1  

Chemistry & Biology, Volume 20

Supplemental Information

An Iterative, Bimodular Nonribosomal Peptide

Synthetase that Converts Anthranilate

and Tryptophan into Tetracyclic Asperlicins

Xue Gao, Wei Jiang, Gonzalo Jiménez-Osés, Moon Seok Choi, Kendall N. Houk, Yi Tang,

and Christopher T. Walsh

Inventory of Supplemental Information Table S1: List of primers used during this study; Figure S1, related to Figure 2: Michaelis-Menten plots of ATP-[32P]PPi exchange assay for AspA. Figure S2: SDS-PAGE gels of the heterologously expressed proteins in this study. Figure S3, related to Figure 3: Extracted ion mass chromatograms [M+H]+ =407 from AspA in vitro reactions. Figure S4, related to Figure 3: In vitro reconstitution of the Asperlicin C, D and 1 production by using dissected AspA_M1 and AspA_M2 proteins. Figure S5, related to Figure 4: The first module of AspA iteratively utilizes two molecules of Ant. Figure S6, related to Figure 5: The T2CT di-domain fragment of AspA generates Asperlicin C and D from exogenous Ant-Ant- L-Trp-SNAC. Figure S7, related to Figure 4 and 5: No cyclic Ant-Ant dimer was observed when incubate AspA_A1-T1-C2 with Ant and ATP. Figure S8, related to Figure 7: Three alternative mechanisms for the formation of 6,11-macrocycle precursor of asperlicins C and D. Figure S9, related to Figure 7: Minimum energy pathways for the nucleophilic addition of neutral aniline to the thioester.

2  

Expression and purification of intact AspA and dissected proteins.  The verified AspA 

expression  plasmid was  retransformed  into  S. cerevisiae  strain  BJ5464‐NpgA  for  protein 

expression. Yeast cells harboring the AspA expression plasmid were grown in yeast extract 

peptone dextrose medium with 1%  (w/v)  dextrose  at  28  °C  for  72 hours.  The  yeast  cell 

pellets were harvested by centrifugation 2500 g for 20 min at 4 °C, and resuspended in 20 

mL  lysis buffer (50 mM NaH2PO4 pH 8.0, 0.15 M NaCl, 10 mM imidazole). The yeast cells 

were lysed by sonication on ice followed by centrifugation (35,000 g, 60 min, 4 °C).   

 

The  AspA_M1,  AspA_M2,  AspA_T2CT  and AspA_CT  expression  plasmids were  transformed 

into E. coli BL21 (DE3). The resulting E. coli cells were grown in 500 mL Luria–Bertani (LB) 

medium with  35 mg  L‐1  kanamycin  at  37  °C  until  A600 reach  to  0.4~0.6  and  60  µL  1  M 

Isopropylthio‐β‐D‐galactoside (IPTG) was added to induce protein expression at 16 °C for 

overnight.    The E. coli  cell  pellets were harvested by  centrifugation  (3750  rpm,  15 mins, 

4 °C) and resuspend in 30 mL lysis buffer (50 mM Tris‐HCl, 2 mM EDTA, 2 mM DTT, 500 

mM NaCl, 5 mM imidazole, pH 7.9). The resuspended buffer was subjected to sonication on 

ice to disrupt E. coli cell membranes followed by centrifugation (14,000 rpm, 30 min, 4 °C). 

The  supernatant  were  incubated  with  Ni‐NTA  agarose  for  at  least  2  hours  at  4°C.  The 

protein/resin mixture was then loaded onto a gravity flow column and washed by buffer A 

(50  mM  Tris‐HCl,  500  mM  NaCl,  pH  7.9)  with  a  stepwise  increasing  concentration  of 

imidazole. The target proteins were eluted by using buffer A with 250 mM imidazole. 

   

3  

Table S1. List of primers used during this study Primer name  Sequence (5’‐3’) 

AspA_P1_F  atggctagcgattataaggatgatgatgataagactagtatgggttcctacaacgccaa

AspA_P1_R  caccattccgtcagcccatg 

AspA_P2_F  catggctcaatagtagggtcc 

AspA_P2_R  gccattttcagccgatctaa 

AspA_P3_F  gtgtggaaactgaagacaaggtc 

AspA_P3_R  cagatcaacacgggtgatga 

AspA_P4_F  gacgaagccgttggaccctt 

AsPA_P4_R  ttcgctttgtccacaatcca 

AspA_P5_F  ttgcgatgggatgtaaactg 

AsPA_P5_R  tggtcgacatgctgtagcca 

AspA_P6_F  atgtctcatgcacaatatga 

AsPA_P6_R  tcatttaaattagtgatggtgatggtgatgcacgtgttgatatccattcaatgcat 

AspA_CT_NcoI_F  aaaaaaccatggtgggcagccatcatgactcgtca 

AspA_CT_EcoRI_R  ttttttgaattctcagtggtggtggtggtggtgttgatatccattcaatgcatg 

AsPA_C2A2T2CT_F  atcaactatcaactattaactatatcgtaataccatatgcaggatatctttcactgcatg 

AspA_T2_NcoI_F  aaaaaaccatggtgaactacatatcaaaccaaagg 

AspA_P1_NdeI_F  atcaactatcaactattaactatatcgtaataccatatgggttcctacaacgccaa 

AsPA_A1T1C2_R  tcatttaaattagtgatggtgatggtgatgcacgtgtcgctcagtacatagattgag 

 

   

4  

Figure S1: Michaelis‐Menten plots of ATP‐[32P]PPi exchange assay for AspA with (A) Ant, 

(B) L‐Trp, and (C) benzoic acid as substrates.  

 

 

   

5  

 

Figure S2: SDS‐PAGE gels of the heterologously expressed proteins in this study. AspA_ A1‐

T1‐C2  and AspA_C2‐A2‐T2‐CT were  expressed  from BJ5464‐NpgA. AspA_CT  and AspA_T2‐CT 

were expressed from BL21 (DE3). All proteins were purified by C‐terminal His6 tag. 

 

   

6  

Figure S3: Extracted ion mass chromatograms [M+H]+ =407 from AspA in vitro reactions. 1 

mM of Ant, L‐Trp, 3 mM ATP and 5 mM MgCl2 were used  in the assays. Trace  i) No AspA 

reaction control; and trace ii) with addition of 10 µM AspA enzyme. 

 

   

7  

Figure S4: In vitro reconstitution of the Asperlicin C, D and 1 production by using dissected 

AspA_M1  (A1‐T1‐C2)  and AspA_M2 proteins  (C2‐A2‐T2‐CT).  1 mM of Ant,  L‐Trp, 3 mM ATP 

and 5 mM MgCl2 were used in the assays. HPCL (280 nm) analyses of trace i) Intact AspA 

positive  control,  trace  ii) only with 10 µM AspA_M1,  trace  iii) only with 10 µM AspA_M2 

and trace ii) with addition of 10 µM AspA_M1 and AspA_M2 proteins. 

 

   

8  

Figure S5: The first module of AspA iteratively utilizes two molecules of Ant. The holo form 

of M1 (50 µM A1‐T1‐C2) was preloaded with Ant (1 mM Ant,  3 mM ATP) for 1 hour while in 

parallel  the T2‐CT di‐domain was converted to the holo  (HS‐pantetheinyl)  form via 20 µM 

Sfp and 1mM CoASH for 1 hour. The two solutions were mixed on addition of 400 µM Ant‐L‐

Trp‐SNAC and incubated overnight before aliquots were analyzed by LC/MS. Extracted ion 

mass chromatograms [M+H]+ =407 from the assay without T2CT di‐domain (trace i); from 

incubation including holo T2CT (trace ii), and from the full length AspA starting from Ant, L‐

Trp and ATP (trace iii). 

 

   

9  

Figure  S6:    The  T2CT  di‐domain  fragment  of  AspA  generates  Asperlicin  C  and  D  from 

exogenous Ant‐Ant‐ L‐Trp‐SNAC. Reactions contained 50mM This‐HCl buffer, pH 7.5, in 100 

µL. Traces (i to iii) contained 20 µM Sfp, 2mM CoASH, 100 µM Ant‐Ant‐L‐Trp‐SNAC. 50 µM 

T2CT or CT was added in traces i and ii, respectively; No enzyme was added in trace iii. The 

suite of asperlicins C, D and compound 1([M+H]+ = 407) are found in traces i but not ii and 

iii. Extracted ion mass chromatograms [M+H]+ =407. 

 

   

10  

Figure S7: No cyclic Ant‐Ant dimer was observed when  incubate AspA_A1‐T1‐C2 with Ant 

and ATP. HPCL traces (280 nm) are shown i) no enzyme control; ii) with addition of1 mM 

Ant, 3 mM ATP and 10 µM AspA_A1‐T1‐C2. 

 

 

   

11  

Figure  S8:  Three alternative mechanisms for the formation of 6,11-macrocycle precursor of asperlicins C and D. The calculations were performed at the PCM(water)/B3LYP/6-31G(d) level (Becke, 1993; Lee, et al., 1988) using reduced models in which the indol ring from Trp side chain has been substituted by a hydrogen. Relative free energies are in kcal mol-1and distances in Angstroms.

12  

In mechanism 1, the C4=O carbonyl oxygen (imidate form) first attacks the thioester to generate an oxazol-5(4H)-one, followed by attack of the C11=O carbonyl oxygen (path a) and subsequent ring expansion to yield a 9-membered ring, which can then be opened to the 6,11-macrolactam. Another possible reaction pathway (path b) involves the attack of N1 to the oxazolone to yield a 7-membered ring accessible also from mechanism 2.

13  

Alternatively in mechanism 2, the amide nitrogen bridging the two Ant residues can initiate attack on the thioester to form a 7-membered ring, followed by ring expansion to the 6,11-macrolactam.

In the originally envisaged mechanism 3, the aniline nitrogen serves as the product releasing nucleophile towards the 6,11-macrolactam.

 

14  

Figure S9. Minimum energy pathways for the nucleophilic addition of neutral aniline to the thioester.  All  attempts  to  locate  transition  structures  in  these  potential  energy  surfaces were  unsuccessful  either  without  explicit  solvation  (A),  in  the  presence  of  four  water molecules surrounding the NH2 and SMe (B) or with the assistance of explicit solvation and methylamine as a general base (C). This behavior was observed also when attempting the ring  expansion  of  other  intermediate  macrocycles  by  nucleophilic  addition  of  aniline  to lactam  carbonyls  (D).  The  calculations  were  performed  at  the  PCM(water)/B3LYP/6‐31G(d)  level using  reduced models  in which  the  indol  ring  from Trp side chain has been substituted  by  a  hydrogen.  Relative  free  energies  are  in  kcal  mol‐1and  distances  in Angstroms. 

   

15  

References: 

Becke, A.D. (1993). Density‐functional thermochemistry. III. The role of exact exchange. J. Chem. Phys. 98, 5648‐5652. Lee, C., Yang, W., and Parr, R.G. (1988). Development of the Colle‐Salvetti correlation‐energy formula into a functional of the electron density. Phys. Rev. B Condens. Matter. 37, 785‐789.