Survival 2.14E-03 to 3.95E-02 22

Carbohydrate Metabolism

3.42E-03 to 3.49E-02 8

Cell Cycle 3.42E-03 to 3.86E-02 7

Physiological System Development and Function

Organismal Development

3.49E-04 to 4.60E-02 18

Embryonic Development

5.08E-04 to 4.60E-02 17

Nervous System Development and Function 5.49E-04 to 4.03E-02 8

Organ Development 5.49E-04 to 4.60E-02 16

Tissue Development 5.49E-04 to 4.60E-02 24

Top Canonical Pathways -Log (P-value)b Ratio

c

VDR/RXR Activation 1.44E-04 0.051

Extrinsic Prothrombin Activation Pathway 1.33E-03 0.125

G-Protein Coupled Receptor Signaling 1.65E-03 0.014

Factors Promoting Cardiogenesis in Vertebrates 3.26E-03 0.033

Intrinsic Prothrombin Activation Pathway 4.09E-03 0.061

ID Associated Network Functions Scored

1 Cellular Development 28

2 Cellular Growth and Proliferation, Cellular Development, Immunological Disease 28

3 Cell-To-Cell Signaling and Interaction, Tissue Development, Cellular Development 26

4 Cell Morphology, Cellular Development, Developmental Disorder 2

5 Cell Morphology, Nervous System Development and Function, Tissue Morphology 2

aFischer's exact test was used to calculate a p-value determining the probability that each biological function assigned to that data set is due to chance alone. bFischer's exact test was used to calculate a p-value determining the probability that each canonical pathway assigned to that data set is due to chance alone. cNumber of genes in a pathway that were found in our significant gene list compared to the total number of genes in that pathway. dNetwork score is the negative log of the p-value for the likelihood that network molecules would be found together by chance alone. A higher score indicates a greater statistical significance that molecules depicted in the network are interconnected.

15

Supplementary Table S15. IPA top down-regulated biological functions and canonical

pathways

Top Biological Functions P valuea

No. of Molecules

Molecular and Cellular Functions

Post-Translational Modification 2.11E-04 to 1.19E-02 2

Protein Synthesis 2.11E-04 to 1.19E-02 2

Cellular Growth and Proliferation 2.38E-04 to 4.78E-02 5

Cell Cycle 4.60E-04 to 2.01E-02 2

Cell-To-Cell Signaling and Interaction 4.60E-04 to 4.62E-02 2

Physiological System Development and Function

Embryonic Development 1.20E-05 to 4.47E-02 4

Tissue Development 1.20E-05 to 4.47E-02 4

Lymphoid Tissue Structure and Development 1.40E-04 to 4.65E-02 3

Cardiovascular System Development and Function 4.60E-04 to 4.05E-02 3

Digestive System Development and Function 4.60E-04 to 4.34E-02 4

Top Canonical Pathways -Log (P-value)b Ratio

c

Folate Polyglutamylation 2.3E-03 0.20

dTMP De Novo Biosynthesis 2.76E-03 0.16

Folate Transformations I 4.13E-03 0.11

Glycine Betaine Degradation 4.59E-03 0.10

Antigen Presentation Pathway 1.69E-02 0.02

ID Associated Network Functions Scored

1 Cell Cycle, Cell-To-Cell Signaling and Interaction, Cellular Growth and Proliferation 9

2 Cardiovascular System Development and Function, Organ Morphology, Organismal Injury and Abnormalities

3

3 Cell Cycle, Developmental Disorder, Immunological Disease 3

4 Antimicrobial Response, Cell-To-Cell Signaling and Interaction, Inflammatory Response

3

5 Cell Morphology, Cellular Assembly and Organization, Cellular Development 2

aFischer's exact test was used to calculate a p-value determining the probability that each biological function assigned to that data set is due to chance alone. bFischer's exact test was used to calculate a p-value determining the probability that each canonical pathway assigned to that data set is due to chance alone. cNumber of genes in a pathway that were found in our significant gene list compared to the total number of genes in that pathway. dNetwork score is the negative log of the p-value for the likelihood that network molecules would be found together by chance alone. A higher score indicates a greater statistical significance that molecules depicted in the network are interconnected.

supplementary materiallup.lub.lu.se/search/ws/files/2522147/3694098.pdf · 1 supplementary material...

Documents