supplemental data. kurzbauer et al. (2012). plant cell 10 ... · supplemental data. kurzbauer et...

Supplemental Data. Kurzbauer et al. (2012). Plant Cell 10.1105/tpc.111.098459

1

Supplementary Figure 1. Molecular characterisation of the Arabidopsis rad51

null allele.

atr rad51 double mutants, with both alleles homozygous for the respective mutation,

were grown for two further generations and then analysed by PCR genotyping and

DNA gel blot analysis, confirming the presence of both mutant alleles. In rad51-1 (Li

et al. 2004) mutants only mRNA corresponding to the 5’ part of the gene, the region

upstream of the inserted T-DNA sequence, was detected. To rule out that a

hypomorphic, truncated RAD51 protein is made from this truncated mRNA, we

generated a new polyclonal antibody against RAD51 ( -RAD51*), with the potential

to detect the N-terminal part of the Arabidopsis RAD51 protein. The new antibody

was successfully tested against different truncated versions of Arabidopsis RAD51

generated in E. coli, including one corresponding to a putative truncated protein in

the rad51-1 mutant (RAD51 N-term). Using this antibody, no RAD51 signal could be

detected in meiotic spreads of rad51-1 mutant plants. We therefore concluded that

the rad51-1 mutant allele represents a true null allele.

(A) Top: Schematic representation of the genomic DNA and the transcript of the

Arabidopsis RAD51 gene (RAD51; At5g20850). The insertion site of the integrated T-

DNA in the rad51 mutant line (rad51-1; GABI_134A01) is indicated as triangle. Black

boxes represent exons, primer for genotyping PCR (red), RT-PCR (blue) and DNA

gel blotting (green) are depicted as arrows and the BsrGI restriction sites (“B”) for

DNA gel blotting are shown. Bottom: Results of genotyping PCR and RT-PCR using

the primer shown on the left. PCR on the wild-type allele of RAD51 yields an

approximately 950 base pairs (bp) product and on the mutant allele an approximately


2

800 bp product. PCR on cDNA yields a product using primer upstream of the

insertion site (I) in wild-type and mutants but primer spanning the insertion site (II)

only give a product with wild-type and never with mutant cDNA. DNA gel blotting was

performed to non-ambiguously demonstrate the exclusive presence of the rad51

mutant allele in atr rad51 F3 plants, defined as homozygous for both mutant alleles

by PCR. In total, 77 plants were tested, 14 individuals are shown (1-14) next to wild-

type (wt) and a rad51 single mutant (rad51). The lower band represents the 1000bp

product of the restriction digest of genomic DNA with BsrGI in wild-type, the upper

band also contains the 2091bp insertion present in rad51 mutants.

(B) Immunoblot and immune-histochemical experiments performed with a newly

generated antibody against Arabidopsis RAD51 ( -RAD51*). This antibody detects

the N-terminus of Arabidopsis RAD51, gives numerous foci on spread nuclei of wild-

type PMCs and does not yield any signal on spread nuclei of mutant rad51 PMCs.

(Size bar: 10 m)


3

Supplementary Figure 2. A mutation in ATR suppresses the severe meiotic

defects of rad51 mutants.

(A) Meiotic spreads of pollen mother cells (PMCs) stained with 4',6-diamidino-2-

phenylindole (DAPI). About 36% of atr rad51 double mutant cells undergo meiosis

without DNA fragmentation (see as well Figures 1 and 4). The displayed metaphase

II cell shows DNA fragmentation. dmc1 mutants form univalents and DNA repair is

not compromised (4% seed formation, n=289 siliques). The same phenotype is

observed in atr dmc1 double mutants (1% seed formation, n=114 siliques). A

mutation in ATRIP only partially alleviates the rad51 phenotype (4% seed formation,

n=48 siliques) and most meiocytes display DNA repair defects.

(B) Images of nuclear spreads of PMCs at early to mid-zygotene stage with RAD51

(red) and ASY1 (green) detected by immuno-fluorescence. Bars represent mean

RAD51 foci numbers per meiotic nucleus. RAD51 foci numbers are moderately but

significantly decreased in atr but not in dmc1 mutants. (Error bars represent standard

deviation; * p<0.05; Wilcoxon-Mann-Whitney test; Size bars: 10 m)


4

Supplementary Figure 3. Synaptonemal complex formation in atr rad51.

Staining for the synaptonemal complex protein ZYP1 showed normal progression of

synapsis in atr rad51 mutant meiocytes. (Size bar: 10 m)


5

Supplementary Figure 4. Antibodies and statistics.

(A) Immunoblot analysis to confirm the specificity of Arabidopsis -RAD51 and -

DMC1 antibodies that have been used for immune-histochemistry. The -DMC1

antibody detects the N-terminus of recombinant Arabidopsis DMC1 and does not

detect recombinant full-length Arabidopsis RAD51. The -RAD51 antibody detects

full-length recombinant RAD51, only shows a very weak residual binding to the

recombinant DMC1 C-terminus protein fragment and does not detect the RAD51 N-

terminus (data not shown).

(B) Monte-Carlo simulations for two further individually scored cells to determine the

expected random frequency of co-localisation of RAD51 and DMC1 foci. In all cases,

the numbers for the observed co-localising RAD51/DMC1 foci (R/D foci) were

significantly lower than the simulated numbers of randomly co-localising events.


6

Supplementary Figure 5. RAD51, DMC1 and H2Ax localisation in meiocytes.

Additional images of nuclear spreads of wild-type leptotene PMCs with RAD51 (red),

DMC1 (green) and H2Ax (blue) detected by immunofluorescence (please refer to

Figure 3 for picture details). (Size bar: 10 m)


7

Supplementary Table 1 – Inter-foci distances

The differences between observed inter-foci distances of different foci classes were

evaluated by two different methods (see below) and were found to not significantly

differ from each other (RD –RAD51 and DMC1 doublet; DD – DMC1 doublet; RR –

RAD51 doublet).

A) Fisher's Exact Test with two distance classes between foci

nm RR RD DD

0-150 7 12 4

150-450 65 89 50

Total 72 101 54

Fisher's Exact Test

p-value

RR vs RD 0,8064

DD vs RD 0,5804

RR vs DD 0,7568

B) Mann-Whitney Test for comparison of (non-parametric) distribution

nm RR RD DD

0-50 0 0 0

50-100 0 2 0

100-150 7 10 4

150-200 6 13 13

200-250 19 13 5

250-300 11 10 8

300-350 10 14 8

350-400 11 19 6

400-450 8 20 10

Mann-Whitney Test for comparison of (non-

parametric distribution)

p-value

RR vs RD 0,1978

DD vs RD 0,06191

RR vs DD 0,4227


8

Supplementary Table 2 – Primer information

primer name sequence 5' - 3'

atr-2 wild-type allele

atr2_1 GGATCAAGTACTACTGACTCAG

atr2_3 CAACTCATTTTGAATATGAGAG

atr-2 mutant allele

atr2_1 GGATCAAGTACTACTGACTCAG

SALK LBa1 TGGTTCACGTAGTGGGCCATCG

rad51-1 wild-type allele

pcr_atrad51_1 GGTTCCATCACGGAGTTATATGG

pcr_atrad51_2 AGCCATGATATTCCCACCA ATC

rad51-1 mutant allele

rad51TDNA CCCATTTGGACGTGAATGTAGACAC

rad51gen GCAGGTATTGCTTCTGTTGATGTA

dmc1 wild-type allele

atdmc1_a CCTGCAATGGTCTCATGATGCATAC

atdmc1_d ACTAATCCTTCGCGTCAGCAATGC

dmc1 mutant allele

atdmc1_d ACTAATCCTTCGCGTCAGCAATGC

Feldmann LB GATGCAATCGATATCAGCCAATTTTAGAC

asy1 wild-type allele

Asy1_new_LP TCATGACATCTTGGCTGTCAG

Asy1_new_RP GTGATGGCTCAGAAGCTGAAG

asy1 mutant allele

Asy1_new_RP GTGATGGCTCAGAAGCTGAAG


atrip wild-type allele

ATRIP_LP TACGGGATAATCTTGTGGCTG

ATRIP_RP ACCGAACAGGATGTGAAACAG

atrip mutant allele

ATRIP_RP ACCGAACAGGATGTGAAACAG


cDNA

atrad51-E1-dn GTCCAACAACAAGACGATGAAGA

atrad51-E3-up CTTTATCGAGCTCCCGTGATCCAG

DNA gel blot

RAD51_probe_dn ATCGCGATGTGAAATAGGTGTG

RAD51_probe_up CTCCTTGATCCATGG GAAGCT

construction of expression plasmids

DMCstart103FWD7 ATAGAATTCATGTCAGTTGTAAAAATCACTACAG

DMCstartallREV8 ATACTGCAGCTAATCCTTCGCGTCAGC

DMC1stop103FWD1 CTTATAAAGAGGAAATAAGTTGTAAAAATC

DMC1stop103REV2 GATTTTTACAACTTATTTCCTCTTTATAAG


9

RAD51stop98FWD1 CTCCATGCTCAGTGACAGGAAATT

RAD51stop98FWD2 AATTTCCTGTCACTGAGCATGGAG

Supplementary methods

Mutant plant line

atrip/suv2-2 (SALK_077978; Sakamoto et al. 2009).

Primer information

Primer for the amplification of RAD51 cDNA were atrad51-E1-dn, binding within exon

1, together with atrad51-E3-up, binding within exon 3 and pcr_atrad51_1, binding

within exon 4, together with pcr_atrad51_2, binding within exon 8. The probe used

for the DNA gel blots was generated by PCR using the primer pair RAD51_probe_dn

and RAD51_probe_up (Supplementary Table 2).

Reverse transcription PCR

Total RNA was isolated from plants using Promega’s SV Total RNA Isolation System

according to the manufacturer’s protocol. cDNA synthesis was conducted with the

iScript cDNA synthesis kit (Biorad). Amplification of cDNA was performed with the

primer pairs given above under standard PCR conditions.

Verification of the rad51-1 mutant allele by DNA gel blot analysis

The presence of the atr-2 and rad51-1 mutant alleles in generations F3 and F4 was

verified via DNA gel blotting. Two inflorescences per plant were homogenized in

Urea Lysis buffer (0.3M NaCl, 30mM Tris-Cl pH8, 20mM EDTA pH8, 1% (w/v) N-

Lauroylsarcosine, 7M Urea) using plastic pestles (Sigma) and incubated at 50°C for

10 minutes. After extraction with PCI (Biomol) and centrifugation (5min, 14000rpm,

RT), the upper phase was recovered and DNA was precipitated with 3M NaOAc

pH5.2 and isopropanol. After washing with 70% EtOH, the pellet was air-dried and

re-suspended in ddH2O. DNA concentration was estimated on a 1% agarose gel and

500ng of DNA were digested overnight in a volume of 100 l using 20 units of BsrGI

restriction endonuclease (Fermentas). RNA was removed by treatment with 1 l

RNaseA (500 g/ml, Roche) at 37°C for 1 hour. DNA was precipitated with 3M

NaOAc pH5.2 and 96% EtOH at -20°C. After centrifugation, the pellet was washed

with 70% EtOH, dried, re-suspended and loaded onto a 0.8% agarose gel. DNA

fragments were separated at 80V. The gel was de-purinated in 0.25M HCl and after

washing, it was neutralized in 0.5M NaOH/1.5M NaCl, followed by equilibration in


10

0.5M Tris/1.5M NaCl pH7. DNA was transferred in 20x SSC (3M NaCl, 0.3 M

Na3Citrat) overnight to a Nylon membrane (Hybond-N, Amersham). Crosslinking was

performed in a Strata crosslinker (UV StratalinkerTM 2400, Stratagene) using the

autocrosslink program. Afterwards, the membrane was air-dried.

Probes were labeled with 50 Ci [ 32P] dATP by Klenow polymerase (10u/ l, MBI

Fermentas). Un-incorporated nucleotides were removed using the QIAquick

Nucleotide Removal Kit (QIAGEN). The membrane was pre-hybridized with Church

& Gilbert buffer (1% [w/v] BSA, 1mM EDTA, 7% [w/v] SDS, 0.5M phosphate buffer

pH7.2). After addition of the radioactively labeled probe, the membrane was

hybridised overnight at 65°C, washed twice with 2x SSC/0.1%SDS and once with 1x

SSC/0.1%SDS for 30minutes. After washing, the membrane was sealed into a

plastic bag and detection was accomplished on a Phosphor Screen (Kodak) in a

Biorad Molecular Imager FX Pro Plus.

Generation of RAD51 and DMC1 expression constructs

The coding sequence (CDS) of Arabidopsis RAD51 was cloned in frame into pET28a

(Merck) using EcoRI restriction sites. The CDS of Arabidopsis DMC1 was cloned in

frame into pET28a using the restriction sites EcoRI and XhoI. The ATPase domain

(C-terminal; amino acid residues 104-344) of DMC1 was amplified by PCR using the

primer DMCstart103FWD7 and DMCstartallREV8 with KOD DNA Polymerase

(Novagen). Each primer included either an EcoRI or a PstI restriction site. The C-

terminal domain of DMC1 was then cloned in frame into the vector pMAL-TEV/6xHIS

(this vector is a modified version of the NEB pMAL-c2 plasmid with a TEV protease

cleavage site instead of the factor Xa site and an additional 6xHIS-tag, inserted in the

SacI site upstream of the TEV site).

In order to construct the expression plasmids for the N-terminal domains of DMC1

(amino acid residues 1-103) and RAD51 (amino acid residues 1-98), respectively, in

vitro mutagenesis was conducted. The above mentioned vector pET28a/DMC1 was

utilised as a template for PCR amplification using recombinant Pfu DNA Polymerase

(Fermentas) with primer DMC1stop103FWD1 and DMC1stop103REV2. For

generating an overexpression plasmid of the N-terminal domain of RAD51, the

plasmid pET28a/RAD51 served as a template for PCR amplification using

recombinant Pfu DNA Polymerase (Fermentas) with primer RAD51stop98FWD1 and

RAD51stop98FWD2. The four primer mentioned above were designed to insert a

stop codon at the end of the N-terminal domains. After amplification, the PCR

products were incubated with DpnI for 3 hours and transformed into chemically


11

competent E.coli DH5alpha cells. All amplicons generated by PCR were sequenced

to confirm error-free amplification (LGC Genomics).

Expression and purification of recombinant proteins for Immunoblot analysis

The plasmids containing full-length DMC1, full-length RAD51 or the C-terminal and

the N-terminal domains of DMC1 and RAD51, respectively, were transformed into

chemically competent Rosetta(DE3)pLysS cells (Merck). A single colony was

inoculated in 2 liters of 2xTY liquid media (16g/l peptone, 10g/l yeast extract, 5g/l

NaCl) and the culture was grown at 37°C until an OD600 of about 0.7 was reached.

1mM Isopropyl- -D-thiogalactopyranosid (IPTG) was added and after 3 hours the

cells were harvested by centrifugation (5000 g, 30', 4°C). The cell pellet was frozen

at -20°C and thawed on ice. Subsequent resuspension of the pellet in ice cold buffer

A (one gram pellet per 5ml of 50mM phosphate buffer pH 8, 500mM NaCl, 2mM beta

Mercaptoethanol, 0.05% NP-40, complete Mini EDTA-free, Roche) was followed by

sonication on ice and an additional round of centrifugation (20000 g, 30', 4°C) yielded

a precleared lysate that was incubated with Ni-beads (Profinity IMAC Ni-charged

resin, Biorad) for 1h at 4°C. The Ni-beads were washed three times with buffer A and

the recombinant 6xHIS-tagged proteins were eluted with 1M Imidazole pH8 in buffer

A. The purity and concentration of the recombinant proteins in the eluates were

analysed by SDS-PAGE using Coomassie staining and Bradford assay according to

standard techniques.

Generation of an antibody directed against Arabidopsis RAD51 ( -RAD51*)

The His-tagged full length Arabidopsis RAD51 protein was expressed and isolated as

described above with the modification that after sonication and subsequent

centrifugation the pellet and not the precleared lysate was used to purify the

recombinant RAD51 protein. To this end the inclusion bodies of the pellet were

resolubilised in buffer A containing 5M Guanidinium chloride and the protein solution

was incubated with Ni-beads for 4 hours at room temperature. After elution with 1M

Imidazole in buffer A containing 5M Guanidinium chloride, the RAD51 protein was

dialysed stepwise against decreasing concentrations of Guanidinium chloride (3M,

1.5M, 0M) in buffer A at 4°C, with buffer changes every 8 hours. After removal of

Imidazole and Guanidinium chloride the protein solution was concentrated with the

help of Vivaspin 20 10,000 MWCO PES centrifugal concentrators (Sartorius Stedim

Biotech) and gel filtration was performed using an ÄKTA FPLC system and a

Superdex 200 16/60 column (GE Healthcare Life Sciences). The fractions that


12

contained the His-tagged RAD51 protein were pooled and approximately 0.5 mg of

the affinity purified recombinant protein was used for antibody production performed

by Eurogentec (Belgium).

Immunoblot analysis

Recombinant proteins (10 ng of purified protein per lane) were separated by SDS-

PAGE and blotted onto a PVDF membrane using standard techniques. The

membrane was blocked with 3% milk (Nonfat dried milk powder; AppliChem) in TBS-

T (10mM Tris/HCl pH 7.5, 150 mM NaCl, 0.05% Tween20) for 1h and incubated for

1h with 1:1000 dilution of anti-DMC1 antibody from rabbit or 1:100 dilution of anti-

RAD51 antibody from rat or 1:5000 dilution of anti-RAD51* antibody from rat in TBS-

T/3% milk. Commercially available secondary antibodies coupled to HRP and

directed against rabbit (1:2000, HP1202, Hycult biotech) or rat (1:5000, ECL Anti-rat

IgG, HRP linked AB, GE Healthcare) were used to detect the recombinant proteins

on the membrane with the help of HRP reagent (Pierce ECL Western Blotting

substrate, Thermo Scientific). The calculated molecular weight is 41,4 kDa for

6xHIS/DMC1, 41,2 kDa for 6xHIS/RAD51, 74,2 kDa for MBP/6xHIS/DMC1 C-term,

15,4 kDa for 6xHIS/DMC1 N-term and 14,6 kDa for 6xHIS/RAD51 N-term.

supplemental data. kurzbauer et al. (2012). plant cell 10 ... · supplemental data. kurzbauer et...

Documents