summerschool 2006 - uni-heidelberg.de · 2011-12-14 · 1 summerschool 2006 for clinical...
TRANSCRIPT
1
Summerschool 2006
for
Clinical Periodontology and Implantology held by
University of Heidelberg in cooperation with
University of Rochester, New York (USA) Ramban Medical Center, Haifa (Israel)
University of Cologne, University of Frankfurt University of Freiburg
This project was sponsored by: German Society of Operative Dentistry, New Working Group for Periodontology
GABA, Sirona, Dentsply-Friadent, Gore, Straumann, NobelBiocare
2
ContentsContentsContentsContents 1. Foreword………………………………………………………………….……………....... 3 2. Introduction………………………………………………………………………...…...... 4 2.1. Lecturers and Instructors………………………………………………… 4 2.2. Participants………………………………………………………………….... 8 3. Schedule/Topics……………………………………………………………………....... 12 4. Pictures of the Events…………………………………………………………..…...... 17 5. Evaluation…………………………………………………………………..……….......... 54 5.1 Evaluation…………………………………………………………………...... 54 5.2 Comments……………………………………………….. ……..…….…..... 63 6. Final Reports of some participants……………. ..………………….………….. 68 6.1 Dr. Frange´s Final Report………………………………………………… 68 6.2 Dr. Garcia´s Final Report………………………………………………… 71 6.3 Dr. Corraini´s Final Report……………………………………………… 74 6.4 Dr. Kim´s Final Report……………………………………………………. 77 6.5 Dr. Djuric´s Final Report………………………………………………… 79 6.6 Dr. Fukuda´s Final Report……………………………………………… 80
3
1. Forward
The second international Summerschool for clinical periodontology and implantology in Heidelberg- what does it mean to me? First of all, it was one step closer to my goal to create a forum where the researchers and clinicians can exchange their experiences and ideas for their future networks. It has been a great experience to me to spend 2 weeks with so interested, ambitious and enthusiastic students with such a strong will to gain more knowledge in periodontology and implantology. One of my former students said: “The experience I had two years ago in Heidelberg has changed my point of view in many things…” What more can I expect as a teacher and a program director? Beside the academic program the central focus is placed on cross-cultural understanding. You all started on Monday of the first week as strangers and you finished the summerschool after 2 weeks as friends. This is something you have to experience on your own otherwise, you can hardly understand it as you can´t just learn it by reading a book. The 2 weeks you spent together here made you very special to each other and having friends all over the world sharing the same vision should encourage you to carry out your own project (teaching or researches) networking with your new friends. So it was a fulfilling task for me to see how you all “grew” academically and socially during the 2 weeks. Thank you for joining us for two wonderful weeks and I hope to keep in touch with you in forms of Alumni Meetings!
PD Dr. med. Dr. med. dent. Ti-Sun Kim
Program director and project manager
4
2. Introduction2. Introduction2. Introduction2. Introduction 2.1. Lecturers and Instructors2.1. Lecturers and Instructors2.1. Lecturers and Instructors2.1. Lecturers and Instructors Program director and Project manager, LecturerProgram director and Project manager, LecturerProgram director and Project manager, LecturerProgram director and Project manager, Lecturer,,,, University of HeidelbergUniversity of HeidelbergUniversity of HeidelbergUniversity of Heidelberg
PPDD DDrr.. mmeedd.. DDrr.. mmeedd.. ddeenntt.. TTii--SSuunn KKiimm Medical Assistant Director of the Dept. of Operative Dentistry and Periodontology at the University of Heidelberg and Private Practice for Periodontology since 2000 October 1985 - December 1991: Dental School at the University of Heideberg, 1992 Doctoral thesis in dentistry (Dr. med. dent.); October 1987 - Oktober 1996: Medical School at the University of Heidelberg, 1995-1996 Internship in General Surgery, Internal Medicine and Oral- and Maxillofacial Surgery at the University of Heidelberg; 1998 Doctoral thesis in Medicine (Dr. med.), since May 1992: Scientific fellow and Assistant Professor at the Dept. of Operative Dentistry and Periodontology of the University of Heidelberg; 1998 Approved Specialist for Periodontology of the German Society of Periodontology (DGP)
Lecturers InternatioLecturers InternatioLecturers InternatioLecturers Internationalnalnalnal
PPrrooff.. DDrr.. EEllii EE.. MMaacchhtteeii Ramban Medical Center, Haifa (Israel) Associate Professor, Faculty of Medicine at the Technion 1979 DMD from Hebrew University, Jerusalem 1982 Advanced graduate studies in Periodontology at Boston University 1982 Faculty of Dentistry at the Hebrew University and Hadassah Medical Center in Jerusalem; 1989 Visiting Associate Professor at the Periodontal Research Center, Department of Oral Biology, at the State University of New York, Buffalo;1994 Establishment of the Unit of Periodontology at the Rambam Medical Center in Haifa 1996 Faculty of Medicine at the Technion as an Adjunct Senior Lecturer; (1996), Adjunct Senior Teaching Fellow (1999) and currently an Associate
Professor (2002
PPrrooff.. DDrr.. JJaacckk CCaattoonn Professor of Dentistry, Program Director of the Advanced Training Program in Periodontics, and Chair of the Division of Periodontics, Eastman Department of Dentistry, School of Medicine and Dentistry, University of Rochester, in Rochester, New York; Diplomate and former Chairman of the American Board of Periodontology; Past President of the American Academy of Periodontology; serves as an editorial consultant to several national and international periodicals; an Associate Editor of the Journal of Periodontology; a Commissioner to the Commission on Dental Accreditation of the American Dental Association; D.D.S. from the University of California Dental School, San Francisco; M.S. from the University of Rochester and a Periodontology Specialty Certificate from Eastman Dental Center; a private periodontal practice is located in Rochester, New York.
5
PPPPPPPPrrrrrrrrooooooooffffffff........ DDDDDDDDrrrrrrrr........ PPPPPPPPaaaaaaaauuuuuuuullllllll RRRRRRRRoooooooommmmmmmmaaaaaaaannnnnnnnoooooooo
Assistant Professor; Eastman Department of Dentistry; University Rochester Medical Center; Co-Director, Dental Implant Training , Division of Periodontology; Private Practice, Limited to Periodontics and Dental ImplantsPresident-Elect, Monroe County Dental Society; Chairman, Ethics Committee; Research Submissions Subcommittee, American Academy of Periodontology of Periodontology; 1999 to Present: Eastman Dental Center, Division of Periodontology Rochester, NY Associate Professor ;
1997 to Present: Jack G. Caton, D.D.S., Timothy M. Blieden, D.D.S. Rochester, NY and Paul R. Romano, D.D.S., P.C. – Principal Partner Periodontist in group private practice;
1988 to 1992: New York University College of Dentistry New York, NY Research Associate Department of Oral Medicine and Pathology 1985 to 1992: William J. Lossef, D.D.S. and Paul R. Romano, D.D.S. New York, NY Principal partner of private general dental practice.
LeLeLeLecturers nationalcturers nationalcturers nationalcturers national
PPPPPPPPrrrrrrrrooooooooffffffff........ DDDDDDDDrrrrrrrr........ mmmmmmmmeeeeeeeedddddddd........ ddddddddeeeeeeeennnnnnnntttttttt........ PPPPPPPPeeeeeeeettttttttrrrrrrrraaaaaaaa RRRRRRRRaaaaaaaattttttttkkkkkkkkaaaaaaaa--------KKKKKKKKrrrrrrrrüüüüüüüüggggggggeeeeeeeerrrrrrrr Assistant Director (University of Freiburg) 1980 – 1985 Undergraduate Dental Education University of Frankfurt, School of Dentistry Frankfurt, Germany, Doctor of Dental Surgery, 1985 – 2001 University of Frankfurt, School of Dentistry, Department of Periodontology, Scientific fellow, Clinical Instructor, Senior Clinical Instructor, 1993 Accredited specialist of the German Society of Periodontology, 1997 Ph.D., Since 2001 University of Freiburg, School of Dentistry Department of Operative Dentistry and Periodontology, Senior Clinical Instructor; Main Interest: Mucogingival Pathology and Regeneration
6
DDDDDDDDrrrrrrrr........ mmmmmmmmeeeeeeeedddddddd........ ddddddddeeeeeeeennnnnnnntttttttt........ JJJJJJJJöööööööörrrrrrrrgggggggg NNNNNNNNeeeeeeeeuuuuuuuuggggggggeeeeeeeebbbbbbbbaaaaaaaauuuuuuuueeeeeeeerrrrrrrr University of Köln, , , , Director of Clinical Research (DENTSPLY FRIADENT GmbH); ; ; ; 1984-1989 Dental School, University Heidelberg 1990 Graduation as Dentist, 1991 PhD 1990 Scientific Information / Education Program by FRIATEC AG, Mannheim, Head of Training Center in Mannheim 1992 Head of education program in Germany for FRIATEC AG 1995 Head of Product development and Positioning, FRIATEC AG 2001 Security Manager for Medical devices, FRIADENT GmbH 2001 Director Clinical Research, FRIADENT GmbH, Since 2001: Resident, Dept. of Dental Surgery and Oral-,Maxillo- and Plastic Facial Surgery of University of Cologne
PPPPPPPPrrrrrrrrooooooooffffffff........ DDDDDDDDrrrrrrrr........ mmmmmmmmeeeeeeeedddddddd........ ddddddddeeeeeeeennnnnnnntttttttt........ PPPPPPPPeeeeeeeetttttttteeeeeeeerrrrrrrr EEEEEEEEiiiiiiiicccccccckkkkkkkkhhhhhhhhoooooooollllllllzzzzzzzz 1982-1987 Dental School at the University of Cologne; 1988-1989 Military service in the Dental Corps; 1989 Dr. med. dent.; 1989-1992 Scientific fellow and postgraduate education in Periodontology at the Dept. of Periodontology, University of Münster; since 1992 Scientific fellow, since 1995 Instructor and Assistant Professor, Ph.D. 1997; 1994 Approved Specialist for Periodontology of the German Society of Periodontology (DGP); Editorial Board of Dento- maxillofacial Radiology, Advisory Board of Deutsche Zahnärztliche Zeitschrift; Main Interest: Diagnosis and Therapy of Furcation Involvement, Computer assisted Radiography, Regenerative Therapy (GTR), Local Antibiotic Therapy, since 2004 director of the department of periodontology at the University of Frankfurt
DDDDDDDDrrrrrrrr........ mmmmmmmmeeeeeeeedddddddd........ ddddddddeeeeeeeennnnnnnntttttttt........ HHHHHHHHeeeeeeeellllllllmmmmmmmmuuuuuuuutttttttt SSSSSSSStttttttteeeeeeeevvvvvvvveeeeeeeelllllllliiiiiiiinnnnnnnngggggggg Assistant Director at the Department of Oro-Maxilla-Facial-Surgery 1974 Graduation from highschool (Abitur); 1977-1982 Apprentiship as dental technician; 1977-1982 Student at the Dental University of Würzburg; 1983 Doctorate Dr. med. dent. University of Würzburg; 1982-1985 Dept. of Dental Prosthetics at the University of Würzburg; 1985-1992 Dept. of Oral and Maxillofacial Surgery at the University of Würzburg; since 1992 Dept. of Oral and Maxillofacial Surgery at the University of Heidelberg; since 1987 Use of different dental implants; since 1992 User of the Astra Tech Dental Implant System, University of Heidelberg
7
JJJJJJJJuuuuuuuunnnnnnnniiiiiiiioooooooorrrrrrrr IIIIIIIInnnnnnnnssssssssttttttttrrrrrrrruuuuuuuuccccccccttttttttoooooooorrrrrrrrssssssss ZÄ. RRRRRRRRaaaaaaaalllllllluuuuuuuuccccccccaaaaaaaa CCCCCCCCoooooooossssssssggggggggaaaaaaaarrrrrrrreeeeeeeeaaaaaaaa ZA SSSSSSSSvvvvvvvveeeeeeeennnnnnnn ZZZZZZZZeeeeeeeehhhhhhhhaaaaaaaacccccccczzzzzzzzeeeeeeeekkkkkkkk
Helpers: Research studentsHelpers: Research studentsHelpers: Research studentsHelpers: Research students Cand.med.dent. HHHHHHHHeeeeeeeellllllllggggggggaaaaaaaa FFFFFFFFiiiiiiiisssssssscccccccchhhhhhhheeeeeeeerrrrrrrr Cand.med.dent. NNNNNNNNiiiiiiiillllllllssssssss ZZZZZZZZiiiiiiiimmmmmmmmmmmmmmmmeeeeeeeerrrrrrrrmmmmmmmmaaaaaaaannnnnnnnnnnnnnnn
8
22222222........22222222........ PPPPPPPPaaaaaaaarrrrrrrrttttttttiiiiiiiicccccccciiiiiiiippppppppaaaaaaaannnnnnnnttttttttssssssss
Ilana Jerša Ilana Jerša Ilana Jerša Ilana Jerša Ma.Celina Petronila u.Garcia Ma.Celina Petronila u.Garcia Ma.Celina Petronila u.Garcia Ma.Celina Petronila u.Garcia Alexandrina L. DumitrescuAlexandrina L. DumitrescuAlexandrina L. DumitrescuAlexandrina L. Dumitrescu Latvia; Riga; LV-1019; Philippines; Ermita, Manila 1000 Romania; Bucharest; ROU61572 Lubanas Street 10 *(632)524-9719 su-th Str.Aleea; Dumbravita Nr.2, *+371 6341894 *(6349)536-3946 fr-sat Bloc 28, Scara B, Etaj 1, AP 49 *+371 6341894 *(63917) 916-6202 *0040 21 7450457 *+371 781 5323 *(632) 302- 3983 *0040 722 352504 [email protected] [email protected] *0040214114280 [email protected]
Nikolina Trupeljak Nikolina Trupeljak Nikolina Trupeljak Nikolina Trupeljak Jin Uk, Kim Jin Uk, Kim Jin Uk, Kim Jin Uk, Kim Priscila CorrainiPriscila CorrainiPriscila CorrainiPriscila Corraini Croatia; Zagreb 10040 The republic of korea; Taejeon Brasil; Sǎo Paulo 05464-000 Novoselečki Put 40 *082- 41- 632- 4545 Umburanas Street 912 *+385-1-2984107 *062- 18- 426- 1526 * (5511)30225523 *+385-91-5350686 [email protected] * (5511)81226428 *+385-1-2984448 * (5511)30225523 [email protected] [email protected]
9
Laurina Zane Laurina Zane Laurina Zane Laurina Zane Gary Itkin Gary Itkin Gary Itkin Gary Itkin Melanie Ruth Karganilla FrangeMelanie Ruth Karganilla FrangeMelanie Ruth Karganilla FrangeMelanie Ruth Karganilla Frange Latvia; Jelgava LV3008; Latvia; Jurmala LV-1018 Philippines; Taguig 1630 Tervetes Street 134/136 Kauckišu 14 A; Lot 10 Block 42; G. Juliano St. * 371-9485-495 *+371 9298953 Phase 3 AFPOVAI West * 371-9485-495 *+371 9298953 Bicutan * 371 -7815-323 *+3717761002 * 632-8405335 [email protected] [email protected] * 63917-5381468 * 632-3023983 [email protected]
Young Taek, KimYoung Taek, KimYoung Taek, KimYoung Taek, Kim Zeljka KojiZeljka KojiZeljka KojiZeljka Kojië Inguna GrinvaldeInguna GrinvaldeInguna GrinvaldeInguna Grinvalde The republic of korea; Seoul Bosnia and Herzegovina Latvia; Riga LV-1012 College of dentistry, Pale 71420; Brivibas Iela 129-4 Yonset University, Trifka Grabeza 115 *+371 7362529 134 Shinchon- Seodaemun *+387 51 216 526 *+371 9463053 *082-2-2228-8825 *+387 65 521 747 *+371 781 5323 *082-11-214-7194 *+387 51 216 525 [email protected] *082-2-392-0398 [email protected] [email protected]
10
Nedzad TahmiscijaNedzad TahmiscijaNedzad TahmiscijaNedzad Tahmiscija Cassia Tiemi FukudaCassia Tiemi FukudaCassia Tiemi FukudaCassia Tiemi Fukuda Milanko DjuricMilanko DjuricMilanko DjuricMilanko Djuric Bosnia and Herzegovina Brazil; Campinas; 13098-340; Serbia and Montenegro; Sarajevo; Z 1000; Kecina 6 Rua Maruba 592 Novi Sad; 21000 * 387- 33- 537- 784 *55-19-32620295 Stenava Branovačkog 6 A [email protected] *55-11-83813303 *+381 21 457- 193 *55-19-32620295 *+381 63-85-99-400 [email protected] *+381 21 6613 362 [email protected]
Sanja JurišiSanja JurišiSanja JurišiSanja Jurišić GiedrGiedrGiedrGiedr÷ Machityt Machityt Machityt Machityt÷
Bosnia and Herzegovina ; Mostar Lithuania; Vilnius; 2016; Ak. Ivana Zovke 9 Nugaletoju 18 A * 00387-36325588 *+37069904278 * 00387-63-382220 [email protected] * 00387-36-333183 [email protected]
11
What a class...!
12
3. Schedule/Topics3. Schedule/Topics3. Schedule/Topics3. Schedule/Topics Week 1Week 1Week 1Week 1
Monday July 31st
08:30 am - 09:00 am Welcome and Introduction of the lecturers
09:00 am - 09:30 am Introduction of the participants
09:30 am - 11:00 am Orientation&Introduction of the Dental Hospital, walk
through the Hospital
11:00 am – 11:30 am Break
11:30 am - 12:30 am Etiology and Pathogenesis of periodontal disease
12:30 am - 01:30 pm lunch break
01:30 pm - 02:15 pm Classification of periodontal diseases; Part I
02:15 pm - 03:00 pm Classification of periodontal diseases; Part II
03.00 pm - 03.30 pm Break
03:30 pm - 04:15 pm Clinical periodontal diagnosis & Microbiological
diagnosis
04:15 pm - 05:00 pm City and the University of Heidelberg
Welcome-Party in the Tropical House (Botanical Garden) of the
University of Heidelberg
Tuesday August 1st
08.30 pm - 09.00 pm Antiinfective therapy at the University of Heidelberg
09:00 am - 09:30 am The principle of full mouth disinfection
09:30 am - 10:00 am Debridement: by hand or by machine?
10:00 am - 10:30 am Break
10:30 am - 11:00 am Scaling and rootplanning
11:00 am - 11:30 am Non-surgical or surgical periodontal therapy?
11:30 am - 12:00 pm Periodontal surgery: flap techniques
12:00 pm - 01:00 pm Lunch break
13
01.00 pm - 03.00 pm Hands-on (pig jaw): Periodontal flap surgery (Kirkland
flap, modified Widman flap, distal wedge, papilla
preservation flap)
03:00 pm Excursion to Bensheim to the Sirona Company
with dinner invitation
Wednesday August 2nd
08:30 am - 09:00 am Fundamentals of setting implants
09:00 am – 09:45 am Is immediate loading possible?
09:45 am - 10:15 am coffee break
10:15 am – 11:00 am Immediate loading in combination with augmentation,
an overview of the literature
11:00 am - 11:30 am Presentation Implant System XIVE
12:15 pm - 01:15 pm lunch break
01:15 pm - 03:00 pm Hands-on Placement of Implants; Xive, Ankylos
03:45 pm - 04:45 pm The role of the marginal bone level in implantology
15 years of follow up
Thursday August 3rd
08:30 am - 09:15 am Etiology and Diagnosis of Furcation Involvement
09:15 am - 10:30 am Fundamental periodontal therapy I – resective therapy,
flap procedures
10:30 am - 11:00 am Coffee break
11:00 am - 12:30 pm Fundamental periodontal therapy II– scaling and root
planing
12:30 pm - 01:30 pm Lunch Break
01:30 pm - 02:30 pm Anatomy and Physiology of Bone, Cementum, and
PDL, Woundhealing
02:30 pm - 03:15 pm Is periodontal regeneration possible?
Indication for GTR
14
03:30 pm - 08:00 pm Ludwigsburg (Castle of Ludwigsburg)
Friday August 4th
08:30 am - 09:00 am Non- resorbable and biodegradable barriers
09.00 am- 10.30 am Hands-on “treatment of furcation involvement”; GTR
with membrane,
10:30 am - 11:00 am coffee break
10:30 am – 12:30 pm Fundamental periodontal therapy III–regenerative
methods
12:30 pm - 01:30 pm Lunch Break
Week 2Week 2Week 2Week 2
Monday August 7th
08:30 am – 10:00 am Sinus lifts – different approaches, clini. Outcomes
10:00 am – 10:30 am Break
10:30 am – 11:30 am Biology of Osseointegration
11:30 am - 12:30 am Treatmentplanning / Treatmentprotocol of setting
Implants at Eastman Dental
12:30 pm – 01:30 pm lunch break
01:30 pm - 03:00 pm Anti-Inflammatory Drugs
03:30 pm Tour to Speyer
Tuesday August 8th
08:30 am - 09:30 am Antibiotics in Periodontology I
09:30 am - 10:30 am Aggressive Periodontitis
10:30 am - 11:00 am Break
11:00 am - 12:30 pm Therapy of Aggressive Periodontitis
12:30 pm - 01:30 pm Lunch Break
15
01:30 pm - 02:15 pm international multicenter Study:
treatment of the edentulous maxilla
clinical approach to Osseospeed
02:15 pm - 02:45 pm Break
02:45 pm - 04:30 pm Periodontal Medicine I
Wednesday August 9th
08:30 am – 09:15 am The mucogingival complex
Gingival recession and mucogingival problems
09:30 am – 10:30 am Diagnosis and classification of gingival recession
Indications for root coverage
10:30 am – 11:30 am Rotational flaps, advanced flaps
Free gingival grafts
Connective tissue grafts
11:30 am - 12:30 am Regeneration of the papilla; Excision of frenulas
12:30 am – 01:30 pm lunch break
01:30 pm – 16:30 pm Mucogingival surgery (Hands on)
• Laterally positioned flap
• Coronally positioned flap
• Free gingival graft
• Connective tissue
graft-envelope technique
04:30 pm – 05:00 pm Postoperative care program
Thursday August 10th
08:30 am - 10:00 am Seminar, interactive
10:00 am – 10:30 am Break
11:00 pm - 11:30 pm Regenerative Therapy and growth factors
16
11:30 pm – 12:30 pm Hands-on RT with Emdogain
12:30 pm - 01:30 pm lunch break
01:30 pm – 03:30 pm Hands-on Straumann Implants
03:30 pm Neckar – River - Cruise
Friday August 11th
08:30 am - 10:30 am Hands-on Nobel-Direct Implants
10:30 am – 11:00 am Break
11:15 am - 12:30 am Periodontal medicine II
12:30 pm – 01:30 pm Final lecture – Where are we going?
Implants or teeth?
17
4. Pictures of selected events4. Pictures of selected events4. Pictures of selected events4. Pictures of selected events Monday, July 31Monday, July 31Monday, July 31Monday, July 31stststst First meeting in the lecture room receiving the scheFirst meeting in the lecture room receiving the scheFirst meeting in the lecture room receiving the scheFirst meeting in the lecture room receiving the schedulesdulesdulesdules
..afterwards, walk through the hospi..afterwards, walk through the hospi..afterwards, walk through the hospi..afterwards, walk through the hospital with Dr. Zehaczektal with Dr. Zehaczektal with Dr. Zehaczektal with Dr. Zehaczek
18
….just arrived ….just arrived ….just arrived ….just arrived at at at at the first floor……the first floor……the first floor……the first floor……
..to visit the orthodontic surgery..to visit the orthodontic surgery..to visit the orthodontic surgery..to visit the orthodontic surgery
19
…the caravan pushes along….…the caravan pushes along….…the caravan pushes along….…the caravan pushes along….
…and finally …and finally …and finally …and finally back to the lecturers room for the first lectures.back to the lecturers room for the first lectures.back to the lecturers room for the first lectures.back to the lecturers room for the first lectures.
20
WelcomWelcomWelcomWelcome party in the Tropical House (Botanical Garden) of the Universitye party in the Tropical House (Botanical Garden) of the Universitye party in the Tropical House (Botanical Garden) of the Universitye party in the Tropical House (Botanical Garden) of the University
of Heidelbergof Heidelbergof Heidelbergof Heidelberg
Surrounded by gorgeous plants from all over the worldSurrounded by gorgeous plants from all over the worldSurrounded by gorgeous plants from all over the worldSurrounded by gorgeous plants from all over the world….….….….
… … … …the the the the participants from all over the world…..participants from all over the world…..participants from all over the world…..participants from all over the world…..
21
..… get to know each other ……. ..… get to know each other ……. ..… get to know each other ……. ..… get to know each other …….
……….while enjoying ……….while enjoying ……….while enjoying ……….while enjoying a delicious suppera delicious suppera delicious suppera delicious supper....
22
23
Tuesday, August 1Tuesday, August 1Tuesday, August 1Tuesday, August 1stststst
Hands-on (pig jaws): Peridontal flap surgery with Professor EickholzPeridontal flap surgery with Professor EickholzPeridontal flap surgery with Professor EickholzPeridontal flap surgery with Professor Eickholz. Participants preparing Kirkland flaps, modified Widman flaps, Distal wedges and papilla preservation flaps.
24
…and afterwards: Excursion to Bensheim to the Sirona Dental CompanySirona Dental CompanySirona Dental CompanySirona Dental Company with dinner invitation.
25
Wednesday, August 2Wednesday, August 2Wednesday, August 2Wednesday, August 2ndndndnd
After the lectures of Professor NeugebauerAfter the lectures of Professor NeugebauerAfter the lectures of Professor NeugebauerAfter the lectures of Professor Neugebauer in the morning in the morning in the morning in the morning, the participants were driven to , the participants were driven to , the participants were driven to , the participants were driven to Friandent in Mannheim where they had lunch.Friandent in Mannheim where they had lunch.Friandent in Mannheim where they had lunch.Friandent in Mannheim where they had lunch.
26
……..Pleasure before work…….
HandsHandsHandsHands----on Placement of Xiveon Placement of Xiveon Placement of Xiveon Placement of Xive----Implants with Professor Neugebauer.Implants with Professor Neugebauer.Implants with Professor Neugebauer.Implants with Professor Neugebauer.
27
Thursday, August 3rd Tour to Ludwigsburg (Castle of Ludwigsburg)
28
29
30
31
Friday, August 4th
Hands-on “Regenerative Therapy with Emdogain” and “Tunnel Preparation” with Prof. Kim
32
Monday, August 7th
Lecture of Prof. Romano from the Eastman Dental Center (New York)
Afterwards: Tour to Speyer …..taking pictures for the next “Miss World” while waiting for the bus
33
Arriving at beautiful Speyer …….
34
35
36
Wednesday, August 9th
Lecture an hands-on-course with Prof. Ratka-Krüger
37
38
39
Thursday, August 10th
40
Participants walking along “Philosophenweg”….
41
42
43
Friday, August 11 Hands-on Nobel-Direct Implants
Participants eating pizza in the conference room…
44
Surgeon Beatles
Germany Indian Dancer
New York Hippopotamus
45
Jaguar Christmas
Galaxy Mediterrainian Sea
Headache Liposuction
Hawaii
46
Italy Summerschool
The participants were a group of outstanding artists...!! Neckar- River- Cruise
47
48
49
Brasilian Samba meets a talented dentist from the Philippines...
50
ThThThThe last dinner in the “Kulturbre last dinner in the “Kulturbre last dinner in the “Kulturbre last dinner in the “Kulturbrauhausauhausauhausauhaus” in Heidelberg” in Heidelberg” in Heidelberg” in Heidelberg
51
52
Later that evening: Paticipants had to perform s.th to get their certificates…..
53
5. 5. 5. 5. Participant's evaluation of the Summerschool for clinical PeriodontologyParticipant's evaluation of the Summerschool for clinical PeriodontologyParticipant's evaluation of the Summerschool for clinical PeriodontologyParticipant's evaluation of the Summerschool for clinical Periodontology and Implantology 2006and Implantology 2006and Implantology 2006and Implantology 2006 Annotation:Annotation:Annotation:Annotation: Values on the pillars of th Values on the pillars of th Values on the pillars of th Values on the pillars of the charts show te charts show te charts show te charts show the average valuation on a he average valuation on a he average valuation on a he average valuation on a scale scale scale scale from from from from 5 5 5 5 (best) to (best) to (best) to (best) to 1 1 1 1 (worse)(worse)(worse)(worse).... I. I. I. I. Comprehensive evaluationComprehensive evaluationComprehensive evaluationComprehensive evaluation 1.What is your evaluation of the Summerschool on a scale from 1.What is your evaluation of the Summerschool on a scale from 1.What is your evaluation of the Summerschool on a scale from 1.What is your evaluation of the Summerschool on a scale from 5555 to to to to 1111 ? ? ? ? 5 4 3 2 1 (5 = best ; 1 = worse)
4,76
0
0,5
1
1,5
2
2,5
3
3,5
4
4,5
5
1
in general
54
2. Please evaluate how the following topics have been dealt with in the Summerschool2. Please evaluate how the following topics have been dealt with in the Summerschool2. Please evaluate how the following topics have been dealt with in the Summerschool2. Please evaluate how the following topics have been dealt with in the Summerschool scale from scale from scale from scale from 5555 to to to to 1111.... a. basic science b. clinical studies c. clinical diagnosis d. hands-on-course
4,29 4,29
4,18
4,76
3,8
3,9
4
4,1
4,2
4,3
4,4
4,5
4,6
4,7
4,8
basic science clinical studies clinical diagnosis hand s-on-course
3. Which topics should be spent more attention to within the Summerschool program?3. Which topics should be spent more attention to within the Summerschool program?3. Which topics should be spent more attention to within the Summerschool program?3. Which topics should be spent more attention to within the Summerschool program? a. basic science b. clinical investigation c. clinical diagnosis d. clinical treatment e. hands-on-course
´
2,62
4,31 4,464,69
4,93
0
0,5
1
1,5
2
2,5
3
3,5
4
4,5
5
basic science clinicalinvestigation
clinicaldiagnosis
clinicaltreatment
hands-on-course
55
5
4,714,67 4,65
4,4
4,5
4,6
4,7
4,8
4,9
5
PD Dr.med.Dr.med.dent. Ti-Sun Kim
Prof. Dr.med.dent. PetraRatka- Krüger
Prof.Dr. Jack Caton Prof.Dr. Paul Romano
Top 4 of the Lecturers ranking on a scale from 5 (b est) to 1 (worse)
II. II. II. II. Lectures, seminars and handsLectures, seminars and handsLectures, seminars and handsLectures, seminars and hands----onononon----coursescoursescoursescourses
1.1.1.1. The Calibre of the Lecturers in general ?The Calibre of the Lecturers in general ?The Calibre of the Lecturers in general ?The Calibre of the Lecturers in general ?
4,59
0
0,5
1
1,5
2
2,5
3
3,5
4
4,5
5
1
Valuations for the calibre of the lecturers in gene ral
2.2.2.2. How was the teaching skills of the teHow was the teaching skills of the teHow was the teaching skills of the teHow was the teaching skills of the teacher ?acher ?acher ?acher ?
56
3.3.3.3. Scientific base of the lectures (evidence based) ?Scientific base of the lectures (evidence based) ?Scientific base of the lectures (evidence based) ?Scientific base of the lectures (evidence based) ?
4,41
0
0,5
1
1,5
2
2,5
3
3,5
4
4,5
Scientific base of the lectures (evidence based)?
4.4.4.4. Please name the 3 lectures / seminars that you think were the bestPlease name the 3 lectures / seminars that you think were the bestPlease name the 3 lectures / seminars that you think were the bestPlease name the 3 lectures / seminars that you think were the best
1. Mucogingival surgery 2. Furcation involvement –GTR with membrane 3. Aggressive Periodontitis
5555. What is your evaluation of the hands. What is your evaluation of the hands. What is your evaluation of the hands. What is your evaluation of the hands----onononon----courses ?courses ?courses ?courses ?
4,2
5 4,9 4,9
4,34,1 4,2
4,6
0
0,5
1
1,5
2
2,5
3
3,5
4
4,5
5
Evaluation of the hands-on-courses
Periodontal flap surgery (Eickholz)
Treatment of furcation involvement - GTR withmembrane (Kim)
Mucogingival surgery (Ratka-Krüger)
RT with Emdogain (Kim)
Straumann Implants
Nobel-Direct Implants
Dentsply Friadent - Xive Implants (Neugebauer)
in general
6666. Which topic would you like to have additionally ?. Which topic would you like to have additionally ?. Which topic would you like to have additionally ?. Which topic would you like to have additionally ?
57
Participants named:
- Asthetic aspects - Treatment planning for implants - Resections and mucogingival surgery - Crown lenghthening procedures - Prosthodontics in relation to periodontics - Bone augmentation - Connection Perio-Prosthodontics - Bone graft surgery, resective therapy - More perio surgery - Perio connection with prosthodontics - Mucogingival and implants all day, if possible - More mucogingival surgery
III. III. III. III. Social eventsSocial eventsSocial eventsSocial events
What is your evaluation of the social events ?What is your evaluation of the social events ?What is your evaluation of the social events ?What is your evaluation of the social events ? 1111. Please name the event that you enjoyed most.. Please name the event that you enjoyed most.. Please name the event that you enjoyed most.. Please name the event that you enjoyed most. 2222. . . . Would you have liked to visit more places in and around heidelberg ?Would you have liked to visit more places in and around heidelberg ?Would you have liked to visit more places in and around heidelberg ?Would you have liked to visit more places in and around heidelberg ?
Yes ….. said…. 11111111 No …..said.…. 5555 ... if yes, which ones ?... if yes, which ones ?... if yes, which ones ?... if yes, which ones ? Participants named:
- Rhein - Landscapes - Heidelberg Castle - Frankfurt - Black Forrest - Baden-Baden - München
4
2
4 4
2
0
0,5
1
1,5
2
2,5
3
3,5
4
Ludwigsburg Sirona afterparty Welcome party Tour to Speyer Walk along"Philosophenweg"
58
3333. . . . Any suggestions what we could have done additionally ?Any suggestions what we could have done additionally ?Any suggestions what we could have done additionally ?Any suggestions what we could have done additionally ?
- I can’t imagine, if you could have done itI can’t imagine, if you could have done itI can’t imagine, if you could have done itI can’t imagine, if you could have done it better. I think it’s an better. I think it’s an better. I think it’s an better. I think it’s an Ideal program.Ideal program.Ideal program.Ideal program.
- All was perfect.All was perfect.All was perfect.All was perfect. - You’ve done a lot.You’ve done a lot.You’ve done a lot.You’ve done a lot. - Access to the internet.Access to the internet.Access to the internet.Access to the internet.
IV. IV. IV. IV. AccomodationAccomodationAccomodationAccomodation Questions were…Questions were…Questions were…Questions were… 1.1.1.1.Where did you stay during the summer school ?Where did you stay during the summer school ?Where did you stay during the summer school ?Where did you stay during the summer school ? 2. Where you satisfied with the service ?2. Where you satisfied with the service ?2. Where you satisfied with the service ?2. Where you satisfied with the service ? Yes No annotations: 3. Was the price reasonable ?3. Was the price reasonable ?3. Was the price reasonable ?3. Was the price reasonable ? Yes No annotations: 4. Where the rooms clean ?4. Where the rooms clean ?4. Where the rooms clean ?4. Where the rooms clean ? Yes No annotations: 5. Was the breakfast o.K. ?5. Was the breakfast o.K. ?5. Was the breakfast o.K. ?5. Was the breakfast o.K. ? Yes No annotations: 6. Would you recommend this accomodation to future participants of the summer school ?6. Would you recommend this accomodation to future participants of the summer school ?6. Would you recommend this accomodation to future participants of the summer school ?6. Would you recommend this accomodation to future participants of the summer school ? Yes No annotations:
Summery: Summery: Summery: Summery: accomodation number of participants that stayed there
- Guest hoGuest hoGuest hoGuest houseuseuseuse 6666 - Nursery houseNursery houseNursery houseNursery house 1111 - Private accommodationPrivate accommodationPrivate accommodationPrivate accommodation 4444 - Korean friend’Korean friend’Korean friend’Korean friend’s houses houses houses house 1111 - Youth HostelYouth HostelYouth HostelYouth Hostel 1111 - HostelHostelHostelHostel 2222 - Wilhelmsfeld u. nursery dormitoryWilhelmsfeld u. nursery dormitoryWilhelmsfeld u. nursery dormitoryWilhelmsfeld u. nursery dormitory 2222
Annotation: * two * two * two * two times times times times –––– the breakfast was not oK, because it was the same every day. the breakfast was not oK, because it was the same every day. the breakfast was not oK, because it was the same every day. the breakfast was not oK, because it was the same every day. * All other questions was answered with “Yes”.* All other questions was answered with “Yes”.* All other questions was answered with “Yes”.* All other questions was answered with “Yes”.
59
V, V, V, V, Improvement of future SummerschoolsImprovement of future SummerschoolsImprovement of future SummerschoolsImprovement of future Summerschools 1. In your opinion, which part of the summer school shoul be focussed more (+) or 1. In your opinion, which part of the summer school shoul be focussed more (+) or 1. In your opinion, which part of the summer school shoul be focussed more (+) or 1. In your opinion, which part of the summer school shoul be focussed more (+) or less (less (less (less (----)))) on in future ? on in future ? on in future ? on in future ? a. Scientific and clinical lectures b.Lectures about German culture c. Hands-on-courses d. Social events e. None of them, they are already well balanced 2. 2. 2. 2. What would be an oWhat would be an oWhat would be an oWhat would be an optimum duration for the Summerschool ptimum duration for the Summerschool ptimum duration for the Summerschool ptimum duration for the Summerschool ???? a. One week b. Two weeks c. Three weeks 3.3.3.3. How did you like the size of the Summerschool ?How did you like the size of the Summerschool ?How did you like the size of the Summerschool ?How did you like the size of the Summerschool ?
4
2 2
6
10
0
5
1
6
0
1
2
3
4
5
6
7
8
9
10
Scientific andclinical lectures
Lectures aboutgerman culture
Hands-on-courses
Social events None of them,they are already
well balanced
more
less
3
9
5
0
1
2
3
4
5
6
7
8
9
One week Two weeks Three weeks
The participants think the optimum duration would be ......
60
a. Too many participants b. Size was quite right c. There should be more participants 4. What do you think about the background of the participants ?4. What do you think about the background of the participants ?4. What do you think about the background of the participants ?4. What do you think about the background of the participants ? a. There should be represented more clinical practitioners b. There should be represented more scientists c. The participants should be recruted from a larger number of different countries d. The participants should be selected from certain geographic areas (e.g. Europe, Asia, South America etc.) 5. Please give a prospect of the effect the Summ5. Please give a prospect of the effect the Summ5. Please give a prospect of the effect the Summ5. Please give a prospect of the effect the Summerschool might have on your future workerschool might have on your future workerschool might have on your future workerschool might have on your future work
1
16
0
0 2 4 6 8 10 12 14 16
Too many participants
Size was quite right
There should be moreparticipants
4
1
12
00
2
4
6
8
10
12
a b c d
61
a. I haven't learnt anything new or s.th. that will have any effect on my work b. I gained a lot of new knowledge but I fear it might be difficult to be realized (due to circumstances at home country /different system etc.) c. I could collect new information and improve my practical skills so that i will definitely integrate the things I've learnt in my future work 6. What do you think about the schedule6. What do you think about the schedule6. What do you think about the schedule6. What do you think about the schedule a. too loose b. was quite o.K. c. too tight
0
5
12
0
2
4
6
8
10
12
a b c
0
10
7
0
1
2
3
4
5
6
7
8
9
10
too loose was quite o.K. too tight
62
VIVIVIVI. Place for some final words, comments , etc. . Place for some final words, comments , etc. . Place for some final words, comments , etc. . Place for some final words, comments , etc. ……………………
I would just like to thank Dr. Kim and staff and teachers from abroad for all the attention given, all the patience to answer questions, all the strength to motivate discussions and exchange of knowledge. I’m aware that organizing a Summerschool is tough and demands work and organization. Above all, it is good that we should satisfy patients wish and when possible, maintain teeth. It was rewarding to see that my countrie’s philosophy in treating Perio is the same. All in all, congratulations! I just loved this program, it was muich more interesting and effective, than I accepted. I would love to come again in a half year, to show with my colleagues my results, to discuss. I hope to be invited to this summerschool again and again. Best regards. Thank you very much. It was my pleasure to be here, to learn a lot of things, to meet very nice people from different countries. Thank you very much! Many thanks to lecturers, organisators and all other. The Summerschool 2006 was a wonderful experience! It was a great opportunity to improve my surgical skills. I have really enjoyed very much all hands-on-courses and the all remaining program. Everything is OK. I have a lot of new experience in periodontology and periodontal surgery. I gained a lot of news with other international colleagues. Thank you very much! Thanks for giving me a chance to be better equipped with more ability and qualification to serve my patients in tooth preservation. Thank you! I’ll miss you so much! I am really greatful for the opportunity to be here. Thank you! This summerschool was really tremendous and interesting experience for me. I’ve met nice people and had a great time in Heidelberg. I’ll remember this time for the rest of my life. Thank you for sharing your knowledge and clinical experience with us. Especially thank you Dr.Kim for the effort that put in organisation of this Summerschool.
63
Too much implant content. I think the first lecture should begin earlier and the last lecture should finish earlier. The schedule was so tight, it makes me feel the time went so fast. Thank you for all the things, Kim, Zehaczek, Cosgarea and all the other helpers. It was a so, so great and happy time. It is great, thank you! I really enjoyed the time, which I spend in here, the studying and the social program. I hope it is not the last time, I am here, in this summerschool and in this city. It is my second summerschool. I learned so much things of periodontology and implantology. It was a great experience for me. Thank you for all. The program is good but it would have been better if the duration is extended for one more week so that the Schedule would not have been so tight. Also, this would give more time for more discussions on certain Topics and lectures. Overall, it has been an enriching experience for me. Overall I am very happy of great possibility to be in that summerschool. I look forward to come again after a few years, than I’ll have more experience in my periodontal practice. I learnt a lot and will try to use my Knowledge in casual practice. Thank you for all!
64
My expection for the Summerschool 2006 was ……..My expection for the Summerschool 2006 was ……..My expection for the Summerschool 2006 was ……..My expection for the Summerschool 2006 was …….. ….. to improve my knowledge in Perio ….. to help me in preparing myself for teaching ….. to see what kind of lectures and educations a student can get on different universities ….. to get systemic knowledge of periodontology and implantology ….. to train my skills and to learn advanced skills ….. to come together with other dentists from many different countries ….. to understand more about implantology and implant- systems ….. to compare the things I've learned at my university with the contents in other universities ….. to gain new friends form other countries ….. to get more information about the different methods of treatment of periodontal diseases ….. to improve my practical skills in periosurgery and in implant placement ….. to get different opinions about the treatment planning ….. to find out more effective teaching methods for students ….. to collect new experiences in periodontal surgery ….. to visit the University of Heidelberg ….. to meet young dentists from all over the world ….. to share experiences with other young dentists ….. to return home with larger knowledge in perio ….. to improve my surgical knowledge ….. to improve my knowledge in implant - placement and - systems ….. to get a cross-cultural experience ….. to stay in touch with new researches ….. to be able to meet and discuss topics with "big" teachers ….. to get the opportunity to review all I've learned in the Masters course ….. to verify if the germans are conservative or radical perios ….. to hear latest news in periodontology ….. to learn more about periodontal surgery ….. to meet new colleagues and exchange experiences ….. to try out mucogingival surgery ….. to have a good time in germany ….. to get as much information as possible ….. to learn more about perio approaches in Europe ….. to enhance my knowledge ….. to become an update in the field of periodontology and implantology ….. to learn something about and out of other international cultures (esp. the german) ….. To enhace my knowledge about gingival recession and mucogingival -problems and - treatment ….. To get an insight into the experiences lectures from different countries made ….. To learn about treatment methods and new materials used in other countries In fact, my experience in the 2 weeks of Summerschool was…..In fact, my experience in the 2 weeks of Summerschool was…..In fact, my experience in the 2 weeks of Summerschool was…..In fact, my experience in the 2 weeks of Summerschool was….. ….. I learned a lot in periodontology ….. The program was really good - a lot of studying, a lot of information, new knowledge,…. ….. Excellent organisation of perio school ….. I've learned much about perio surgery ….. I've changed some points of view in periodontology when I saw new findings and new approaches
65
….. It was better than I expected ….. That I was busy studying ….. Reviewing basic principles was great ….. Amazing, surely beyond my expectations ….. Very enriching to meet people from countries I've never been ….. An opportunity to share knowledge ….. Good ….. Unforgetable, to meet such nice people ….. I've learned a lot, especially during hands-on courses ….. I made a lot of new experiences in periodontal surgery and implant placement ….. Great lecturers ….. Very interesting and usefull hands-on course ….. Nice and enthusiastic colleagues in the group ….. Fulfilling because I ahve seen that what is thought at our university is at par with thoughts of other universities. ….. Gratifying because now I have friends from countries that are far distant from my own country ….. Influenced to apply further study of periodontology and implantology ….. Good to have courage and confidence in flap & regenerative surgery ….. Great chance to get scientific and systemic lectures by professors from other countries and universities ….. All positive ….. This summerschool gave me the answers on some of the questions that I had concerning periodontal therapy ….. I learned a lot about implants ….. Great ….. Brilliant ….. I loved it ….. Much more exciting than I expected ….. I liked the discussions ….. Nice ….. Good hands- on course ….. I learned more than I expected ….. I heard and did things that I never heared/did before ….. I learned a few new things in antiinfective therapy, about periodontal patients maintenance It would have been better if…...It would have been better if…...It would have been better if…...It would have been better if…... ….. the hands on courses would have last longer, especially on mucogingival surgery ….. I could repeat everything we made on hands on course ….. we did come to Heidelberg with a bigger knowledge of periodontology ….. summerschool would last one week longer ….. esthetic parts of periodontology were included ….. I could get schedules before the lecture ….. we would get lectures on CD ….. We there were more hands on courses within the two weeks ….. There would be not more than one participant from one country ….. Students from the western part like United states were included in the program so that I could have compared european and US education. ….. We were allowed to observe and assist in actual clinical cases ….. It would have been a little shorter
66
….. If some of the basics would have been skiped ….. There was less lectures about implants ….. The two implants systems were prepared at one day ….. All is better During the 2 During the 2 During the 2 During the 2 weeks I missed ……weeks I missed ……weeks I missed ……weeks I missed …… ….. tea ….. the internet ….. interactive courses ….. places for lunch ….. time for hands on ….. my family and friends ….. my boyfriend ….. my girlfriend ….. home ….. my pillow ….. my countries traditional food ….. my patients and my colleagues in my clinic ….. Kimchi, my favorite korean food ….. my dog ….. a bike to take me faster to places ….. my children During the 2 weeks I appreciated …..During the 2 weeks I appreciated …..During the 2 weeks I appreciated …..During the 2 weeks I appreciated ….. …..a lot of studying …..new people, colleagues, friends …..terrific teachers and professors …..interactive kind of teaching …..latest findings in periodontology were presented to us by worldwide respected authors …..all the things …..professors doing lectures …..Assistants who helped our program …..the attention I received from Dr.Kim and staff …..the visits to the companies …..the schedule that was very well organized …..all …..excellent lectures and hands-on-courses …..good organization …..hospitality in clinic …..Dr. Kims relation to all students …..excellent organisation …..lecturers …..very good organisation of the summerschool …..Heidelberg …..interesting lectures …..the hard work that Dr. Kim and her staff and the other professors had given and showed us so that we could be better specialists in this field …..the cultural awakening and the friendship that has developed among the students who belong to different parts of the world
67
…..the beauty and the magic of Heidelberg City …..Dr. Kim and fellows who always gave us warm hospitality and great lectures …..Our professors who answered my questions so kindly …..My classmates who became my friends although we had difficulties with communicating in english. …..Good organisation …..A lot of energy and positive atmosphere that Dr. Kim invested in this summerschool …..the trips that we made …..the work and enthusiasm of all lecturers and staff …..Dr.Kim and the assistant professors …..Dr. Machtei and Dr. Catons lectures …..Hands-on-courses …..the good organisation …..nice attitude of the organizers, lecturers …..very well organized summerschool programm and social life after lessons …..great job that was done to make this summerschool possible
68
6. 6. 6. 6. Final ReportsFinal ReportsFinal ReportsFinal Reports
THE MAGIC OF HEIDELBERG A Final Report on the International Summer School Program for Clinical
Periiodontology and Implantology 2006
MELANIE RUTH KARGANILLA FRANGE Manila, Philippines
From July 31 until August 11, 2006, the second International Summer School for Clinical Periodontology and Implantology was held at the University of Heidelberg. The first international summer school was held in 2004 and it was from my co-faculty, Dr. Christian Ermita at the College of Dentistry, University of the Philippines, that I have learned how good the program was. That was why when the dean of our unit announced that there was going to be a second one, I took the opportunity to apply at once. This year there were 15 successful accepted applicants that came from distant parts of the world: Bosnia, Brazil, Croatia, Korea, Latvia, Lithuania, Philippines and Serbia. In the second week, two from Bosnia who have already attended the 2004 summer school, joined our group. During the first day, Dr. Ti-Sun Kim, the directress of the program allowed us to introduce ourselves to the class. When I have learned how far apart the countries we all came from, I said to myself that it might be difficult to create a unified group because of cultural differences. Nevertheless, I resisted my original thought and just allowed time to disprove or prove my doubts. The program can be summarized into 5 parts. The first one was lectures on the basic courses: Classification of Periodontal Diseases; Clinical and Microbiological Periodontal Diagnosis; Antibiotics in Periodontology; Anatomy and Physiology of Bone, Cementum, Periodontal Ligament and Wound Healing; Scaling and Polishing; and Periodontal Flap Techniques. Although considered basic, I think it was still important to include this in the course so that there was a sort of a basis or starting point to get the discussion rolling and also to calibrate what everyone knew. The second part was the more advanced perio courses such as resective and regenerative treatment and, mucogingival surgery. I considered this as advanced because these topics are not taught comprehensively in the undergraduate dentistry program in the Philippines. I would say these topics caught the interest of most of the attendees of the program. The third part was Implantology. Here the fundamentals of setting implants, sinus lifts, biology of osseointegration and 3 different implant systems were discussed in the class. This was also very interesting because only a few in the group had experience in implantology. This has given us the opportunity to break through the concept of implantology. The fourth part, although I would consider as part of the basic course such as Gingival Overgrowth, Aggressive Periodontitis and Periodontal Medicine were discussed,
69
stressed and given more attention. I think because these are the topics which present cases that make our clinical practice in perio more exciting and challenging. The fifth part was the hands-on course. This included the Dentsply-Friadent Xive, Strauman and Nobel Biocare implant systems. Also there were hands-on course on periodontal flap techniques, Furcation and Regenerative therapies (Emdogain and membranes) and, Mucogingival Surgery. In my opinion, the regenerative therapies and the mucogingival surgery were the best seller- hands-on courses. Based on the reaction of the participants and on the discussion in the class, this was where everybody was most attentive to during the presentation and, where everyone showed great interest during the hands-on course. The mucogingival lecture and hands-on were full and tiring but this did not stop the class from listening and trying it out on the pig’s mandible. The professors that made the presentations are top –caliber. Aside from their great knowledge on the topics that they lectured on, each has its own style of making the discussions interesting. I have never imagined Drs. Caton and Machtei would be giving out a lecture in front of me. Because I have this impression that they are considered one of the demigods in perio because of their broad clinical experiences and researches. The only encounter I had with these people (which are actually not real encounters) was when I read their articles on various journals. And personally meeting them was like a chance of a lifetime. But of course my favorite was Dr. Kim, not because she was the program directress but because of the interactive lectures she had with us. Not only that she stimulated our minds but she also gave us the chance to discuss and interact with others. Such interaction made us know each other more and also made us learn and peek on how perio is taught and how cases are treated in other countries. Also as a result of this I found myself a little proud and thankful because what I have learned in perio in our country does not differ much with what the other countries teach their students. Suffice to say that what we learn in the Philippines is what I can consider as “globalize”. The summer school was not just academic because we also had cultural awakenings of Germany. We had a lecture about the city of Heidelberg; excursions to Bensheim and Sirona Company, Ludwigsburg and Speyer; cruise along the Neckar River and a hike on the Philosopher’s trail. These activities also paved the way for the exchange of cultural experiences of the participants in their respective countries. Thus, albeit indirectly, we also had cultural awakenings of Bosnia, Brazil, Croatia, Korea, Latvia, Lithuania, Philippines and Serbia. In general, to me, the entire experience was stimulating, enriching and fulfilling. Stimulating because it has broaden our knowledge in Periodontology. Enriching because if the cultural exchanges that have widen what we knew about the rest of the world. Fulfilling because both the academic and the cultural experiences have struck my mind, my heart and my soul. As to my initial doubts of whether people from poles-apart countries would click and blend considering that the only common ground was periodontics, I would say that I spoke to myself too soon. Because at the end of the two week- program, friendships have blossomed naturally. We did not have to force it upon ourselves for the sake of perio, rather, it just happened. And because of this, the vision of Dr. Ti-Sun Kim to have a multicenter from different countries for clinical and research cooperation and exchanges in Periodontology for the sake of humanity, might not be a hard task at all. And this is what I call as the MAGIC OF HEIDELBERG.
70
I would like to thank: Dr. Kim: for conceptualizing the international summer school program. I know it was a gargantuan task to organize such program. Also I thank her for the rare opportunity she has given me. Drs. Caton, Machtei, Kruger, Eickholz, Romano, Neugebauer, and Steveling: for unselfishly sharing what they have learned and discovered Dr. Kim’s staff (Sven, Raluca, Helga, Isabel etc): for all the supportive hard work and for baby-sitting 17 adult students International Summer school students batch 2006: especially Nikolina, Zeljka, Milanko, Young Taek and Jin, for the wonderful company and friendship University of the Philippines: for all the support and understanding Dr. Nannette Vergel De Dios: my mentor in Periodontolgy All the sponsors: if not for them, the summer school would not have happened
71
International Summer School for Clinical Periodontology and Implantology University of Heidelberg, Germany
July 31- August 11, 2006 The 2006 International Summer School for Clinical Periodontology and Implantology was organized by the Section of Periodontology of the University of Heidelberg. The Summer School was held in cooperation with the University of Cologne, University of Frankfurt, University of Freiburg, University of Rochester and Technion Institute. One of the goals of the Summer School was to create an international forum for the exchange of ideas among young dental professionals. Therefore, participants came from different countries—Bosnia-Herzegovina, Brazil, Croatia, Korea, Latvia, Lithuania, Philippines, Romania and Serbia-Montenegro. The group was composed of periodontology residents, periodontal specialists and professors, as well as oral surgery and endodontic residents. As such, this heterogeneity among participants fueled interesting discussions which supplemented classroom learning from lectures and hands-on workshops. During the first week of the Summer School, a review of the classification of periodontal diseases (Dr. Raluca Cosgarea and Dr. Sven Zehaczek), as well as the different clinical indices and microbiological assays employed during the diagnosis of periodontal diseases (Dr. Cosgarea) was given. Review of basic knowledge was conducted to ensure calibration among participants. Other lectures included the use of antibiotic prophylaxis in Periodontology (Dr. Ti-Sun Kim). Medical conditions indicating antibiotic prophylaxis, dental procedures requiring coverage and antibiotic regimens were discussed. The specific treatment regimes carried out at the University of Heidelberg and the principle of full mouth disinfection were also presented. A short debate cum panel discussion among participants as to the advantages and disadvantages of full mouth disinfection and quadrant root planing provided an effective venue to present published evidence, as well as personal experience in patient management, in order to justify the selection of either full mouth or quadrant root planing. Succeeding lectures on scaling and root planing, hand and machine debridement, non-surgical versus surgical periodontal therapy and periodontal surgical (flap) techniques were given by Dr. Peter Eickholz. These were followed by hands-on exercises, wherein participants were made to do modified Widman’s flap, distal wedge and modified circumferential suture on pigs’ mandibles. The fundamentals of setting implants (from implant planning to placement), as well as the concept of immediate loading were discussed by Dr. Jörg Neugebauer. The Xive® implant system (Dentsply-Friadent) was then presented, after which, participants were given hands-on training on the placement of the above-mentioned implant system. The lecture by Dr. Helmut Steveling on the role of the marginal bone level in implantology completed our lessons on implantology for the first week. The remaining lectures during the first week were on the etiology, diagnosis and treatment of furcation involvement, guided tissue regeneration (Dr. Kim), response of the periodontium to resective, reparative and regenerative therapy (Dr. Jack Caton), and the anatomy and physiology of bone, cementum and periodontal ligament, and wound healing (Dr. Paul Romano).
72
The final hands-on session during the first week was on guided tissue
regeneration-- placement of a non-resorbable membrane (Gore-Tex) on a furcation involved premolar on a pig’s mandible.
The second week of the Summer School was also comprised of both lectures
and hands-on exercises. These involved discussions on gingival overgrowth (Dr. Kim), sinus lifts and grafting, biology of osseointegration, anti-inflammatory drugs and treatment planning and basic surgical protocol at the Eastman Dental Center in Rochester, New York (Dr. Romano). Dr. Eli Machtei also updated the participants on the etiology, diagnosis and treatment of aggressive periodontitis, as well as the bi-directional relationship between periodontal disease and certain systemic conditions. Detailed presentations on the diagnosis and treatment of gingival recession and mucogingival problems were given by Dr. Petra Ratka-Krüger. Participants were also instructed on coronally positioned and semilunar flaps, and on the placement of free gingival and connective tissue grafts on pigs’ mandibles.
Additional lectures on regenerative therapy using growth factors were given,
followed by hands-on experience on the use of Emdogain on angular bony defects in pigs’ mandibles. Participants were also instructed on tunnel preparation, also on pigs’ mandibles.
During the second week, two additional implant systems were also introduced—
Straumann and Nobel-Direct. Lectures were followed by hands-on placement on models. The inclusion of three different implant systems during the Summer School (Xive during the first week), helped participants to evaluate the features, advantages and disadvantages of some systems available in the market.
The final lecture by Dr. Kim—“Where are we going? Implants or teeth?”—helped
put a perspective as to how dental practitioners should go about managing patients with periodontal disease. I share Dr. Kim’s view that every effort must be exerted to save as many periodontally-involved teeth as we can. The dentist must listen to the patient’s own wishes and goals, and use the knowledge, techniques and technology at hand, in order to restore periodontal health. A conservative approach should be employed whenever possible.
Although majority of the lectures served as reviews, it is worth noting that one
could always learn something new from each lecture. This is because each lecturer updated the participants with published literature which could either support or contradict the different concepts and periodontal treatment modalities presented. Lectures were always evidence-based and in addition, several lecturers (such as Dr. Caton, Dr. Kim and Dr. Machtei) helped the participants on how to become more critical when reviewing literature. Dr. Machtei also provided us participants with research ideas, and he urged us to conduct the research once we go back to our respective countries.
Learning was also supplemented by numerous questions and answers, as well
as by lively discussions among participants and lecturers. These discussions allowed and encouraged the surfacing of different opinions, and gave insight as to how periodontal patients are managed by dentists from different countries.
As part of the Summer School, a number of social activities were also organized
by the University of Heidelberg and the sponsoring companies. These included the Welcome Party at the Tropical House of the Botanical Garden, the excursion to
73
Bensheim to the Sirona Company, trips to Ludwigsburg and Speyer, a walk up Philosophers’ Trail, the Neckar river cruise, and the final celebration sponsored by Dentsply-Friadent. All these activities served as welcome breaks from the hectic lecture and hands-on schedule. They also provided participants time to interact, learn about each other’s culture, and simply to enjoy each other’s company.
I attended the Summer School expecting to be updated in the field of
Periodontology and Implantology, and to be able to learn from colleagues from other countries, through the exchange of accepted concepts (in different countries), as well as through the exchange of research ideas. The Summer School was a great and enriching experience—most concepts we subscribe to in our University were validated, I gained new knowledge and acquired new skills which can be applied to my teaching and clinical practice. From the different teaching styles of the lecturers, I also learned methods for mentoring and motivating students. Moreover, I was able to make new friends from all over the world. I hope to share this Summer School experience so that more people--- students, colleagues and patients---may ultimately profit from it.
Ma. Celina Petronila U. Garcia, DDM Manila, Philippines
74
International Summer school for Clinical Periodonto logy and Implantology University of Heidelberg, Germany, July 30 – August 11, 2006
Final Report
The International Summer school for Clinical Periodontology and Implantology was organized by the Section of Periodontology, Department of Operative Dentistry of the University of Heidelberg. The summer school was composed of 17 dentists from the following countries: Brazil, South Korea, Latvia, Lithuania, Romania, Bosnia, Serbia, Croatia and the Philippines. Such a mixture of participants provided a unique opportunity to exchange different ideas and knowledge among all of us, especially due to the fact that also dentists from different areas were participating of this Summer school such as specialists in Endodontics and Prosthesis. Dr. Ti-Sun Kim, Head of the Section of Periodontology of the University of Heidelberg, organized for the second time in Germany this Summer school. Two main differences were taken in order to improve the course this time: The number of participants was reduced and the number of hands-on classes was increased. The program has endured two weeks, with the contents approached into lectures, interactive seminars, a genius idea to keep the students more active during classes and make then discuss about controversy themes in Periodontology, and hands on courses, with the schedule perfectly planned, without forgetting the cultural aspects of the course, where after classes we could know al lot about the history of Heidelberg, getting to know some landmarks such as the castle of Ludswigburg, considered the biggest castle in Germany, the city of Speyer with its cathedral and its religious history, and the Neckar river. The first week was dedicated to the basic aspects of Periodontology (Clinical and Microbiological diagnosis, Classification of Periodontal diseases, Antibiotics in Periodontology, Treatment Planning and Etiology and Diagnosis of Furcation Involvement), with lectures given by Dr. Kim and the faculty members of the University of Heidelberg, and lectures from Dr. Eickholz from the University of Frankfurt on Scaling and root planning, Periodontal surgery, Flap techniques with hands-on on the pig jaw, of Dr. Steveling from the Oral Surgery Department of University of Heidelberg about fundamentals of setting implants, immediate loading combined or not with augmentation procedures and hands-on with placement of Friadent Implants. Dr. Jack Caton, from the University of Rochester, USA gave us brilliant lectures, primarily stressing the importance of questioning and discussing during his classes, about the response of the periodontium to therapy, showing all his research works with highlights of the importance of a correct interpretation of clinical trials results in Periodontology, the role of local drug releasing in Periodontology and about the researches his group has been done with low dose doxicicline as adjunt to conventional therapy in the management of Chronic Periodontits, the importance of a consensus in Individual Prognosis in Periodontology and what are the guidelines from the AAP considering prognosis, and about reparative and regenerative surgical therapy in Periodontology. The second week was a mixture of a lot of subjects in both Periodontology and Implantology. At the beginning of the week, Dr. Romano from University of Rochester, gave us one of the best classes of Anatomy and Histology of the Periodontium I have ever had. After this, he gave us a lecture about the Biology of Osseointegration, Sinus
75
Lift procedures and the treatment planning and protocol for implant placement at Eastman Dental Centre, and talked about Anti-inflammatory Drugs and its role and appliance in Dentistry. In this same week, Dr. Eli Machtei spoke, according to his own words, about the themes he most like in Periodontology: Aggressive Periodontitis, since is the Periodontal disease who shows the bests results after therapy, and Periodontal Medicine, who is his main research area in Periodontology. We also have lectures with Dr. Petra Ratka-Krüger, from University of Freiburg, about diagnosis, classification, treatment and management of Mucogingival problems, stressing the importance of a correct diagnosis, and about knowing the previsibility of success in case of treatment of these problems, explaining in details all the surgical techniques for the treatment of gingival recession. We also have with her and extraordinary hands-on course with mucogingival surgery with laterally positioned flap, coronally positioned flap, free gingival grafts and techniques to enhance the amount of attached gingival and connective tissue graft-envelope technique in pig jaws. We also had in these two weeks more lectures and hands-on courses about Implant Systems, both at the University laboratory and at some Implant Dentistry companies such as Friadent-Dentsply, since Dr. Kim pointed out the importance of knowing in details all the implant systems, weighting all its advantages and disadvantages and not just one or two of them. We also had lectures about gingival overgrowth, regenerative therapy and growth factors and full mouth disinfection with Dr. Kim and her always best didactics and attention to her students and global knowledge of the medical status of the patients, without forgetting that science is not science without the spirit of group, always trying to know if everyone was ok and if everyone was setting up without problems in Heidelberg, and without the funny moments, such as the final lunch at the University with all the students, and our performances dancing at the final dinner to get our certificates. One of the best memories I have with her was the famous journey to the “Philosopher’s trail” with the colleagues from the summer course, who were all very friendly and companion to each others. I am sure that this Summer course made me not just know that all that I´ve learned in my University was not so much different from the University of Heidelberg, but was really a great experience to exchange knowledge, learn more about Periodontology and Implantology from a lot of high qualified and experienced Periodontologists, and also to know very special people that I surely will miss a lot. I hope I can come back in a short period of time. Dr. Priscila Corraini São Paulo, Brazil Acknowledgments I would also like to thank the following people for making this summerschool so memorable and possible:
� Dr. Kim, who organized this Summer school, thank you very much for all efforts to make our stay so enrich full and enjoyable. You are that kind of special person that I will never forget;
� University of Heidelberg for providing me the scholarship to attend this summer school;
� University of São Paulo, Brazil for the scholarship;
76
� Head of the Section of Periodontology and my Supervisor at my MSc thesis Dr. Francisco Emilio Pustiglioni and all the Professors from the Periodontology discipline of University of São Paulo for the encouragement, support and trust that I would surely add something to their Department;
� The companies that supported the summer school, GABA, Dentsply-Friadent, Sirona, Nobel Biocare and Strauman;
� The organizations that supported this summer school: German Society of Dental, Oral and Maxillofacial Medicine, German Society of Periodontology, New Working Group for Periodontology
� Dr. Isabel, Dr. Raluca, Dr. Sven, Dr. Neils, Dr. Isabel and all the clinical staff of the Section of Periodontology from the University of Heidelberg;
� To all my classmates.
77
Final Report for NAGP Scholarship Dr. Kim Young Taek
Yonsei University Dental Hospital 134 Shinchon-dong Seodaemun-gu
Seoul, Korea 120-752
First of all, I believe that you would need more time to fully cover Periodontology, Implantology and the cultures of Germany than a two-week program. However I could meet lots of friends there and I already miss them now. The program was totally excellent and made my eyes open to the world. So I’d like to thank you for giving me such an opportunity to participate in this course. When I first arrived at Heidelberg, it was quite a strange place to me. In fact it was my first time to attend a course in foreign countries. It was a natural response for me, but I also felt a bit of curiosity. Because many other participants were from various countries, such as Brazil, Serbia, Latvia, Romania, Philippines, etc. As the course began, the class schedule turned out to be very tight on the contrary to my expectation. I thought it would go a little bit easy because of long span of classes. Two weeks were a long time, I thought. But, like I mentioned, this course drove us so tight to make me and maybe the others to feel the same way. There were so many things to learn and so many things to do. Of course, I enjoyed that with the other participants from all over the world. Especially, the lecturers, Dr. Romano, Dr. Machtei, and Dr. Ti-Sun Kim were so amazing. The all lectures were so helpful to me and the lectures on basic part were so meaningful in that I could refresh my knowleges and learned new ones as well. Currently I am on training course for periodontology and implantology as a resident. So it was a good opportunity for me to learn current information and knowleges. Some of the advanced courses including GTR, Emdogain, free gingival graft, connective tissue graft and so forth were familiar with me, but I can not tell that I am very good at those yet. In fact, this course was exactly what I wanted. Every hands-on courses were also very good. ITI, Xive and Branemark systems were familiar to me because my hospital has equipped these systems too. I guess that periodontic parts were a little bit easier. But, as I mentioned, advanced courses were the very course that I wanted. So I really appreciated those. I also enjoyed visiting some companies, i.e. Sirona, Friadent and other places. We got also some excursions to Speyer, Ludwigsburg and Neckar-River. They were good in some way that we could experience the German culture. If this course had ended with
78
just lectures and hands-ons practices, this course would not have been such an impressive one. I think the most important thing I learned was that the participants could be friends like
Dr. Kim said. Maybe we could be in contact and also we can be co-workers sometime. The second important thing is that I learned to understand the other culture. Of course, it is impossible to understand the other culture just for two-week experience. But it was the good chance for me to begin to know other cultures and atmospheres. I think that ‘the Summerschool in Heidelberg’ can be a channel to communicate among the Periodontology and Implantology society all over the world. If this course goes on, the vision of the Summerschool would not be just a dream.
79
This summer I participated in the work of the Summer School in Clinical Periodontology and Implantology at the University of Heidelberg. My final report is as follows.
The Summer School was attended by fifteen participants from Korea, the Philippines, Brazil, Lithuania, Latvia, Romania, Bosnia-Herzegovina, Croatia, and Serbia, and in the second week we were joined by two colleagues from Bosnia-Herzegovina who had attended this Summer School two years ago.
Those two weeks were characterized by intensive learning with a busy schedule of outstanding lectures, hands-on courses, interesting excursions and social activities. The whole program of the Summer School was divided into two parts: Periodontology and Implantology. At the very beginning members of the university of Heidelberg Dr. Cosgarea and Dr. Zehaczek gave some basic lectures about classification of the periodontal disease, microbiological diagnosis and antibiotic therapy. The most interesting part for me was the lecture by Dr. Kim who outlined the principles of periodontal therapy at the University of Heidelberg, which was exactly one of the main reasons for my participating in this Summer School. The School of Dentistry and the Department of Periodontology that I come from is a small one, and in my opinion in our managing of the periodontal patients we should rely on a well recognized and highly respected faculty as is the one in Heidelberg. Moreover, it is my firm opinion that the principles of periodontal therapy at the University of Heidelberg could be applied at our Department as well.
Among the many brilliant lectures we were given, I was most impressed by the lectures by Dr. Caton on response of the periodontium to therapy and the lecture of Dr. Machtei on Periodontal- systemic interaction. However, the talks by other lecturers were none the less interesting, such as those by Dr Eickholz, Dr Romano, Dr Ratka-Kruger. What I found most motivating was that the majority of the lectures were organized in the manner to compare different data from the literature about one problem. This kind of lecturing is completely new to me, and it triggers further consideration of the problem to reach one’s own conclusion.
Alongside with the theoretical lectures there was practical education as well. Different techniques of flap surgery, mukogingival surgery and GTR were practiced on pig’s jaws. What I found most remarkable was to work with Emdogain, which I had not had the chance to encounter before, as well as an excellent hands-on course on mukogingival surgery.
The lectures in Implantology were also very interesting and useful, and they were followed by practical work. There were four implant systems presented, namely Astra, Strauman, Dentsply Friadent and Nobel Biocare. Three of these were completely new to me since I had only had the chance to work with Strauman. Apart from the educational side, the Summer School excelled in social activities as well. Excursions to Ludwigsburg, Speyer and the Neckar river cruise enabled us not only to get to know more of German culture and history, but also for the participants to get to meet each other and this way make new professional and personal contacts. As a word of conclusion, this Summer School in Periodontology fully met my interests and expectations, and I am very pleased to have attended it. The theoretical and practical knowledge I have acquired will surely advance my future work, and mainly my work with the students. The schedule was exceptionally well organized, and the effort alongside with the positive energy put into the whole project by Dr Kim was remarkable. I can only say: thank you for inviting me. With best regards,
Dr Milanko Djuric Clinic for Dentistry, Medical Faculty, Novi Sad, Serbia
80
24th August, 2006.
FINAL REPORT
International Summer School for Clinical Periodonto logy
and Implantology
July 31 st to August 11 th, 2006
Name: Cassia Tiemi Fukuda Country: Brazil E-mail: [email protected] or [email protected] OBJECTIVES
The aim of this summer school was to acquire knowledge and to have the opportunity to be up-to-date with the Periodontology field (research and clinical). Above all, the objective was to attend a forum in order to exchange ideas between different nationalities and to develop the networking between the 15 dentists. RESULTS The objectives previously established were mostly achieved and some are in implementation. During the summer school at the University of Heidelberg, I was able to develop many different activities that can be divided in academical and cultural issues. a) Academical
Academically, we had lectures/classes reviewing the basic Periodontal principles for the common understanding of all the 15 dentists with different background.
Interactive classes and debates on important themes such as Full Mouth Disinfection and Furcation Treatment were exciting and motivated us to talk and interact. We could exchange experience with other countries students’ about some corner-stones in Periodontology.
Furthermore, we had the unique opportunity to clarify doubts and hear opinion of well known researchers and teachers. For example, the discussion on Antibiotics with Dr. Caton or on Aggressive Periodontitis with Dr. Machtei. Discuss about the different drugs, surgery techniques and treatment planning around the world were enriching.
The interesting hands-on activities provided us clinical practice ideas of Flap Surgeries, Placement of Implants, Mucogingival Surgeries, Endogain and Furcation Treatment so that we could learn a different suture, a different tip, a different instrument, a different technique or even an important unattended detail.
Getting in touch with 3 different implant systems (hands-on) was excellent since we could observe and be aware of the advantages and disadvantages of each kind of implant, depending on the teeth and patient.
81
All in all, we learn to try the best treatment planning for our patient. Nevertheless, treatment planning is not an easy task to comment on since I believe that each patient represents a particular case, we cannot generalize and just try to fit patients into certain pre-established groups. However, it seems that University of Heidelberg as University of Sao Paulo is mainly conservative, using evidence based concepts, files (radiographs, photos, probing and clinical attachment) and common sense when deciding guidelines of a patient’s treatment.
The knowledge acquired, as well as the opportunity I had to compare and contrast various clinical procedures, technology applied and structure will be of paramount importance for better complying with the patient’s and research needs. b) Cultural Culturally, we had the opportunity to visit the most famous sightseeing spots of Heidelberg city such as the wonderful castle. The welcome party at the Botanical Garden was the event that introduced me to German culture, as well as, to the pleasant area of University of Heidelberg. Moreover, we went to the Neckar River Cruise on the last day which was really amazing since we were able to have a highlight of all history and culture of Heidelberg city and surroundings. The tour to Speyer and to the Castle of Ludwisburg were very interesting with the pleasant company of Prof. Paul Romano and family. Visiting the Sirona Dental Company at Bensheim was surprising owing to the fact that we were able to walk through the company and be delighted with their high quality products show room. For example, the Perioscan is an innovation in the Periodontal area and hopefully will save time for the dentist and for the patient as it will detect the points of the tooth surface with calculus. I believe that these organized excursions were extremely beneficial since we were able to learn also outside the classroom environment. All guided tours, with no exception, were outstanding.
All in all, we were able to experience German society closely concerning its culture, values and habits. LIVING CONDITIONS During the summerschool period I stayed for two days at ”Café Frish Hotel” which was close to the university and the breakfast were very good.
On August 1st, we moved to the “Guest House” inside the campus of the University of Heidelberg. Therefore, it was very well located; about 5 minutes walk from the UniversitatsKlinikum Heidelberg. Moreover, there were facilities such as a bakery, a bank, a bookshop, a bus stop, a public international telephone and a restaurant at the area. These facilities are extremely important for us, who are foreigners. We had laundry machines, one computer with internet and an entertainment area. The apartment was well furnished in all rooms (bedroom, kitchen, living room).
82
One only commentary would be on wireless internet access. We wanted to contact our families using our notebooks, but that was not possible at the university or the guest house. FUTURE PLANS Concerning my future plans after the summer school, I will try to adapt and put into practice all the dentistry aspects I observed. Moreover, I plan to debate with Brazilian periodontists the different concepts acquired, maybe we can adopt some of them, who knows? Also, after analyzing deeply how this cross-cultural summer school was enriching I will recommend to other students.
Above all, being in contact with different ideas and opinions about the same issue is extremely enriching since this fact help us to create our periodontal philosophy, our periodontal treatment protocol, our concept about what we think is more suitable to our clinical or research reality. I believe that by hearing and observing different concepts, we can get from each one what we think is the best to build our own concepts. GENERAL OPINION
First of all, I would like to thank Dr. Ti Su Kim for all the attention and concern since the very first e-mails. She has strength and energy that makes things happen! I really admire her for all the initiative and willing to always improve more and more. If she has a goal, hardly one is going to defeat her. Moreover, Dr Kim’s staff (Raluca, Sven, Isabel, Helga, Neils) had patience and gave us attention with doubts and questions concerning academic or any other field.
I am honored to have been presented to such a serious, hard working, responsible and renowned department. ACKNOWLEDGEMENTS
Surely, this summer school enriched my personal and academic life with different experiences. Nevertheless, I believe I still have a long journey of research and clinical apprentice as a Periodontist as I saw excellent examples of dedication and perseverance in Germany.
These great experiences contributed to increase my motivation on the endless quest for life knowledge and academic education. This great experience promoted by University of Heidelberg and University of Sao Paulo will be of utmost value, since it has created a differential in my career - to help promote a better society with my periodontics services in clinical and academic field.
For this would not be possible if I did not have support from:
• Dr. Ti Su Kim, who organized the summerschool, thanks you for all efforts to make our stay most fruitful and enjoyable.
• University of Heidelberg for the scholarship • University of Sao Paulo for the scholarship • Dean Francisco Emilio Pustiglioni and Prof. Giorgio De Micheli for all
the encouragement
83
• The companies that supported the summerschool: DentsplyFriadent, GABA International, Nobel Biocare, Sirona, Strauman
• The organizations that supported the summer school: German Society of Dental, Oral and Maxillofacial Medicine, German Society of Periodontology, New Working Group for Periodontology
• The professors and lecturers: Prof. Jack Caton and Prof. Paul Romano (University of Rochester), Prof. Matchei (Ramban Medical Center, Israel) , Prof. Peter Eickholz (University of Frankfurt), Prof. Petra Ratka-Kruger (University of Freiburg) and University of Cologne
• My new friends all over the world, a unique mixture: Alexandrina, Gary, Giedre, Ilana, Inguna, Jin, Laurina, Maria Celina, Melanie Frange,Milanko Djuric,Nedzad Tahmiscija,Nikoina Trupeljak,Priscila Corraini, Sanja Jurisic, Young Taek Kim, Zeljka Kojic