1

Cancer Cell, Volume 22

Supplemental Information

EGF Receptor Is Required

for KRAS-Induced Pancreatic Tumorigenesis

Christine M. Ardito, Barbara M. Grüner, Kenneth K. Takeuchi, Clara Lubeseder-Martellato, Nicole

Teichmann, Pawel K. Mazur, Kathleen E. DelGiorno, Eileen S. Carpenter, Christopher J. Halbrook,

Jason C. Hall, Debjani Pal, Thomas Briel, Alexander Herner, Marija Trajkovic-Arsic, Bence Sipos,

Geou-Yarh Liou, Peter Storz, Nicole R. Murray, David W. Threadgill, Maria Sibilia, M. Kay

Washington, Carole L. Wilson, Roland M. Schmid, Elaine W. Raines, Howard C. Crawford, and Jens T.

Siveke

Inventory of Supplemental Information

Supplemental Data

Figure S1, related to Figure 1.

Figure S2, related to Figure 2.

Figure S3, related to Figure 3.

Figure S4, related to Figure 4.

Figure S5, related to Figure 5.

Supplemental Experimental Procedures

Supplemental References

2

SUPPLEMENTAL DATA

Figure S1, related to Figure 1: Upregulation of EGFR expression in human and mouse pancreatic disease. (A) IHC for

total EGFR shows elevated levels in tissue sections of human chronic pancreatitis and PDA in comparison to healthy

human pancreatic tissue. (B) Expression of EGFR in the mouse models used in this study, including KrasLSL-G12D/+;Ptf1aCre/+

(KrasG12D) and the KrasLSL-G12D/+;Ptf1aCre/+;p53Flox/Flox (KrasG12D;p53KO) models. Arrows indicate mPanIN areas highly EGFR

positive. Scale bars = 50 m.

3

Figure S2, related to Figure 2: Genetic ablation of EGFR signaling impairs KRAS-driven PDAC development. (A) IHC for

total EGFR in a KrasG12D;p53KO;EgfrKO pancreas. Arrowheads indicate EGFR-negative mPanIN lesions. Scale bar = 50 m.

(B) Western blot analysis of cell lines established from KrasG12D;p53KO compared to KrasG12D;p53KO;EgfrKO pancreata for

EGFR, E-Cadherin, N-Cadherin, active MET (MET pY1234, pY1235), total MET, full length Notch-1 (Notch1 fl) and

intracellular domain (Notch1 IC), full length Notch-2 (Notch2 fl) and intracellular domain (Notch2 IC). HSP90 was used as

a loading control.

4

5

Figure S3, related to Figure 3: Ablation of EGFR signaling blocks pancreatitis-dependent neoplasia and ADM in vivo. (A)

IHC and (B&C) quantitation of MUC5AC in KrasG12D, KrasG12D;EgfrKO and KrasG12D;Adam17KO mice (*** p < 0.001). Scale

bars = 50 µm. n=3 to 4 per group. (D)Total EGFR IHC analysis in KrasG12D control and KrasG12D;EgfrKO mice. Arrowheads

highlight EGFR positive mPanIN (n=7). Scale bars = 20 µm. (E) PCR analysis of DNA isolated from either pancreas (P) or

tail (T) of the indicated genotypes to examine pancreas specificity of recombination of the STOP cassettes in KrasG12D ,

KrasG12D;Adam17KO and KrasG12D;EgfrKO mice compared to floxed mice without Ptf1aCre/+. (F) Histology of 1-year old Tgfa

mice show induction of extensive ADM (asterisks) and fibrosis, neither of which is not found in Tgfa;EgfrKO or

Tgfa;Adam17KO mice of the same age. Scale bars = 100 µm. (G) Cerulein induction of a chronic pancreatitis-like

phenotype in wild-type (WT) EgfrKO and Adam17KO mice, as indicated. H&E and DBA-Lectin staining of ductal structures

are shown. Scale bars = 100 µm. n=5 (H&I) Quantitation of cerulein-treated pancreata shown in (G) stained by IHC for

infiltrating inflammatory cells positive for either Ly-6B.2 (neutrophils), F4/80 (macrophage) or CD3 (T-cells) in the

pancreata of EgfrKO (H) and Adam17KO mice (I) in comparison to controls. (n=5, *** p < 0.001. Error bars are +/-SEM). (J)

IHC analysis of the proinflammatory proteins COX1 and COX2 in pancreata from the cerulein-treated wild-type and EgfrKO

animals shown in (G). BV indicates blood vessels. Scale bar = 20 µm. (K-N) Wild-type, EgfrKO and Adam17KO mice were

treated with 7 hourly injections of 50 g/kg of cerulein and allowed to recover for 1 hour (K-M) or 4 hours (N). At

sacrifice, body and pancreatic masses were determined (K) and serum collected for assay of amylase activity (L). (M)

H&E revealed several areas of necrosis (arrows) n=5. Scale bar = 50 m (N) SOX9 IHC of saline treated wild type control

and cerulein-treated wild type, EgfrKO and Adam17KO mice with 4 hours of recovery, n=3. Scale bar = 50 m.

6

7

Figure S4, related to Figure 4: EGFR signaling is required for ADM. (A) Staining for the intermediate progenitor marker

Nestin (white arrowheads) in acinar epithelial explants of KrasG12D and KrasG12D;EgfrKO mice at days 2 , 3 and 4 of

explant culture (upper panel, white arrow). Scale bar = 20 µm. (B) Quantitation of Nestin positive acinar clusters at days

2 and 3 in KrasG12D and KrasG12D;EgfrKO explant cultures. (C) IF staining for actin (red) and EGFR pY1068 IF (green) in WT

and EgfrKO explant cultures treated with cerulein for 3 days. Scale bar = 20 µm. (D) IF staining for TGFA (green,

arrowheads) in wild type, EgfrKO and Adam17KO acinar cell explants at 0, 3 and 5 days of culture. Scale bars = 20 µm. (E)

Co-IF staining for amylase (green) and CK19 (red) in wild-type and Adam17KO acinar cell explants, treated with cerulein

at 0, 3 and 5 days of culture. Scale bars = 20 µm. (F) IHC for the EGFR ligand TGFA, active pY1068 EGFR, ADAM17 and

AREG in normal human pancreas and chronic pancreatitis samples. Scale bars = 50 µm for main micrographs, 25 m for

insets.

8

Figure S5, related to Figure 5: EGFR is important for maximal MAPK activity, which is critical for metaplasia and

neoplasia. (A) Active phospho-STAT3 IHC in 3 month old KrasG12D and KrasG12D;EgfrKO pancreata. (B) KRAS and EGFR co-

immunoprecipitation from KrasG12D derived tumor cells isolated as described previously ( Mazur et al., 2010). IgG was

used as negative control for immunoprecipitation. Whole cell lysate was used as a positive control for expression of the

blotted proteins. Numbers designates indicate two separate cell lines. (C) Confocal IF analysis of EGFR and KRAS

localization in pancreata of 3 month old KrasG12D mice. Arrowhead highlights an area of colocalization. Scale bar = 10 m.

(D) S2013 (mutant KRAS) and BXPC-3 cells (wild-type KRAS) were treated with vehicle, erlotinib or recombinant TGFA.

Lysates were assessed for RAS activity by RAF-RBD pulldown. ERK and EGFR activities were measured by western blotting

for pERK1/2 pT202,pY204 and EGFR pY1068, respectively. Numbers represent quantitation from 3 independent

experiments. Similar results were obtained with other mutant Kras PDA cell lines, including L3.2, CAPAN-2 and ASPC-1.

MiaPaCa2 and Panc1 cell lines did not respond to erlotinib treatment. (E) IHC for for pERK1/2 pT202,pY204 in normal

human pancreas and chronic pancreatitis. Scale bar = 50 m.

9

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

RNA isolation for pancreas and qRT-PCR

Mice were anesthetized with avertin and the tail of the pancreas was removed and immediately homogenized in

RLT buffer (Qiagen, Valencia, CA) using a Pro 250 Homogenizer (Pro Scientific, Oxford, CT). Total RNA was extracted

from mouse pancreatic tissue using the RNeasy Mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol.

5 µg of RNA was treated with TURBO DNA-free DNase (Ambion, Austin, TX) according to the manufacturer’s directions.

Reverse transcription was performed on 2 µg of DNase-digested RNA using the iScript cDNA Synthesis Kit (Bio-Rad,

Hercules, CA).

All real-time PCR reactions were performed in triplicate using Power SYBR Green PCR Master Mix (Applied

Biosystems, Foster City, CA) on a StepOnePlus Real-time PCR System (Applied Biosystems) and analyzed using the

StepOne version 2.2 software (Applied Biosystems, Foster City, CA). Aliquots equivalent to 12.5 ng of total RNA were

taken from the reverse transcription reactions and added to 25 L PCR reactions containing 300 nM of forward and

reverse primers. To ensure only one PCR product was being produced, melt curve analysis was performed after the

amplification cycles by denaturing each reaction over a 35°C temperature gradient from 60°C to 95°C. The cycle

threshold (Ct) of the amplification plot was adjusted to a point within the geometric phase of amplification to obtain Ct

values for each PCR reaction. The relative amount of each gene of interest was normalized to the reference genes

HPRT1, RPL13A, 18s RNA and TBP by a modified delta Ct method. The fold change was then calculated by comparing the

delta Ct of each experimental condition to the control treatment and expressed as arbitrary mRNA units and expressed

relative to signal from results from wild type pancreata.

qRT-PCR oligonucleotides

Neuregulin F/R AACAGCAGGCACAGCAGCCC/ AGGGGAGCTTGGCGTGTGGA

EGFR (fresh pancreas) F/R TGCCACCTATGCCACGCCAAC / TGAGACCTCTGGCTGGCCCA

EGF F/R CAGCGGACCCAACAGCAGCA / GCACTGACCCGAGCTGCAGG

TGFA F/R TGTGGCCCTGGCTGTCCTCA / GGCACTGCCAGGGGTGTTGT

10

HBEGF F/R TTGTCCGCGTTGGTGACCGG / CTTGGGGTGGCCAGGCCTTG

AREG F/R GGAGCCGCTGTCGTGTTGCT / GTCCACCGGCACTGTGGTCC

BTC F/R ATGCCGCTTCGTGGTGGACG / GCAGGTGCAGACGCCGATGA

EREG F/R CACTCCGCAAGCTGCACCGA / TGCACTTGAGCCACACGGGG

18s RNA F/R CGAAGGATTGACAGATTG / CAAATCGCTCCACCAACTAA

TBP F/R CCCCACAACTCTTCCATTCT / GCAGGAGTGATAGGGGTCAT

HPRT1 F/R TCAGTCAACGGGGGACATAAA / GGGGCTGTACTGCTTAACCAG

RPL13a F/R TCTGGGCCGGAAGGTGGTGG / GGCAGCATGCCTCGCACAGT

Cyclophillin-F/-R ATGGTCAACCCCACCGTGT / TTCTGCTGTCTTTGGAACTTTGTC

ErbB1-F/-R (for explants) GTCTGCCAAGGCACAAGTAAC / CACCTCCTGGATGGTCTTTAA

ADAM 17 F/R CCCCCACCCGGAGATGCTGA/ CGGCACACACGGGCCAGAAA

Antibodies:

CK19 (TROMA III, Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, Iowa), Amylase (Sigma-

Aldrich), total EGFR and EGFR pY1068 from both Millipore (Billerica, MA) and Epitomics (Burlingame, CA). Antibodies

recognizing Erk1/2, Akt 1/2,Kras, Cox1, Cox2 were from Santa Cruz Biotechnology (Santa Cruz, CA) Those for Erk pT202

pY204, Akt pT308, c-Met, Stat3 Y705, E-cadherin and Cleaved Caspase-3 were from Cell Signaling Technology (Danvers,

MA); for Notch-1, N-cadherin and Sox9 were from BD Biosciences (San Diego, CA), for total Ras and CyclinD1 were from

Epitomics, for Muc5 AC (Thermo Fisher Scientific, Kalamazoo, MI), CD3 and BrdU (Abcam, Cambridge, MA),

ADAM17/TACE (Millipore), for Ly-6B.2 and F4/80 were from AbD Serotec, (Oxford, UK), pY1234/pY1235 c-Met (R&D),

TGFA (Novus Biologicals) and AREG (LifeSpan BioSciences Inc., Seattle, WA).

Antibodies for whole-mount immunofluorescence included cytokeratin-19 (DAKO, Carpinteria, CA), amylase and

actin (Sigma-Aldrich), Nestin (BD Biosciences) and EGFR pY1068 (Epitomics). Secondary antibodies were Alexa Fluor488-

labeled anti-rabbit and Alexa Fluor594 anti-mouse (Invitrogen, Grand Island, NY).

11

BrdU incorporation

Wild type, KrasG12D, EGFRKO and KrasG12D;EGFRKO mice were treated i.p. with either 250 µg/kg cerulein or saline

once daily for three days followed by three days of recovery. Beginning on the third day of cerulein administration and

continuing until euthanasia, 50 mg/kg BrdU was injected i.p. once daily. Tissue harvest was performed 8 hours after the

injection on a particular day, as indicated. Mice were anesthetized and perfused with 4% paraformaldehyde. Tissue was

analyzed by IHC.

Histological quantitation

Quantitation of amylase positive area was performed on independent, singly DAB stained sections using

Olympus cellSens Dimension imaging software. Final quantitation represents the average of 15-20 20X fields of view

from 2 mice of each genotype, treatment regimen or time point, as indicated.

For MUC5AC quantitation, representative slides per mouse were chosen and at least 5 10X pictures were taken

from each slide and calculated manually or using the AxioVision 4.8 software (n = 3-4 mice per group).

Cleaved Caspase 3 and Cyclin D1 and were quantified using Aperio ImageScope v11.1.2.752 software.

Quantitation represents the average of 10-15 20x fields of view from a representative slide from each mouse. Caspase

quantitation used an algorithm counting positive pixels, whereas CyclinD1 quantitation counted positive nuclei (n = 3).

For CK19 quantitation of the In vivo treatment of KrasG12D;p53KO mice with erlotinib or cetuximab, three slides

per mouse from different regions were randomly chosen and at least 5 10X pictures were taken from each slide and

calculated manually or using the AxioVision 4.8 software (n = 3 mice per group).

Percentage of healthy acinar tissue in KrasG12D;p53KO and KrasG12D;p53KO;EgfrKO mice was calculated using the

Zeiss Mirax optical slide scanner and the Panoramic Viewer 1.15 software. Two slides per mouse from 2 mice of each

genotype were measured.

12

Primary cell isolation for RAS Activity Assay

Pancreata were removed from 3 to 5 week old wild-type, KrasG12D, KrasG12D;Adam17KO or KrasG12D;EGFRKO mice.

Pancreata were rinsed twice in HBSS, minced and incubated with 0.2 mg/mL Collagenase-P (Roche, Indianapolis, IN) at

37°C for 15 minutes. Collagenase digested tissue was rinsed 3x in HBSS containing 5% FBS and filtered through 500 µm

and 105 µm polypropelene mesh (Spectrum Laboratories, Rancho Dominguez, CA) in succession. Filtrate was

centrifuged through HBSS supplemented with 30% FBS and resuspended in 1x Waymouth MB 752/1 medium (Sigma-

Aldrich, St. Loius, MO) supplemented with 50 µg/mLg gentamycin (Life Technologies, Grand Island, NY), 0.4 mg/mL

soybean trypsin inhibitor (Life Technologies), and 1 µg/mL dexamethasone (Sigma-Aldrich). The cellular suspension was

plated in non-adherent plates overnight at 37°C and 5% CO2. The following day, cells were either left untreated or

treated with 1 µM Erlotinib (Cayman Chemical, Ann Arbor, MI) for 6 hours, rinsed once in HBSS and lysed in an

appropriate volume of MLB (25 mM HEPES pH 7.4, 150 mM NaCl, 1% Igepal CA-630, 10% glycerol, 25 mM NaF, 10 mM

MgCl2 and 1 mM EDTA) containing protease and phosphatase inhibitors (Roche).

RAS Activity Assay

GST-Raf-1-RBD fusion protein was prepared by modifying procedures published elsewhere (Castro A.F et al Methods,

2005). Briefly, a 250 mL culture of BL21(DE3)LysE bacteria containg the GST-Raf-1-RBD expression construct was induced

with IPTG for 4 hours. The bacteria was pelleted by centrifugation and resuspened in bacterial lysis buffer (50 mM Tris

pH 8.0, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 100 µM PMSF) containing protease inhibitors (Roche). Bacteria were

lysed by ten 10 second pulses using a Branson Sonifier 150 (Branson Ultrasonics Corp., Danbury CT) at power setting 7.

Debris was pelleted by centrifugation and Lysate was removed and incubated with 500 µL of glutathione beads (Thermo

Scientific, Rockford, IL) for 2 hours at 4°C with agitation. Beads were pelleted and washed 3x with wash buffer (20 mM

Tris pH 8, 50 mM NaCl, 20% glycerol, 1 mM EDTA and 1 mM DTT) containing protease inhibitors (Roche). The active RAS

pulldown assays were performed by incubating 750 µg of either cell line or acinar cell lysate with 75 µg of GST-Raf-1-RBD

fusion protein bound beads in a total volume of 1.5 mL of MLB at 4°C for 1 hour with agitation. Beads were washed 3x

13

with MLB then incubated with Laemmli buffer at 95°C for 5min. Protein was separated by denaturing SDS-PAGE,

transferred to Immobilon PSQ (Millipore, Billerica, MA) and visualized by standard western blotting techniques.

Immunoprecipitation of murine PDA lysates

Primary murine PDA cell lines of KrasG12D mice were lysed in a non-denaturating lysis buffer and incubated with primary

antibody (Egfr and Ras, both Millipore). Pull-down of immunoprecipitates was achieved using A/G agarose (Thermo

Scientific) and visualization was performed using standard western blot.

Cytokine Expression Analysis

Two Egfr floxed and EgfrKO mice were treated to induce chronic pancreatitis, as described. Two saline-treated mice of

each genotype were used as baseline normalization controls. The pancreata were harvested 24 hrs after the final

cerulein injection and divided in half. The pancreatic head was preserved and embedded in paraffin for further analysis,

while the tail was homogenized to make protein lysates. Protein was quantitated by BCA assay (ThermoFisher Scientific,

Rockford, IL) and equal protein from the duplicate genotypes and treatment regimens were combined. Lysates were

used to probe the Mouse Cytokine Array, Panel A (R&D Systems, Minneapolis, MN) and quantitated with Imagequant5

software (GE Healthcare, Piscataway, NJ). When the ratio between the saline and cerulein-treated mice differed by

more than 5-fold between genotypes, the cytokine was scored as being differentially expressed.

Amylase Activity Assay

Blood was collected from mice by cardiac puncture upon euthanization, allowed to coagulate and centrifuged to

obtain serum. Serum amylase activity was determined using Liquid Amylase Reagent (Pointe Scientific, Canton, MI)

according to the manufacturer’s instructions.

SUPPLEMENTAL REFERENCE Mazur, P. K., Einwachter, H., Lee, M., Sipos, B., Nakhai, H., Rad, R., Zimber-Strobl, U., Strobl, L. J., Radtke, F., Kloppel, G.,

et al. (2010). Notch2 is required for progression of pancreatic intraepithelial neoplasia and development of pancreatic

ductal adenocarcinoma. Proc Natl Acad Sci U S A 107, 13438-13443.