suleiman 1

8/12/2019 Suleiman 1

http://slidepdf.com/reader/full/suleiman-1 1/8

American Journal of Research Communication www.usa-journals.com

Suleiman, et al., 2014: [email protected]

Comparison of Widal test and polymerase chain reaction for early and

rapid diagnosis of typhoid fever

Suleiman Ali and Mohammed Nafi

AL-Neelain University, Faculty of Medical Laboratory Science – Khartoum - Sudan

Correspondence: Suleiman Ali Suleiman

AL-Neelain University, Faculty of Medical Laboratory Science, Microbiology

Department - Khartoum-Sudan

Phone: +249912906129, E-mail: [email protected]

Abstract

Background: Typhoid is a common problem in developing countries. Cultivation of bacteria

and serology (especially Widal test) gives unacceptable levels of false-negative and false-

positive results, respectively.

Aim: The aim of this study is to compare Widal test and Polymerase chain reaction for the

detection of the early typhoid fever.

Method: A total of 80 suspected cases of typhoid fever were included in this study. Blood

samples (serum and EDTA) were collected from all cases during the first week of illness.

Widal test and polymerase chain reaction were carried for all samples.

The results: A total of 80 individuals of both gender suspected to have typhoid fever were

included in this study, of them 19 (23.8%) were positive and 61 (76.2%) were negative for

Salmonella typhi O, whereas for Salmonella paratyphi BO 20 (25%) were positive and 60

(75%) were negative. For PCR 10 (12.5%) were positive and 70 (87.5%) were negative.

There was significant differences by using Widal test and PCR in diagnosis of typhoid fever

p. value 0.000

Conclusion: PCR technique is not only absolutely specific, but also very sensitive and,

therefore, much superior to Widal test for the early diagnosis of typhoid.





Key words: PCR, Salmonella, Typhoid fever, Widal

{Citation: Suleiman Ali, Mohammed Nafi. Comparison of Widal test and polymerase chain

reaction for early and rapid diagnosis of typhoid fever. American Journal of Research

Communication, 2014:} www.usa-journals.com, ISSN: 2325-4076.

Introduction

There are an estimated 21 million new cases and 216,000 deaths attributed to typhoid fever

every year (1). The disease, caused by Salmonella enterica serovar typhi, remains a common

problem in many parts of the world where access to clean water is limited. In the regions

where enteric fever is common, clinical diagnosis of typhoid fever is inadequate, as the

symptoms it causes are non-specific and overlap with those of many other febrile illness

including malaria, dengue fever, rickettsioses, leptospirosis and melioidosis (2). Widal test is

agglutination assay in which Salmonella typhi cells are used to detect antibodies in blood.

Many of the surface antigens of the enterobacteriaceae demonstrate significant conservation

and induce antibodies that are cross-reactive. Consequently, the Widal test has very low

sensitivity and specificity, and little or no practical value in endemic areas despite its

continued use (2). Several other serologically based assays are available for use in typhoid

diagnosis including, Typhidot and Tubex, but have the same problems associated with the use

of the Widal test (3). Isolation of the salmonella remains the most reliable diagnostic method

in suspected typhoid fever and blood has been the main sample used for culture of the

organism (4,5). However, blood culture can only identify 45 to 70% of patients with typhoid

fever, and is highly dependent on the amount of blood sampled. In addition the bacteraemic

level of Salmonella t yphi, the presence of bactericidal activity in the blood, recent

administration of antibiotics may all affect the sensitivity. The intracellular nature

http://www.usa-journals.com/


http://www.biomedcentral.com/1471-2334/12/164#B1













of Salmonella serovar Typhi also slows its growth in blood culture media. In addition, blood

culture takes at least 2 to 5 days before the identification of the organism, which is often too

late to initiate appropriate antibiotic therapy (6,7). Given the problems associated with

serological methods and blood culture, PCR based methods have been exploited recently

because they can theoretically amplify DNA only from Salmonella t yphi (specificity) and

should detect even low numbers of live or dead bacterial cells (sensitivity) (8,9). The aim of

this study is to compare between Widal test and Polymerase chain reaction for the detection

of the early typhoid fever.

Methods

A descriptive cross-sectional study was done between June and October 2013 at Khartoum

Teaching hospital, Khartoum state. A total of 80 suspected cases of typhoid fever both male

and female were included in this study, individual with past history of typhoid fever, and

individual complaining from fever with any obvious focus for other infections were excluded

from this study. Two venous blood samples were collected (2.5 ml in EDTA, and other 2.5

ml in plain container), serum was prepared from the plain container for Widal test, and

EDTA was stored at – 20oC for DNA extraction and PCR.

Widal test procedure

The Vidal agglutination test was done by a tube titration method, using Murex reagents

(Murex Biotech Limited, UK) containing O (somatic) and H (flagellar) antigens of

Salmonella typhi and O and H. antigen of Salmonella paratyphi A and B , with serial dilutions

of sera beginning at 1:10. Patient serum is doubly diluted by mixing and transferring from

1:10 to 1:640 in three-four rows. First row usually comprises of Felix tubes, where somatic S.

typhi O antigen was added. For all the remaining rows, Dreyer’s tubes were taken; where

different flagellar H antigens are added. Each tube contains 0.5 ml of diluted serum. A test





tube with only saline was kept in each row as a control. All the tubes (including control) in a

row were mixed with 0.5 ml of antigen suspension. The first row is treated with S. typhi O

antigen, the second row with S. typhi H antigen, the third row with S. paratyphi A H antigen

and the fourth row with S. paratyphi B H antigen. Since infections by S. paratyphi B are rare,

this antigen is usually omitted in the test. After all the tubes have been treated with specific

antigen suspensions, the widal rack is placed in a thermostatically controlled water bath

maintained at 37oC for overnight incubation.Titer 80 and more was regarded as positive for

typhoid fever.

Detection of Salmonella using PCR

DNA extraction: One mL of blood containing 20 mM potassium EDTA as anticoagulant

was centrifuged at 10,000 rpm for 5 minutes. One mL of lysis buffer (0.2% Triton X100 in

Tris HCl pH 8.0) was added to the pellet. The mixture was gently aspirated several times to

effect hemolysis. The tube was centrifuged at 12,000 rpm for 6 minutes, the supernatant was

discarded, and the procedure was repeated once. The pellet was washed once with distilled

water. After the removal of the supernatant, the pellet was resuspended in 20-30 μL of

distilled water. The tubes were sealed, kept in boiling water for 20 minutes, and brought back

to room temperature before being used as a template for PCR.

PCR Procedure: The flic-d gene sequence of salmonella serovar typhi was detected by

PCR,. The primer sequences were as follows: forward primer

ACTCAGGCTTCCCGTAACGC; reverse primer GGCTAGTATTGTCCTTATCGG. The

reaction was performed in a 50 μL volume using Jena Bioscience, Germany master mix of

thermostable DNA polymerase for PCR. Thermo-cycling conditions in a Techne

thermocycler (Bibby Scientific Limited, Beacon Road, Stone, Staffordshire, ST15 0SA, UK)

were as follows: 95°C for 5 min, followed by 35 cycles of 93°C for 30 Sec, 55°C for 30 Sec





and 72°C for 40 Sec, with a final extension at 72°C for 5 min. The amplified products (5 μl)

were separated by electrophoresis on 1% agarose gel and visualized by staining with

ethidium bromide using UV gel documentation system. A163-bp PCR product was amplified

with the above flic-d gene specific primers.

Ethical Clearance: Approval was taken by the ethical review board of the Faculty of

Medical Laboratory Sciences Al-Neelain University. Verbal consent was taken from each

study unit

Results

A total of 80 individuals of both sexes suspected to have typhoid fever were included in this

study, of them 19 (23.8%) were positive, 61 (76.3%) were negative for S. typhi O, whereas

for S. paratyphi BO 20 (25%) were positive and 60 (75%) were negative, for PCR 10

(12.5%) were positive and 70 (87.5%) were negative. In comparison, between Widal test and

PCR results, 7 cases were positive by both S. typhi O Ag and PCR, 3 cases were positive by

PCR and negative by S. typhi O Ag and 12 cases positive by S. Type O Ag and negative by

PCR; On the other hand 10 cases were positive by both S. paratyphi BO Ag and PCR while

10 cases were positive only by S. paratyphi BO Ag. There was a significant difference by

using Widal test (tube) and PCR in diagnosis of typhoid fever p. value 0.000.

Table 1: Comparison between PCR and Widal test

S. typhi O Ag S. paratyphi B O Ag

Positive Negative Positive Negative

PCR Positive 7 3 10 0

Negative 12 58 10 60

Total 19 61 20 60





Discussion

Typhoid fever is one of the most common infectious diseases in developing countries. Early

and definitive diagnosis of the disease is not only important in relieving patient’s suffering,

but also critical in avoiding fatal complications such as perforation of the intestines. It also

makes possible specific treatment at an early stage, which leads to the rapid elimination of the

pathogen. Otherwise, the patient’s excreta, especially stool, becomes a constant source of

spread of the disease. Although various diagnostic techniques have been used, Widal test is

the most favored method. Widal test is not a candidate for early detection of the disease

because specific antibodies take at least one week to reach detectable levels. Beside these

shortcomings, its value is further diminished by its non-specificity. It is particularly

unreliable with single titers (10). The recent introduction of PCR techniques offers highly

specific, sensitive and reasonably quick diagnostic modality. Even 1-5 bacteria/mL can be

detected with absolute specificity within 1-2 days. We decided to check this theoretical

promise of PCR on the actual situation and compare it to Widal test. For polymerase chain

reaction, we preferred to target the flagellin gene because its hypervariable, region VI is

unique for Salmonella typhi, and its amplification provides 100% specificity The alternative

method in which the Vi gene is targeted can give false-positive results because of the

presence of Salmonella paratyphi C.(11). The sensitivity of the latter has been reported to be

more (5 bacteria/mL) than the former (10 bacteria/mL). The sensitivity of our regular PCR

was tenfold more than that reported by Song et. al. (12). There were significant differences by

using Widal test and PCR We conclude that PCR is much superior to Widal test. It has great

discriminating value due to its very high sensitivity and specificity. Therefore, it can be of

singular importance for the detection of early cases of typhoid, which is not only important

for the treatment of patients but is also necessary for control of the disease. Due to the need

for extensive infrastructure and specialized skills, the PCR facility cannot be made available





everywhere, especially in developing countries. Nevertheless, due to its high sensitivity and

specificity, as demonstrated in this study, it needs to be made available to everyone by

establishing collection centers, which can send samples to a few specialized reference

laboratories built in larger cities. Another factor to be considered is the relatively high cost,

which is almost twice that of blood culture. In fact, due to the rapid and definitive diagnosis,

the patient is saved from hospital admission, loss of working days, unnecessary expenditure

on unrelated and misdirected treatment which may be many times more than the cost of PCR.

It is believed that in the long run, it will turn out to be less expensive for both the patient and

the community. Furthermore, due to rapid diagnosis and definitive treatment, the patient’s

physical suffering is reduced to a minimum.

References

1. Crump JA, Mintz ED: Global trends in typhoid and paratyphoid fever. Clinical Infectious

Diseases 2010, 50:241-6

2. Levine MM, Grados O, Gilman RH, Woodward WE, Solis-Plaza R, Waldman W:

Diagnostic value of the Widal test in areas endemic for typhoid fever. Am J Trop Med

Hyg 1978, 27:795-800.

3. Prakash P, Sen MR, Mishra OP, Gulati AK, Shukla BN, Nath G: Dot enzyme

immunoassay (Typhidot) in diagnosis of typhoid fever in children. J Trop

Pediatr 2007, 53:216-217.

4. Parry CM, Hien TT, Dougan G, White NJ, Farrar JJ: Typhoid fever. N Engl J

Med 2002, 347:1770-1782.

5. Wain J, Hosoglu S: The laboratory diagnosis of enteric fever. J Infect Dev

Ctries 2008, 2:421-425.

6. Wain J, Pham VB, Ha V, Nguyen NM, To SD, Walsh AL, Parry CM, Hasserjian RP,

HoHo VA, Tran TH, Farrar J, White NJ, Day NP: Quantitation of bacteria in bone

marrow from patients with typhoid fever: relationship between counts and clinical

features. J Clin Microbiol 2001, 39:1571-1576.

7. Wain J, Diep TS, Bay PV, Walsh AL, Vinh H, Duong NM, Ho VA, Hien TT, Farrar J,

White NJ, Parry CM, Day NP: Specimens and culture media for the laboratory diagnosisof typhoid fever. J Infect Dev Ctries 2008, 2:469-474.

http://www.biomedcentral.com/sfx_links?ui=1471-2334-12-164&bibl=B12







8. Ali A, Haque A, Sarwar Y, Mohsin M, Bashir S, Tariq A: Multiplex PCR for differential

diagnosis of emerging typhoidal pathogens directly from blood samples. Epidemiol

Infect 2009, 137:102-107.

9. Levy H, Diallo S, Tennant SM, Livio S, Sow SO, Tapia M, Fields PI, Mikoleit M,

Tamboura B, Kotloff KL, Lagos R, Nataro JP, Galen JE, Levine MM: PCR method toidentify Salmonella enteric servers typhi, paratyphi A, and paratyphi B among salmonella

Isolates from the blood of patients with clinical enteric fever. J Clin

Microbiol 2008, 46:1861-1866.

10. Abdul Haque, PhD; Janbaz Ahmed, MBBS, M Phil; Javed A. Qureshi, PhD EARLY

Detection of Typhoid by Polymerase Chain Reaction. Annals of Saudi Medicine. 1999,19:

337-340

11. Ambati SR, Nath G, Das BK: Diagnosis of typhoid fever by polymerase chain reaction.

Indian J Pediatr 2007, 74:909-913.

12. Song JH, Cho H, Park MY, Na DS, Moon HB, Pai CH: Detection of Salmonella typhi in

the blood of patients with typhoid fever by polymerase chain reaction. J Clin

Microbiol 1993, 31:1439–1443.


suleiman 1

Documents