T. Phung et al. (Supplementary Information)

SUPPLEMENTARY INFORMATION

Supplementary Figure S1. Phosphorylated-Akt staining in human vascular tumors.

Immunohistochemical stains for phospho-Akt (S473) in normal human skin and human vascular

tumors. Representative areas of “low” and “high” levels of staining within a tumor are shown.

Arrows in normal skin indicate immuno-reactive blood vessels. Scale bar, 100 μm.

1

T. Phung et al. (Supplementary Information)

Supplementary Figure S2. Isolation of primary infantile hemangioma endothelial cells, and

effects of Akt1 knockdown on vascular tumor cell apoptosis. (A) Bright field image of purified

hemangioma endothelial cells (EC) cultured in a monolayer on Collagen I-coated plate.

Staining of hemangioma EC with LDL labeled with the fluorescent probe 1,1'-dioctadecyl-

3,3,3',3'-tetramethyl-indocarbocyanine perchlorate (Dil-Ac-LDL). Immunofluorescence stains of

cells for CD31 (green) and VE-Cadherin (green). Nuclei were counterstained with Hoescht dye

(blue). (B-C) Effects of Akt1 knockdown on vascular tumor cell apoptosis. (B) HemeEC and

(C) ASM.5 cells were cultured in serum-free media for 96 hours to induce apoptosis and

assessed by flow cytometry for the apoptosis marker Annexin V. 7-AAD-PerCP marks necrotic

2

T. Phung et al. (Supplementary Information)

cells. Bar graphs show the percentage of apoptotic (Annexin V-positive) cells of the total cells

analyzed. *P<0.01, N=3.

Supplementary Figure S3. Expression levels of Akt1, Akt2 and Akt3 in double transgenic

myrAkt1 mice, and the development of hemangioma in myrAkt1 skin grafts in syngeneic

immunocompetent FVB recipients. (A) Endothelial cells were purified from myrAkt1 mice that

had been treated ± tetracycline to turn on transgene myrAkt1 expression, and cell lysates were

immunoblotted for Akt isoforms and β-actin. (B) Densitometric analysis of the western blots was

performed, and the results were expressed as the ratio of each Akt isoform in EC with myrAkt1

3

T. Phung et al. (Supplementary Information)

on / myrAkt1 off. N=4. (C) Skin from FVB myrAkt1 donor mice was grafted onto the back of

age-matched wild type syngeneic FVB recipients, and expression of endothelial myrAkt1 was

induced 2 weeks after skin engraftment. After 4 weeks of myrAkt1 induction, vascular tumors

developed at the graft sites in recipient animals with “myrAkt1 on” but not in those with “myrAkt1

off.” (D) Dot plot graph of tumor volume in mice with myrAkt1 off and myrAkt1 on. *P<0.01,

N=6.

4

T. Phung et al. (Supplementary Information)

Supplementary Figure S4

Supplementary Figure S4 (Cont’d)

5

T. Phung et al. (Supplementary Information)

6

T. Phung et al. (Supplementary Information)

Supplementary Figure S4. Akt1, Akt2 and Akt3 expression in human vascular tumors. (A)

Normal human skin, infantile hemangioma and angiosarcoma tissues were stained for Akt1,

Akt2 and Akt3. Representative areas of “low” and “high” levels of staining of each Akt isoform

within a tumor are shown. Arrows in normal skin indicate immuno-positive blood vessels. Scale

bar, 100 μm. (B) Higher magnification of the same stains. Scale bar, 100 μm.

7

T. Phung et al. (Supplementary Information)

Supplementary Figure S5. Akt3 expression in vascular tumor cell lines. (A) Human dermal

microvascular EC (HDMEC), infantile hemangioma cells (HemeEC) and human angiosarcoma

ASM.5 cells were analyzed by western blot for Akt3. The graph shows densitometric analysis of

Akt3 blot, normalized to β-actin. (B) Similar analysis was performed on normal mouse lung

microvascular endothelial cells (mouse EC) and mouse hemangioendothelioma cells (EOMA).

*P<0.05, N=5.

8

T. Phung et al. (Supplementary Information)

Supplementary Figure S6. Knockdown of Akt1, Akt2 and Akt3 in tumor cells, and the effects

of loss of Akt1, Akt2 and Akt3 on vascular tumor growth in vivo. (A) HemeEC, (B) ASM.5 and

9

T. Phung et al. (Supplementary Information)

(C) EOMA cells were transduced with lentivirus expressing shRNA to human Akt1 (shAkt1),

Akt2 (shAkt2), Akt3 (shAkt3) or pLKO control, and analyzed by western blot for each Akt isoform

and β-actin. Tables show densitometric quantitative analysis of each Akt isoform, calculated

relative to the levels in pLKO. *P<0.05, N=3. (D-E) Effects of loss of Akt1, Akt2 and Akt3 on

vascular tumor growth in vivo. (D) To validate Akt1, Akt2 and Akt3 knockdown, EOMA cells

were transduced with pLKO, shAkt1, shAkt2 or shAkt3 lentivirus, and analyzed by western blot

for each Akt isoform. Two to three separate shRNA clones (#1, #2 and #3) for each Akt isoform

were tested. (E) EOMA cells with Akt1, Akt2 or Akt3 knockdown (shRNA clone set #2) were

implanted subcutaneously in nu/nu mice. Tumor size was measured every 2 days. *P<0.05,

N=8.

10

T. Phung et al. (Supplementary Information)

Supplementary Figure S7. Loss of S6-Kinase rescues the effects of Akt3 on tumor cell

migration. (A) Western blot analysis of ASM.5 cells transduced with lentiviral pLKO, shAkt3 or

shAkt3 + shS6K to confirm the knockdown of Akt3 and S6K. (B) Brightfield images of

hematoxylin-stained tumor cells migrated across the membrane in Transwell assay.

11

T. Phung et al. (Supplementary Information)

Supplementary Figure S8. Loss of Rictor increases S6K pathway activation. (A) ASM.5 cells

expressing pLKO or Rictor shRNA (shRictor) were immunoblotted for the indicated proteins to

assess for Akt, S6K and S6 activation. (B) S6K knockdown increases Akt3 levels. ASM.5 cells

expressing pLKO or shS6K were immunoblotted to assess for Akt1 and Akt3 levels. (C)

Inhibition of S6K activity with rapamycin increases Akt3 levels. EOMA cells were treated ±

rapamycin at the indicated doses overnight, and immunoblotted for the indicated proteins.

12

T. Phung et al. (Supplementary Information)

Supplementary Table S1. In vitro properties of the S6K inhibitor LY2584702. *Kinases related

to p70 S6K.

13

T. Phung et al. (Supplementary Information)

Clone name Source Clone ID Target sequence (5’ to 3’)

Human shAkt1 #1 Toker None GCTACTTCCTCCTCAAGAATG

Human shAkt1 #2 Toker None GAGTTTGAGTACCTGAAGCTG

Human shAkt2 #1 Toker None GCGTGGTGAATACATCAAGAC

Human shAkt2 #2 Toker None GAGGTGTCTGTCATCAAAGAA

Human shAkt3 #1 TRC NM_005465.x

-1222s1c1

GTAAACTGGCAAGATGTATAT

Human shAkt3 #2 TRC NM_005465.x

-569s1c1

TGGCACACACTCTAACTGAAA

Mouse shAkt1 #1 TRC NM_009652.1

-713s1c1

CGTGTGACCATGAACGAGTTT

Mouse shAkt1 #2 TRC NM_009652.1

-1141s1c1

GCACATCAAGATAACGGACTT

Mouse shAkt2 #1 TRC NM_007434.2

-280s1c1

GATGGATCTTTCATTGGGTAT

Mouse shAkt2 #2 TRC NM_007434.2

-1266s1c1

GCTCATTCTTATGGAGGAGAT

Mouse shAkt3 #1 TRC NM_011785.2

-565s1c1

CTATGCTATGAAGATTCTGAA

Mouse shAkt3 #2 TRC NM_011785.2

-1365s1c1

CAGCTCAGACTATTACAATAA

Mouse shS6K TRC NM_028259.1

-963s1c1

ACATTGTTACACAGCCAGTAT

Mouse shRictor TRC NM_030168.2 CGAGACTTTGTCTGTCTAATT

14

T. Phung et al. (Supplementary Information)

-6240s1c1

Supplementary Table S2. Sequences of lentiviral short-hairpin RNA (shRNA) constructs.

TRC, the RNAi Consortium, the Broad Institute and MIT/Harvard Medical School. Toker, Alex

Toker and Rebecca Chin, Beth Israel Deaconess Medical Center and Harvard Medical School.

Toker shRNA clones were made based on siRNA sequences from Irie et al. (1).

15

T. Phung et al. (Supplementary Information)

SUPPLEMENTARY MATERIALS AND METHODS

Cell lines and reagents. Human infantile hemangioma cells, human dermal

microvascular endothelial cells and ASM.5 cells were cultured in MCDB131 media with

Microvascular Growth Supplement (Cascade Biologics) of 10% fetal bovine serum,

hydrocortisone (1 µg/ml), human fibroblast growth factor (3 ng/ml), heparin (10 µg/ml), human

epidermal growth factor (1 ng/ml), dibutyryl cyclic AMP (0.08 mM), 2 mM L-glutamine and

penicillin-streptomycin antibiotics. Mouse EOMA cells were cultured in DMEM (4.5 gm/L

glucose) and 20% fetal bovine serum. LY2584702 (Eli Lilly, Inc.) was prepared in 0.25%

Tween-80 and 0.05% anti-foam. Rapamycin (LC Laboratories) was solubilized in DMSO at 50

mg/ml.

Immunostaining. Immunofluorescence staining of frozen tissue sections was performed as

previously described (2). Briefly, tissues were fixed in cold 4% paraformaldehyde, blocked in

5% goat serum/PBS, and incubated with antibodies overnight at 4C, followed by incubation with

DylightTM 488-conjugated secondary antibody (Jackson Immunoresearch Labs) for 1 hour.

Tissues were visualized with Zeiss LMS 510 confocal microscope, and images were captured

using Zeiss LSM Image Browser Software. For immunohistochemical stains, 5 μm-thick paraffin

tissue sections were dewaxed and rehydrated. Endogenous peroxidase activity was quenched

with 3% H2O2 in methanol. Antigen retrieval was performed by heating tissues in 1 mM EDTA

for 12 minutes before blocking with 5% goat serum. Tissues were incubated with primary

antibody (1:200 dilution) overnight at 4 C. Biotinylated secondary antibody (1:300 dilution) was

applied before ABC peroxidase system application (Vector Laboratories) and DAB color

development. Tumor stain reactivity (% positive staining cells) and stain intensity (1, low; 2,

moderate; and 3, high) were evaluated and scored by two pathologists (LE and PRW). The

16

T. Phung et al. (Supplementary Information)

average of the two score sets was graphed. Photographs were captured using an Olympus

BX41 microscope, ProgRes C5 digital camera (Jenoptik) and ProgRes CapturePro 2.6 software.

Cell growth, apoptosis and migration assays. Cells were cultured in 96-well plate (2,000

cells/well) for 0-5 days in complete media ± VEGF (50 ng/ml) ± rapamycin (10 ng/ml). Cell

number was determined by CyQuant Cell Proliferation Assay (Invitrogen), and results are

expressed as unit of fluorescence labeling of DNA content in the cell. Cell apoptosis was

induced under serum starvation conditions for 96 hours, and assessed by flow cytometric

analysis for the apoptosis marker Annexin V per manufacturer’s instructions (BD Biosciences).

Migration scratch assay was performed according to standard procedure (3). Cells were

cultured to confluency in 60-mm plates, at which time wound scratches were made using a 20

μl-pipette tip. Floating cells were removed and fresh complete media was added, and cells

were incubated at 37C for 16 hours. Images were captured at 0 and 16 hours using a Zeiss

Axiovert-40 CFL inverted microscope and AxioVision software. Percent wound closure, which

reflects cell migration, was calculated as 1- (open area at end time/open area at starting time) x

100. Boyden chamber transwell migration assay was performed per standard procedure (4).

Briefly, cells in 1% FCS medium were plated onto the upper chamber of Transwell membrane,

and medium containing 10% FCS was added to the lower chamber. Cells were incubated at

37C for 6 hours. Cells were then stained and those that had migrated onto the lower membrane

surface were counted.

Quantitative real-time PCR. qPCR primers used are mouse Rictor forward primer 5’-

CGAAGCATTTCCTGTCCC-3’ and reverse primer 5’-ACGGCTCCTGGTGACTTG-3’ (5).

Mouse 18S rRNA forward primer 5’-CGCCGCTAGAGGTGAAATC-3’ and reverse primer 5’-

CAGTCGGCATCGTTTATGG-3’ (6). Rictor mRNA expression was normalized to 18S RNA

content.

17

T. Phung et al. (Supplementary Information)

SUPPLEMENTARY REFERENCES

1. Irie HY, Pearline RV, Grueneberg D, et al. Distinct roles of Akt1 and Akt2 in regulating

cell migration and epithelial-mesenchymal transition. J Cell Biol 2005; 171: 1023-34.

2. Phung TL, Eyiah-Mensah G, O'Donnell RK, et al. Endothelial Akt signaling is rate-limiting

for rapamycin inhibition of mouse mammary tumor progression. Cancer Res 2007; 67: 5070-5.

3. Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and inexpensive

method for analysis of cell migration in vitro. Nat Protoc 2007; 2: 329-33.

4. Chen HC. Boyden chamber assay. Methods Mol Biol 2005; 294: 15-22.

5. Xu XY, Zhang Z, Su WH, et al. Characterization of p70 S6 kinase 1 in early development

of mouse embryos. Dev Dyn 2009; 238: 3025-34.

6. Clow C, Jasmin BJ. Brain-derived neurotrophic factor regulates satellite cell

differentiation and skeltal muscle regeneration. Mol Biol Cell 2010; 21: 2182-90.

18