supplemental information the hippo transducer yap1 ... · activated satellite cells and is a potent...

23
Cancer Cell, Volume 26 Supplemental Information The Hippo Transducer YAP1 Transforms Activated Satellite Cells and Is a Potent Effector of Embryonal Rhabdomyosarcoma Formation Annie M. Tremblay, Edoardo Missiaglia, Giorgio G. Galli, Simone Hettmer, Roby Urcia, Matteo Carrara, Robert N. Judson, Khin Thway, Gema Nadal, Joanna L. Selfe, Graeme Murray, Raffaele A. Calogero, Cosimo De Bari, Peter S. Zammit, Mauro Delorenzi, Amy J. Wagers, Janet Shipley, Henning Wackerhage, and Fernando D. Camargo

Upload: vonguyet

Post on 10-Jun-2018

218 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

Cancer Cell, Volume 26

Supplemental Information

The Hippo Transducer YAP1 Transforms

Activated Satellite Cells and Is a Potent Effector

of Embryonal Rhabdomyosarcoma Formation

Annie M. Tremblay, Edoardo Missiaglia, Giorgio G. Galli, Simone Hettmer, Roby Urcia, Matteo Carrara, Robert N. Judson, Khin Thway, Gema Nadal, Joanna L. Selfe, Graeme Murray, Raffaele A. Calogero, Cosimo De Bari, Peter S. Zammit, Mauro Delorenzi, Amy J. Wagers, Janet Shipley, Henning Wackerhage, and Fernando D. Camargo

Page 2: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

1

SUPPLEMENTAL DATA

Page 3: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

2

Figure S1, related to Figure 2. (A) Images showing the hindlimbs flexibility from control (left) and induced Myf5Cre-hYAP1 S127A mice (right). (B) x-ray imaging showing excised limbs from control (left) and induced Myf5Cre-hYAP1 S127A mice (right). (C-D) Cross-section of the brown fat pads of adult control (C) and induced Myf5Cre-hYAP1 S127A mice (D) stained by H&E. Scale bars, 50 μm. (E) Diagram of the allograft transplantation studies with Myf5Cre-hYAP1 S127A donors. (F-I) Cross-section of the allografts tumors from (E), stained by H&E (F) and immunostained for YAP1 (G), Desmin (H) and Myogenin (I). Scale bars, 50 μm. (J) Diagram of the secondary transplantation experiments. (K) Relative latency per number of cells transplanted. (n=2/dilution) (L-M) Primary tumors of the TA in Myod1-hYAP1 S127A mice after 4 weeks of DOX induction. (N-O) Images of tumors in (M), stained by H&E. Scale bars, 200 µm (N) and 100 um (O). Yellow arrowheads mark centrally located nuclei. (P) Diagram of the allograft transplantation studies with Myod1-iCre-hYAP1 S127A donors. (Q-) Cross-section of the allografts tumors from (P), stained by H&E (Q) and immunostained for YAP1 (R), Desmin (S) and Myogenin (T). Scale bars, 50 μm (Q, R) and 100 μm (S, T). (U) C2C12 myoblasts infected with a hYAP1 S127A retroviral expression virus or control virus, grown in soft agar. Quantification was performed after 15 days in culture. n=4, p <0.001. Scale bar, 500 μm.

Page 4: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

3

Figure S2, related to Figure 3. (A) As in (Fig 3C), immunostained for PAX7. (B) Quantification of PAX7 immunostaining as in (A). Results are presented as fold change of the percentage of PAX7+ nuclei/total nuclei/10X field of view (FOV) +/- SD. (6 FOV/condition analyzed, total of counted nuclei are 870 for control and 920 for Pax7-YAP1 S127A mice). (C-G) As in (Fig 3D), immunostained for YAP1 (C), PCNA (D), Desmin (E), Myogenin (F) and PAX7 (G). All scale bars, 100 μm

Page 5: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

4

Figure S3, related to Figure 4. (A-B) Diagram of the ZsGreen1-traced YAP1 -ERMS tumor cells generation and culture (A) and the resulting tumors following transplantation/regression of ZsGreen+ YAP1 -ERMS cells (B). Dashed line circumscribes the tumor location. Scale bars, 1 cm. (C) EdU incorporation in cultured ZsGreen1-traced tumor cells in the presence and absence of DOX. (n=3). Scale bars, 50 μm. (D) Quantification of EdU incorporation as in (C) (presented as mean +/- SEM). (E) Immunofluorescence staining for MyHC in differentiated ZsGreen1-traced tumor cells in the presence and absence of DOX (n=3). Scale bars, 50 μm.

Page 6: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

5

Figure S4, related to Figure 5. (A) Fold Change of hYAP1, Cyr61, Myf5, Pax7, Myod1 and Myh4 mRNA levels by qPCR in control muscle and during tumor regression after DOX withdrawal for 0 (TUM), 3 (OFF3) and 6 days (OFF6) (n=3; Fold change +/- SEM). (B) Diagram from Ingenuity Pathway Analysis (IPA) of the 249 downregulated genes in the YAP1 -ERMS tumors versus control muscle. Table S1, related to Figure 5. Provided as an Excel file.

Page 7: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

6

Page 8: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

7

Page 9: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

8

Figure S5, related to Figure 6. (A) Enrichment of Myogenin, MEF2 and SRF binding sites within the TEAD1 peaks identified by ChIP-Seq in YAP1 -ERMS cells. Analysis from GREAT annotation. (B) Heat map of the TEAD1-bound sites in YAP1 -ERMS clustered according to the presence of shared loci with MYOD1, Myogenin and SRF in C2C12 myotubes. (C) Gene ontology analysis of the shared TEAD1/MYOD1/Myogenin/SRF binding sites. (D) Distribution of the expression change of genes from the Malignant Muscle Neoplasm and the Muscle Contraction categories in (C). (E) Gene ontology analysis of the TEAD1 only sites. (F) Heat map of the TEAD1-bound sites in YAP1 -ERMS clustered according to the presence of shared loci with MYOD1 and Myogenin in C2C12 myoblasts and myotubes. (G-J) Target genes validated by ChIP-qPCR for YAP1 (G), TEAD1 (H), MEF2 (I) and MYOD1 (J) occupancy in RD cells. Fold enrichment over IgG normalized to 1 (red line) +/- SD. Negative region is -8.3 kb upstream of CTGF TSS. (K) Heat map showing expression of YAP1 /TEAD1 validated target genes in RD cells versus skeletal muscle control (SKM). (L) Heat map showing expression of YAP1 /TEAD1 validated target genes in human ERMS tumors versus skeletal muscle control (SKM). (M-O) Expression score of the YAP1 gene (M), YAP1-ERMS-activated signature (N) and YAP1-ERMS-repressed signature (O) expression scores in human fetal myoblasts undergoing differentiation (public dataset GSE3780).

Page 10: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

9

Figure S6, related to figure 7. (A-B) Radar plot showing the level of enrichment for YAP1-ERMS-activated signature and other relevant signal transduction pathways in human RMS versus skeletal muscle (A) and in ERMS versus ARMSp (B). The - log10 of the p value of the hypergeometric test for each signature was reported in a radar plot (p value cupped at 0.0001). Grey area represents p values below significance after Bonferroni correction.

Page 11: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

10

Table S2, related to Figure 7. Provided as an Excel file. Sonic hedgehog homolog (SHH) signature: Shi et al., 2010 Embryonic Stem Cell (ES) signature: Ben-Porath et al., 2008. Activated satellite cells (Satell−act.) signature: Pallafachina et al., 2010. β-Catenin signature: Bild et al., 2006. ERBB2 signature: Mackay et al., 2003. MYC signature: Bild et al., 2006. NOTCH signature: Mazzone et al., 2010. RAS signature: Bild et al., 2006. SRC signature: Bild et al., 2006. TGF-β signature: Padua et al., 2008. STAT3 signature: Alvarez et al., 2005. WNT signature: Biocarta (http://www.broadinstitute.org/gsea/msigdb/cards/BIOCARTA_WNT_PATHWAY). Table S3, related to Figure 7.

Variables Coefficients CI 95% p Value (Intercept) -0.18 (-0.58 / 0.22) 0.374 Histology (baseline: Fusion Negative RMS)

Fusion Positive -0.49 (-0.76 / -0.21) 0.001 Tumor stage (baseline: Stage 1)

2 0.08 (-0.46 / 0.62) 0.778 3 0.59 (0.11 / 1.07) 0.016 4 0.64 (0.15 / 1.14) 0.012

Unknown -0.04 (-0.71 / 0.62) 0.901 Dataset 0.09 (-0.18 / 0.36) 0.519 Patient Age (baseline: Favorable)*

Unfavorable 0.11 (-0.15 / 0.38) 0.403 Unknown 0.88 (-0.02 / 1.78) 0.056

Tumor location (baseline: Favorable)*

Unfavorable -0.24 (-0.58 / 0.1) 0.169 Unknown 0.4 (-0.3 / 1.11) 0.266

Multivariable linear regression modeling the relationship between YAP1 -ERMS_activated score and other clinico-pathological variables such as fusion status, tumor stage, patient age and tumor location. * These variables were categorized as previously reported (Missiaglia et al, 2012). Model F-statistic: 3.395 on 10 and 223 DF, p = 0.00038.

Page 12: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

11

SUPPLEMENTAL EXPERIMENTAL PROCEDURES Histology, immunohistochemistry and immunofluorescence

For generation of formalin-fixed paraffin-embedded sections, tissues were collected, washed in PBS and

fixed in 10% formalin overnight then transferred to 70% ethanol until processing. For frozen sections,

tissues were washed in PBS and fixed for 1 hour in 4% paraformaldehyde/PBS at RT followed by an

overnight dehydration step in 20% sucrose/PBS at 4 degrees. Muscles were then frozen in liquid nitrogen-

cooled 2-methylbutane (Sigma), on a drop of OCT. Frozen muscles were kept at -80 until sectioning (10

um). For immunofluorescence stainings, cells were fixed with 4% paraformaldehyde/PBS at RT for 10

minutes and washed 3 times with PBS before staining.

Immunohistochemistry stainings of paraffin embedded tissues were performed using the anti-rabbit

Vectastain ABC-Elite kit (Vector) or the M.O.M kit basic (Vector) according to manufacturer’s

instructions. The following antibodies were used: rabbit anti-YAP1 (Cell Signaling, 4912), mouse anti-

PCNA (Santa Cruz Biotechnology, sc-56), rabbit anti-Caveolin-1 (Cell Signaling, 3267), mouse anti-

Caveolin-3 (BD Transduction, 610420), mouse anti-MYOD1 (Vector Laboratories, VP-M669), mouse

anti-Desmin (Dako, clone D33), mouse anti-Myogenin (DSHB, F5D), mouse anti-Myosin Heavy Chain

(DSHB, MF20), mouse anti-PAX7 (DSHB), mouse anti-human Ki67 (Dako, M7240).

For immunofluorescence stainings, fixed frozen sections or cells, were permeabilized with PBS/0.2%

Triton-X100 for 10 minutes and washed 3 times with PBS. Cells or sections were then blocked for 1 hour

at RT in PBS/10% goat serum, and incubated with primary antibody diluted in blocking solution

overnight. Where applicable, the M.O.M. kit (Vector) was used according to manufacturer’s instructions.

After 3 washes in PBS, appropriate fluorophore-coupled secondary antibodies (Alexa fluor conjugates;

Invitrogen) were applied at a 1:500 (sections) or 1:1000 (cells) dilution in PBS for 1 hour at RT followed

Page 13: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

12

by 3 washes in PBS. Slides were coverslipped over a drop of ProLong gold mounting media with DAPI

(Invitrogen).

RNA Purification, RT-PCR, and Real-Time PCR Total RNA was isolated using TRIzol (Invitrogen) and 400 ng was reverse transcribed using the iScript

cdna synthesis kit (Bio-Rad) according to the manufacturer’s instructions. StepOnePlus™ Real-Time

PCR System and TaqMan-based Real-Time PCR gene expression assays (Applied Biosystems) were used.

Taqman assays for mouse and human YAP1 (Mm00494240_m1, Hs00902712_g1), MyH4

(Mm01332518_m1), Myf5 (Mm00435125_m1), Myod1 (Mm00440387_m1), Pax7 (Mm01354484_m1),

Cyr61 (Mm01323719_g1) were multiplexed with Gapdh or 18S control assays (Applied Biosystems).

Western Blotting

For immunoblotting analysis, cells were lysed in ice-cold RIPA lysis buffer (Boston Bioproducts)

containing proteases and phosphatases inhibitors (Roche). Muscle tissue and tumor samples were

homogenized with a polytron (Ultra turrax, IKA) in ice-cold RIPA lysis buffer (Boston Bioproducts)

containing proteases and phosphatases inhibitors (Roche). Protein concentration was measured using

Bradford Ultra (Expedeon). Equal amount of proteins were resolved on 10% NuPage Novex bis-tris gels

(Invitrogen) using MOPS SDS running buffer (Invitrogen) and then transferred on PVDF membranes

using iBlot gel transfer device (Invitrogen). After blocking in 5% non-fat dry milk in Tris-buffered saline

pH 7.4 (Boston Bioproducts) containing 0.05% Tween 20 (5% milk/TBST) for 1 hour at RT, the

membranes were incubated with primary antibodies overnight at 4 degrees. After 3 washes in 5%

milk/TBST, appropriate secondary antibodies coupled to HRP were used at 1:10 000 for 1 hour at RT in

5% milk/TBST. The following primary antibodies were used: rabbit anti-YAP1 (Cell Signaling, 4912),

rabbit anti-phospho YAP1 S127A (Cell signaling, 4911), rabbit anti-MYOD1 (Santa Cruz, sc-760), rabbit

Page 14: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

13

anti-MEF2 (Santa Cruz, sc-313), rabbit anti-SNAI2 (Cell Signaling, 9585), mouse anti-TWIST1 (Santa

Cruz, sc-81417), goat anti-MDFIC (Santa Cruz, sc-163066), Gapdh-HRP (Cell Signaling, 3683).

Mouse Gene Expression analysis

Triplicate microarray analyses of tumor samples at Day 0, doxycycline-withdrawn for 3 and 6 days and

uninduced donor mouse control muscle from same genetic background were performed at the Molecular

Genetics Core Facility (Children’s Hospital Boston) on Mouse Gene 1.0 ST Arrays (Affymetrix, Santa

Clara, CA). Microarray analysis was performed using 5 μg of total RNA isolated with TRIzol

(Invitrogen) and purified using RNeasy kit (Qiagen). Data analysis and sample clustering was performed

using the GenePattern software (genepattern.broadinstitute.org). A threshold of 0.05 for adjusted p-value

and a relative fold change of 1.5 were used to generate 3 lists of genes differentially expressed between

the Day0 tumors and the 3 other conditions. Area-proportional Venn diagrams were generated using the

BioVenn online tool (http://www.cmbi.ru.nl/cdd/biovenn/index.php) and the resulting lists were analyzed

with Gene Ontology (GO) and Gene Set Enrichment Analysis (GSEA)

(http://www.broadinstitute.org/gsea/index.jsp) and the FatiGO tool (Babelomics 4

suite, http://babelomics.bioinfo.cipf.es). The networks were generated through the use of IPA (Ingenuity®

Systems, www.ingenuity.com).

Chromatin Immunoprecipitation and Deep sequencing.

Chromatin Immunoprecipitation was performed essentially as previously described (Galli et al., Plos Gen.

2012). Briefly, RD cells or cells derived from YAP-driven tumors under Myf5-Cre or Pax7-CreER cells

were cross-linked in 1% formaldehyde for 10 minutes at room temperature after which the reaction was

stopped by addition of 0.125M glycine. Cells were lysed and harvested in ChIP buffer (100 mM Tris at

pH 8.6, 0.3% SDS, 1.7% Triton X-100, and 5 mM EDTA) and the chromatin disrupted by sonication

using a Diagenode Bioruptor sonicator UCD-200 to obtain fragments of average 200-500 bp in size.

Suitable amounts of chromatin were incubated with specific antibodies overnight. Antibodies used were

Page 15: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

14

IgG (Sigma, I8140), YAP1 (a kind gift of Joseph Avruch, MGH, Boston), TEAD1 (BD, 610922), MEF2

(Santa Cruz, sc-313), MYOD1 (Santa Cruz, sc-760). Immunoprecipitated complexes were recovered on

Protein-A/G agarose beads (Pierce) or Protein G Dynabeads (Invitrogen) and, after extensive washes,

DNA was recovered by reverse crosslinking and purification using QIAquick PCR purification kit

(Qiagen).

ChIP-seq libraries were built using the NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, E7370)

according to manufacturer’s recommendation. Libraries for each cell lines were barcoded using NEBNext

multiplex oligos for Illumina (NEB, E7335) and run on a single lane of HiSeq2000 (Illumina) at the

Center for Cancer Computational Biology at Dana Farber Cancer Institute.

ChIP-seq data analyses

ChIP-seq data were mapped over the mouse reference genome (mm9) or the human reference genome

(hg19) using Bowtie2 software (Langmead et al, 2009) keeping only the first best alignment. Aligned data

were filtered to keep only alignments without sequencing errors, with a single unique mapping position

and with no more than one mismatch. Peak segmentation was done using MACS version 1.3.7.1 (Zhang

et al. 2008) using as background the IgG or input data (parameters: p-value <10E-8, bw=250, mfold=5).

Peaks were mapped with respect to the closest transcriptional unit using GREAT (McLean et al, 2010).

K-Means clustering and heatmap generations were performed using Seqminer (Ye et al, 2011).

Human RMS gene expression analysis

Direct comparison between different groups was performed using a robust model-fitting algorithm,

adjusting standard errors estimates by an Empirical Bayesian approach. P-values were adjusted for

multiple testing using the Benjamini-Hochberg procedure. The overrepresentation of specific gene

signatures in the genes found differentially expressed between RMS and skeletal muscle was evaluated by

hypergeometric test and p value adjusted by Bonferroni correction. The gene signatures used in the

Page 16: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

15

analysis are reported in supplementary methods. Cox regression Wald test was used to estimate hazard

ratios and assess differences in survival. All analysis were performed using R software (2.15.2)3 .

We collected the expression profile of normal skeletal muscle and fetal myoblasts at different stage of

differentiation from the GEO public resource (http://www.ncbi.nlm.nih.gov/geo/) and the accession

numbers are listed below. After normalization, each probesets was mapped to a gene using the annotation

provided in Bioconductor packages hgu133plus2.db and hgu133a.db (v2.8.0). Then the number of

features were reduced by selecting, within each dataset, the most variable probeset per gene. Genes were

filtered to remove those which log expression was below 6 in all the analyzed samples. Direct comparison

between normal skeletal muscle and tumor samples was performed employing the ‘limma’ software

(v3.14.1 - Smyth, G. K., 2005), using a linear model fitting algorithm. Genes showing p-values, adjusted

using the Benjiamini-Hochberg procedure, lower than 0.05 and with an absolute fold-change above 1.5

were considered differentially expressed.

Human-Mouse comparisons

HomoloGene database (http://www.ncbi.nlm.nih.gov/homologene) was used to identify human

homologues genes for the mouse gene signatures. The YAP1 -ERMS signature scores were computed for

each samples by taking the median expression of the genes included in the signatures. Scores were

standardized within each datasets and merged to perform a multivariate regression analysis. The

regression model included tumor stage, histology, age, tumor location and dataset origin.

Signature enrichment analyses

Hypergeometric test was used to assess if the genes found differentially expressed by direct comparison

were enriched in genes associated to specific signatures. P-value was adjusted by Bonferroni correction.

These gene signatures were either obtained from the literature or from the analysis of the gene expression

profile of the mouse model and their details are listed in Table S2, provided as an Excel file.

Page 17: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

16

Multivariate clinicopathological analyses

For each sample, we computed a YAP1 -ERMS_activated signature score and DOWN by taking the

median expression of the genes included in each of the signature. Scores were standardized within each

datasets by subtracting the mean signature score divided by its standard deviation. After standardization,

the signature scores from the two datasets were showing similar distribution and were merged to perform

a multivariate regression analysis. The regression model included tumor stage (1, 2, 3 and 4) histology

(ERMS, ARMS_Neg, ARMS_Pax3 and ARMS_Pax7), age (Favorable, Unfavorable), tumor location

(Favorable, Unfavorable) and dataset of origin. The association between stage and YAP1 -

ERMS_activated score level was assess by the Spearman's rank correlation coefficient. Significance was

determined by permutation test by performing a 1000 rearrangement of the stage label.

Proliferation and differentiation assays

Cell proliferation of RD cell line stably expressing a Dox-inducible YAP1 shRNA and of dissociated

tumor cells was assessed by EdU (5-ethynyl-2’-deoxyuridine) incorporation using 10 µM of EdU for 2-4

hr in growth media with or without Doxycycline (2 mg/mL). For EdU detection, the Click-iT® EdU kit

(Invitrogen) was used following the manufacturer’s instructions. For differentiation assays, RD cells

expressing a DOX-inducible YAP1 shRNA or dissociated tumor cells were plated at near confluency in

DMEM supplemented with 10% FBS, pen/strep and glutamine in the presence or absence of doxycycline

(2 mg/mL) for 3 days before changing the media to differentiation-permissive conditions (DMEM, 2%

FBS, pen/strep, glutamine) for an additional 3 days, with continued presence or absence of doxycycline (2

mg/mL).

Soft agar assays

RD cells infected with an inducible Yap-TRIPz shRNA lentivirus (2.5 X 102, 5 X 102, and 10 X 102) were

seeded to top layer of 1.5 ml of growth medium with 0.4% agar and layered onto 2 ml of 0.6% agar base

Page 18: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

17

in six-well plates. Cells were fed with 1.5 ml of appropriate medium every 3-4 days for 4 weeks, and

colony growth were imaged weekly. Doxycycline was replenished every other day. At the end of 4

weeks, colonies on each well were stained with 0.01% crystal violet and >100 um in size were counted.

Human ChIP primer sequences

Gene name sequence chip_h_ankrd1_fwd ACTCAGAGGCAGGTGAATTTTC chip_h_ankrd1_rev GCCCTCTCACATTTCTTCCTGA chip_h_ccnd1_fwd AGTACAACCCGCCTTATTACGT chip_h_ccnd1_rev CTTAACTCGAGCACCAGTCCAG chip_h_cdc6_fwd TGGTCAAGGTGGCTTTCTGTTA chip_h_cdc6_rev ttttGCGTGTGGTTTTGATGGT chip_h_cyr61_fwd GCCGGTGATTAGGTAAACATGC chip_h_cyr61_rev ACCTTTGACCTTCTGAATAGCCA chip_h_hhat_1_fwd GGCATAATTAGGGAGTGGGCTA chip_h_hhat_1_rev GGAGTGGAGCTGACTGTATGAG chip_h_mef2c_fwd AGGAATCACTTGTGGTCTGCAT chip_h_mef2c_rev TCTGGTCTCCTTCCGTCTTGTA chip_h_mef2d_fwd ACCACAGTTCCAACCAATCTCA chip_h_mef2d_rev CACTGAGCTCTTCCCTCCTTTC chip_h_myc_fwd AGGACAGATGCCAACTTCCTTC chip_h_myc_rev ATAGGTTGCACAATGGCAGAGA chip_h_myod1_fwd GAGGCCAGGACAAGATTGATGA chip_h_myod1_rev GGGAAGCAGGCAGGACTAATTA chip_h_myog_fwd ATGACCCTCCCTACATTCTCCT chip_h_myog_rev CCACGTGACTTTCTATCCCAGA chip_h_rras2_fwd GTCCACAAATGCCAAACTCACA chip_h_rras2_rev GCTATTCTCTCCGGCTGAATCA chip_h_tnnc1_fwd AGGTGCAGAGAGAGTGGAGT chip_h_tnnc1_rev TGCAAGGAAGTGGAAGTGTCAG chip_h_tnni1_fwd GTGTAGTGTGACCCCAGAGTCT chip_h_tnni1_rev AGCCAAGCATCTCAGGAATTCA chip_h_tnnt2_fwd GCCAGGAATGTGCTCTGAAATT chip_h_tnnt2_rev GGAGTGGTAGAGAAAGATTCCCT chip_h_cabin1_fwd AGTGGGATGCCAGTGTTTGTAT chip_h_cabin1_rev ATGTTAAACAGCGAGCTCCTGA chip_h_mdfic_fwd GCAAGATAAAGAACGGCCACAC chip_h_mdfic_rev AGGTGCTGAAAGTTTGCGATTA

Page 19: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

18

chip_h_myh4_fwd AGTACTCCGTTGTGAGGATGTAC chip_h_myh4_rev ACACCTACCTCTTGATCCAACA chip_h_myl1_fwd AGCCATTCAAGCAAGGTAGTCT chip_h_myl1_rev ACCCACAAAGCCAAGGAATCTA chip_h_mamstr_fwd ATTAGCGCCCCTGAGTCTTAAC chip_h_mamstr_rev GAGTTTTCGGGAAGTAGCGGAT chip_h_myl12b_fwd TCAACATTACATGAGACGAACCCT chip_h_myl12b_rev TGAGTTGCCAGATGTAGCAAG chip_h_ctgf_-8.3_fwd GGCAGACGGCAGATGCATAAC chip_h_ctgf_-8.3_rev TCACTGCACCTTTGCTTTTCTA

Mouse ChIP primer sequences

Gene Name Sequence chip_m_ankrd1_fwd AACTGGACTTATCAGCACTCCA chip_m_ankrd1_rev CTGCAGACATCACTCCAGAGAA chip_m_cabin1_fwd ACTGAGAAGCATAGCCAACCAA chip_m_cabin1_rev AGTGAGCTAGTGAGGCATTGTG chip_m_cyr61_fwd GAAGGCAAGGAACAGGGTAGAA chip_m_cyr61_rev TGTTACGTCTGGTGTCTGATTCA chip_m_hspb2_fwd CAGACACCTAGTTCTGCTCTCC chip_m_hspb2_rev GGGAATTGAGCCAGCAACTATC chip_m_mdfic_2_fwd TCCATCACAGCCACATCAAGAA chip_m_mdfic_2_rev CAGACAGACAGCTTCATGGACT chip_m_mef2d_fwd AGACCTCTCCCAAGACGTTTTC chip_m_mef2d_rev GCCCTCTTTAGACCTGGAATGT chip_m_myl4_fwd TGAAGTGAGGCCTTGTAAGCTT chip_m_myl4_rev CACTGCTACCCTGAGTCTGTTT chip_m_myod1_fwd GAGGAACAGGGATGGGTTGTC chip_m_myod1_rev CTGGCCTCTCTCTAACCCAAG chip_m_myog_fwd CATTCTGGGAAGGGGTTACTGT chip_m_myog_rev CCACTCCCCAAACTGCTTCTAT chip_m_myom2_fwd CCAGCAGATCCCTTCATTTCCT chip_m_myom2_rev CGTAGCTCAGCACTTTGGAATG chip_m_snai2_fwd ACAAATGTCTGGCTCCTAGTGT chip_m_snai2_rev CACACGGCCAGATCCAATTTAG chip_m_tnnc2_fwd GAATGATGGCAGACTGGGTGTA chip_m_tnnc2_rev CCTGGCTACTTTGGAACTCACT chip_m_twist1_fwd CCCACACCTCTGCATTCTGATA chip_m_twist1_rev AGACCTCTTGAGAATGCATGCA

Page 20: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

19

GEO datasets used (HGU133a platform)

Source Name Tissue ID GEO_Series GSE3780GSM86678 Fetal Myoblasts_0h GSM86678.CEL GSE3780 GSE3780GSM86680 Fetal Myoblasts_0h GSM86680.CEL GSE3780 GSE3780GSM86682 Fetal Myoblasts_0h GSM86682.CEL GSE3780 GSE3780GSM86684 Fetal Myoblasts_6h GSM86684.CEL GSE3780 GSE3780GSM86686 Fetal Myoblasts_6h GSM86686.CEL GSE3780 GSE3780GSM86688 Fetal Myoblasts_6h GSM86688.CEL GSE3780 GSE3780GSM86690 Fetal Myoblasts_12h GSM86690.CEL GSE3780 GSE3780GSM86692 Fetal Myoblasts_12h GSM86692.CEL GSE3780 GSE3780GSM86694 Fetal Myoblasts_12h GSM86694.CEL GSE3780 GSE3780GSM86696 Fetal Myoblasts_18h GSM86696.CEL GSE3780 GSE3780GSM86698 Fetal Myoblasts_18h GSM86698.CEL GSE3780 GSE3780GSM86700 Fetal Myoblasts_18h GSM86700.CEL GSE3780 GSE3780GSM86702 Fetal Myoblasts_24h GSM86702.CEL GSE3780 GSE3780GSM86704 Fetal Myoblasts_24h GSM86704.CEL GSE3780 GSE3780GSM86706 Fetal Myoblasts_24h GSM86706.CEL GSE3780 GSE3780GSM86708 Fetal Myoblasts_36h GSM86708.CEL GSE3780 GSE3780GSM86710 Fetal Myoblasts_36h GSM86710.CEL GSE3780 GSE3780GSM86712 Fetal Myoblasts_36h GSM86712.CEL GSE3780 GSE3780GSM86714 Fetal Myoblasts_48h GSM86714.CEL GSE3780 GSE3780GSM86716 Fetal Myoblasts_48h GSM86716.CEL GSE3780 GSE3780GSM86718 Fetal Myoblasts_48h GSM86718.CEL GSE3780 GSE3780GSM86720 Fetal Myoblasts_3d GSM86720.CEL GSE3780 GSE3780GSM86722 Fetal Myoblasts_3d GSM86722.CEL GSE3780 GSE3780GSM86724 Fetal Myoblasts_3d GSM86724.CEL GSE3780 GSE3780GSM86726 Fetal Myoblasts_4d GSM86726.CEL GSE3780 GSE3780GSM86728 Fetal Myoblasts_4d GSM86728.CEL GSE3780 GSE3780GSM86730 Fetal Myoblasts_4d GSM86730.CEL GSE3780 GSE3780GSM86732 Fetal Myoblasts_7d GSM86732.CEL GSE3780 GSE3780GSM86734 Fetal Myoblasts_7d GSM86734.CEL GSE3780

chip_m_mef2c_fwd GTGGAGCAGTTTAGGGAAGGAA chip_m_mef2c_rev CCCTTCAGCAAATCCCTCCTAG chip_m_mybph_fwd GTGTTGAAGAAGCAAGCCAGAC chip_m_mybph_rev CCCCACTTTCTCTCCAGGAAAT chip_m_tnni1_fwd CAGGCTCTGGTTGACATGAAGA chip_m_tnni1_rev CCCATTGCCCAGGTTCTAAGTA chip_m_tnnt2_fwd AAGCCTGTTCCCTGCATATCTG chip_m_tnnt2_rev GAACAAGTACCCCACGCCATAT chip_m_myh2_fwd CCAGTTTCAAGAAGCATCCACA chip_m_myh2_rev CCTCCCCTTGATTTCTTCCCAA chip_m_mamstr_fwd TGCCGAGTTTGGGGAGATATTT chip_m_mamstr_rev TTGTGTGACAGTGCTCAGTACT chip_m_pou5f1-2kb_fwd GGCAGACGGCAGATGCATAAC chip_m_pou5f1-2kb_rev CTCAATAGCAGATTAAGGAAGGGC

Page 21: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

20

GSE3780GSM86736 Fetal Myoblasts_7d GSM86736.CEL GSE3780 GSM24652 Skeletal Muscle GSM24652.CEL GSE1462 GSM24653 Skeletal Muscle GSM24653.CEL GSE1462 GSM24654 Skeletal Muscle GSM24654.CEL GSE1462 GSE6011GSM139501 Skeletal Muscle GSM139501.CEL GSE6011 GSE6011GSM139502 Skeletal Muscle GSM139502.CEL GSE6011 GSE6011GSM139503 Skeletal Muscle GSM139503.CEL GSE6011 GSE6011GSM139504 Skeletal Muscle GSM139504.CEL GSE6011 GSE6011GSM139505 Skeletal Muscle GSM139505.CEL GSE6011 GSE6011GSM139506 Skeletal Muscle GSM139506.CEL GSE6011 GSE6011GSM139507 Skeletal Muscle GSM139507.CEL GSE6011 GSE6011GSM139508 Skeletal Muscle GSM139508.CEL GSE6011 GSE6011GSM139510 Skeletal Muscle GSM139510.CEL GSE6011 GSE6011GSM139511 Skeletal Muscle GSM139511.CEL GSE6011 GSE6011GSM139512 Skeletal Muscle GSM139512.CEL GSE6011 GSE6011GSM139513 Skeletal Muscle GSM139513.CEL GSE6011 GSE6011GSM139514 Skeletal Muscle GSM139514.CEL GSE6011 GSE3307GSM74408 Skeletal Muscle GSM74408.CEL GSE3307 GSE3307GSM74362 Skeletal Muscle GSM74362.CEL GSE3307 GSE5370GSM74360 Skeletal Muscle GSM74360.CEL GSE3307 GSE5370GSM119937 Skeletal Muscle GSM119937.CEL GSE3307 GSE3307GSM74356 Skeletal Muscle GSM74356.CEL GSE3307 GSE5370GSM119936 Skeletal Muscle GSM119936.CEL GSE3307 GSE3307GSM74357 Skeletal Muscle GSM74357.CEL GSE3307 GSE3307GSM74404 Skeletal Muscle GSM74404.CEL GSE3307 GSE3307GSM74361 Skeletal Muscle GSM74361.CEL GSE3307 GSE3307GSM74363 Skeletal Muscle GSM74363.CEL GSE3307 GSE3307GSM74409 Skeletal Muscle GSM74409.CEL GSE3307 GSE3307GSM74407 Skeletal Muscle GSM74407.CEL GSE3307 GSE5370GSM74359 Skeletal Muscle GSM74359.CEL GSE3307 GSE3307GSM74406 Skeletal Muscle GSM74406.CEL GSE3307 GSE3307GSM74403 Skeletal Muscle GSM74403.CEL GSE3307 GSE3307GSM74358 Skeletal Muscle GSM74358.CEL GSE3307 GSE3307GSM74410 Skeletal Muscle GSM74410.CEL GSE3307 GSE3307GSM74402 Skeletal Muscle GSM74402.CEL GSE3307

GEO datasets used (HGU133plus2 platform)

Source Name Tissue GEO_Series GSM175882.CEL Skeletal Muscle GSE7307 GSM175883.CEL Skeletal Muscle GSE7307 GSM175884.CEL Skeletal Muscle GSE7307 GSM175940.CEL Skeletal Muscle GSE7307 GSM176310.CEL Skeletal Muscle GSE7307 GSM176313.CEL Skeletal Muscle GSE7307 GSM176317.CEL Skeletal Muscle GSE7307 GSM80790.CEL Skeletal Muscle GSE3526

Page 22: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

21

GSM80791.CEL Skeletal Muscle GSE3526 GSM80792.CEL Skeletal Muscle GSE3526 GSM103559.CEL Skeletal Muscle GSE5110 GSM103560.CEL Skeletal Muscle GSE5110 GSM103563.CEL Skeletal Muscle GSE5110 GSM103565.CEL Skeletal Muscle GSE5110 GSM42732.CEL Skeletal Muscle GSE2328 GSM42733.CEL Skeletal Muscle GSE2328 GSM42738.CEL Skeletal Muscle GSE2328 GSM792114.CEL Skeletal Muscle GSE31983 GSM792115.CEL Skeletal Muscle GSE31983 GSM792117.CEL Skeletal Muscle GSE31983 GSM792133.CEL Skeletal Muscle GSE31983 GSM792134.CEL Skeletal Muscle GSE31983 GSM792135.CEL Skeletal Muscle GSE31983 GSM792137.CEL Skeletal Muscle GSE31983 GSM792150.CEL Skeletal Muscle GSE31983 GSM792160.CEL Skeletal Muscle GSE31983 GSM792163.CEL Skeletal Muscle GSE31983 GSM792167.CEL Skeletal Muscle GSE31983 GSM792170.CEL Skeletal Muscle GSE31983 GSM792171.CEL Skeletal Muscle GSE31983 GSM792179.CEL Skeletal Muscle GSE31983 GSM792189.CEL Skeletal Muscle GSE31983 GSM792200.CEL Skeletal Muscle GSE31983 GSM792214.CEL Skeletal Muscle GSE31983 GSM792217.CEL Skeletal Muscle GSE31983 OD_415_U133_2.CEL Skeletal Muscle ITCC/CIT

SUPPLEMENTAL REFERENCES Alvarez JV, Febbo PG, Ramaswamy S, Loda M, Richardson A and Frank DA. (2005) Identification of a genetic signature of activated signal transducer and activator of transcription 3 in human tumors. Cancer Res. 65 , 5054-62 Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A and Weinberg RA. (2008) An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet 40 , 499-507 Bild AH, Yao G, Chang JT, Wang Q, Potti A, Chasse D, Joshi MB, Harpole D, Lancaster JM, Berchuck A, Olson JA Jr, Marks JR, Dressman HK, West M and Nevins JR. (2006) Oncogenic pathway signatures in human cancers as a guide to targeted therapies. Nature 439 , 353-7 Galli GG, Honnens de Lichtenberg K, Carrara M, Hans W, Wuelling M, Mentz B, Multhaupt HA, Fog CK, Jensen KT, Rappsilber J, Vortkamp A, Coulton L, Fuchs H, Gailus-Durner V, Hrabě de Angelis M, Calogero RA, Couchman JR and Lund AH. (2012) Prdm5 regulates collagen gene transcription by association with RNA polymerase II in developing bone. PLoS Genet 8 , e1002711.

Page 23: Supplemental Information The Hippo Transducer YAP1 ... · Activated Satellite Cells and Is a Potent Effector . of Embryonal Rhabdomyosarcoma Formation . Annie M. Tremblay, ... Henning

22

Mackay A, Jones C, Dexter T, Silva RL, Bulmer K, Jones A, Simpson P, Harris RA, Jat PS, Neville AM, Reis LF, Lakhani SR and O'Hare MJ. (2003) cDNA microarray analysis of genes associated with ERBB2 (HER2/neu) overexpression in human mammary luminal epithelial cells. Oncogene 22 , 2680-8 Mazzone M, Selfors LM, Albeck J, Overholtzer M, Sale S, Carroll DL, Pandya D, Lu Y, Mills GB, Aster JC, Artavanis-Tsakonas S and Brugge JS. (2010) Dose-dependent induction of distinct phenotypic responses to Notch pathway activation in mammary epithelial cells. PNAS 107 , 5012-7 McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, Wenger AM, and Bejerano G. (2010) GREAT improves functional interpretation of cis-regulatory regions. Nat Biotechnol 28 , 495-501. Padua D, Zhang XH, Wang Q, Nadal C, Gerald WL, Gomis RR, and Massagué J. (2008) TGFbeta primes breast tumors for lung metastasis seeding through angiopoietin-like 4. Cell 133, 66-77 Shi T, Mazumdar T, Devecchio J, Duan ZH, Agyeman A, Aziz M and Houghton JA. (2010) cDNA microarray gene expression profiling of hedgehog signaling pathway inhibition in human colon cancer cells. PLoS One 5 , pii: e13054 Smyth GK, Michaud J and Scott HS. (2005) Use of within-array replicate spots for assessing differential expression in microarray experiments. Bioinformatics. 21 , 2067-75 Ye T, Krebs AR, Choukrallah MA, Keime C, Plewniak F, Davidson I and Tora L. (2011) seqMINER: an integrated ChIP-seq data interpretation platform. Nucleic Acids Res. 39 , e35 Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W and Liu XS. (2008) Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9 , R137