THE JOURNAI, IJF BIO~GICAL. CHEMISTRY Vol. 265, No. 3, Issue of January 25, lq~ 1683-X87,1990 CC 1990 by The American Society for Biochemistry and MolecuIar Biology, Inc. Printed m U.S. A.

Structure of the Human Smooth Muscle o-Actin Gene ANALYSIS OF A cDNA AND 5’ UPSTREAM REGION*

(Received for publication, June 9, 1989)

Sita Reddy$$, Kemal Ozgurll, Melvin Lu$i[, Wen Changs, Sheela R. Mohanll, C. Chandra Kumarl7, and H. Earl Ruley#** From the §Center for Cancer Research, Massachusetts Znstitute of Technology, Cambridge, Massachusetts 02139 and the YlDepartment of Tumor Biology, Schering Research, Bloomfield, New Jersey 07003

The structures of a cDNA and the 5’ upstream region of the human smooth muscle a-a&in gene have been characterized. Transcriptional start sites and the non- coding first exon were mapped by primer extension analysis and by comparing cDNA and genomic se- quences. The deduced human smooth muscle a-a&in protein sequence is identical to the corresponding bo- vine protein sequence, and thus confirms that the pre- viously determined human genomic sequence con- tained a mutation at codon 312. Human smooth muscle cells express only a single, 1.4-kilobase smooth muscle o-a&in transcript. 5’ Noncoding sequences that have the greatest similarity to the chicken gene are located in five noncontiguous segments, extending from ap- proximately 250 base pairs upstream of the cap site through the first exon. Conserved sequences encom- pass a region required for expression and tissue-spe- cific regulation of chicken smooth muscle a-a&in and therefore are probably also important for expression of the human gene.

A&ins are highly conserved proteins expressed in all eucar- yotic cells. Actin filaments form part of the cytoskeleton and play essential roles in regulating cell shape and movement. Six distinct a&in isotypes have been identified in mammalian cells (1). Each is encoded by a separate gene and is expressed in a developmentally regulated and tissue-specific manner. a and B cytoplasmic isoactins are expressed in a wide variety of cells; whereas, expression of a skeletal, a cardiac, a vascular, and -y enteric isoactins is more restricted to specialized muscle cell types.

As a&ins are highly related with regard to sequence and yet are differentially expressed, the gene family provides a special opportunity to understand factors responsible for tis- sue-specific expression. Smooth muscle a-actin is of further interest because it is one of a few genes whose expression is

* This work was supported in part by National Cancer Institute Grant ROl CA42063, National Heart, Lung and Blood Institute Grant POlHL41484 (to H. E. R.), and Cancer Center Core Grant 14051 (to P. A. Sharp). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “uduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) JO5192 (cDNA) and JO5193 (promoter).

$ To whom correspondence should be addressed. Tel.: 617-253. 0264.

11 Current address: Box 441,36th and Hamilton Walk, Philadelphia, PA 19104-6092.

** Rita Allen Foundation scholar.

relatively restricted to vascular smooth muscle cells. Further- more, expression of smooth muscle a-a&in is regulated by hormones (Z), cell proliferation (3), and altered by patholog- ical conditions including oncogenic transformation (4) and atherosclerosis (5, 6).

The human smooth muscle a-actin gene has only been partially characterized (7). Genomic clones which cross-hy- bridized to Dictyostelium actin sequences were isolated and the majority of coding exons sequenced. However, the pro- moter region and the first and last exons were not analyzed. To assist future efforts to understand the regulation and tissue-specific expression of the human smooth muscle a- actin gene, we have characterized a nearly full-length cDNA and the structure of 5’ noncoding region.

MATERIALS AND METHODS’

RESULTS AND DISCUSSION

Isolation and Nucleotide Sequence of the Human Smooth Muscle wActin cDNA-The nucleotide sequence of the 1.4- kb2 human smooth muscle a-a&in cDNA insert contained in clone pea is shown in Fig. 1. The cDNA insert was nearly full-length and include& (i) the entire a-actin coding se- quences present within a 377-amino acid open reading frame and (ii) 47 and 147 nucleotides of 5’ and 3’ untranslated sequences, respectively. As with both vertebrate (8, 9) and invertebrate actins (10, 11) the protein sequence begins with the dipeptide Met-Cys, which is removed post-translationally G9.

The structure of the first exon of the human smooth muscle a-actin gene was determined (as discussed below) by (i) com- paring cDNA and genomic sequences, (ii) mapping the tran- scriptional start site by primer extension, and (iii) noting sequence similarities to exon 1 of the chicken a-actin gene (13). Based on these considerations, the 5’ end of the cDNA extended 24 nucleotides into exon 1 and lacked just 19 nucle- otides immediately downstream of the transcriptional start site.

The predicted amino acid sequence of the human smooth muscle a-actin is identical to the bovine sequence (14) and the coding region was identical to a previously determined genomic sequence (7), with the exception of a single base change that places alanine, rather than valine, at position 312. This difference was not unexpected since Ala312 (13, 14) is present in all other sequenced vertebrate smooth muscle a-

’ Portions of this paper (including “Materials and Methods” and Fig. 2) are presented in miniprint at the end of this paper. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are included in the microfilm edition of the Journal that is available from Waverly Press.

’ The abbreviation used is: kb, kilobase.

1683

by guest on August 19, 2020

http://ww

w.jbc.org/

Dow

nloaded from

1684 Human Smooth Muscle cx-Actin cDNA and 5’ Upstream Region

.2 . GCAGCCCAGCCFNZCACTGTCAGGAATCCTGTGAAGZAGCTCCAGCTATGTGTGAAGAA

MetCysGluGlu

GTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGA ValMetValGlyMetGlyGlnLysAspSerTyrValGlyAs~l~laGlnSerLysArg

4 . G-GATCT~CACCAC~TTTCTAC~TGAGCTTCGTGTT~CCCTG~GA~ATCCC GluLysIleTrpHisHisSe~PheTyrAsnGluLeuArgValAlaPr~luGluHisPra

59 (4)

119 124)

179 (44)

239 (64)

299 184)

359 <lo41

419 (124)

419 (144)

539 (1641

599 (184)

659 (204)

719 m4)

179 (244)

839 (264)

899 (284)

959 1304)

1019 (324)

1079 (344)

1139 (3641

1199 (3311

1259

1319

FIG. 1. Sequence of a human smooth muscle a-actin cDNA. Numbers in the right margin refer to the last nucleotide or amino acid in each line. The boundaries of exons (2-9) and the deduced amino acid sequence are indicated. Amino acid changes from the chicken (residue 234) and the rat (residues 148,234, and 299) proteins are indicated. Codon 312 which was previously reported to encode valine and a sequence likely to form part of a polyadenylation signal have been underlined twice.

actins, and the result confirms previous speculation that Va13” arose by mutation (7).

Zsolution and Nucleotide Sequence of the Human Smooth Muscle a-Actin Promoter-A partial restriction map (Fig. 2) of PLY, a cosmid clone containing a portion of the human smooth muscle a-actin gene, was generated by Southern blot analysis, probing with a synthetic oligonucleotides homolo- gous to exon 2 of the human gene and with the promoter region and exon I of the chicken gene (a 1.6-kb EcoRI/SspI fragment from pAC377 (13)). The restriction map obtained by this analysis (Fig. 2) showed that the size of the first intron in the human a-actin gene is approximately 3.7 kb. This map also agreed with a previously published restriction map (7), demonstrating that the a-actin sequences were not rearranged during cloning.

To facilitate an analysis of the 5’ end of the human gene, pa sequences contained within a 3.6-kb EcoRI/BamHI frag- ment that hybridized to the chicken promoter region were subcloned. The subcloned region was also used to probe human genomic and pa DNAs cleaved with EamHI + EcoRI, BgDI, PwII, and EcoRV (data not shown). The hybridization pattern indicated that the 3.6-kb EcoRI/BamHI fragment lacked repetitive sequences.

The sequence of the first exon and 896 base pairs upstream of the transcriptional initiation site was determined as shown in Fig. 3. Major transcriptional start sites were mapped by primer extension analysis (Fig. 4) to three adjacent purines contained in the sequence, GAA. The sequence, TATATAA, located from 23 to 29 nucleotides upstream from the transcrip- tional start site, is probably a TATA box, since this transcrip- tional element is frequently located at a similar position in eucaryotic promoters that utilize RNA polymerase II (15). The sequences CCTTGTTTGG and CCCTATATGG, located at positions -62 to -71 and -112 to -121, respectively, resemble CArG elements (consensus sequence, CC(A/T)eGG) found upstream of the skeletal (16,17) and cardiac (18) muscle a-actin genes and implicated in muscle-specific gene expres- sion (19-22).

Comparison of Human and Chicken a-Actin 5’ Sequences- The present study is the second (after the chicken) to describe sequences in the 5’ upstream region of a vertebrate smooth muscle a-actin gene. It is therefore interesting to compare human and chicken sequences for conserved sequence ele- ments that may be involved in gene regulation. Fig. 5 shows a comparison of the two sequences using the Dot Plot (23) computer program. The sequences were compared 21 nucleo- tides at a time, and matches of 14 or more nucleotides were recorded as dots. Stretches of similar sequence appear as

G~TTCGAGACGAGATTTGGGTGGGGACGTAG~CC~CCATATCACCT~TCTCTCTA -836

CTTCCTGTC~GGAGGTTA~TGGGCAGAG~~AGGGCTACA~G~TTC~TTTG~C~T -776

CTCCTTTCT~TTCC~CT~CTTCTTTGACA~CT~T~TAGACTCTCTGGTC~~ -716

ATGGTCCCTACTTAT~TGCT~TTGCTC~TGAC~TTAGTAGAC~GCT~T~A -656

cc-* TGAATGTAGTTATAGTAATGCTAACATCCAAATTCCTCTTTGTAAGACATA Hid1

~CCTGTC~CCTTGTCTCCATACTTC~TTCCTATTTCCACTCACCTCCCTC~G~CT

TGATTTAT~CAGTGTGCCTACCAT~TCATCACTCCCTCTATGTATTTATAGACGA . 5ph1 .

CTG~GG~TATCTTTCTTCTTT~AT~TACCGT~TAG~~GTTTT~GTCCGTG

GTTTATCTCCCACAGGCGGCTG~CCGCCTCCCGTTTCATGAGCAGACCAGT~~TGCA

GTGG~GAGACCCAG~CTCCGGCCACCCAGATTAGAGAGTTTTGT~TGA~T~

A'J&TTGTGTTAGACTGAACGACAGGCTCAAGTCTGTCTTTGCTCmGAAGCA

AGTGGGAGGAGAGCAGGCCAAGGGGC DraIII .

TGTGACTTATAGATTCCAGTGGCTCTTTT~TTACCCGGTAT~T~GACATCATCTGCA

~GATTT~CTGGGTTCATGCACTGATATTTCTG~TG~GATTGTACTACT-TGAT

TGTAGCTTTTGGCTTTAATGATCTAACGTTAAAGACAGGGCTAATAT 232

-596

-536

-476

-416

-356

-296

-236

-116

-116

-56

5

65

25

85

FIG. 3. Sequence of exon 1 and the 5’ flanking region of the human smooth muscle a-actin gene. Numbers in the right margin refer to the relative position of the last nucleotide in each line to the transcriptional start site. The 5’ ends of a-actin RNA mapped by primer extension (*), a likely TATA box sequence (-), exon 1 sequences (=), and sequences resembling CArG elements (w) are also indicated,

by guest on August 19, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Human Smooth Muscle a-Actin cDNA and 5’ Upstream Region 1685

A

FIG. 4. Determination of the tran- scription initiation sites of human smooth muscle a-actin gene by primer extension analysis. 5’-“P-La- beled oligomers corresponding to exon 1 (SC.001) and exon 2 (X.002) sequences were hybridized to 5 pg of total poly(A+) RNA isolated from human vascular smooth muscle cells and extended with reverse transcriptase as described under “Materials and Methods.” A, the ex- tended products primed by SC.001 (lane I) or tRNA (lane 2) were electropho- resed on a 6% acrylamide/urea gel; end- labeled SC.001 was also used to prime dideoxy sequencing reactions using p&i as the template (/anes 7’, C, G, end A). B, the extended product primed by SC.002 (lane I) or tRNA (lane 2) were electrophoresed next to a sequencing ladder generated using Ml3mpl8 DNA and -20 Ml 3 universal primer (larzes A,

E z= - T -

C, G, and T). The size of the extended products primed by SC.002 were deter- mined based on the known Ml3mpl8 sequence.

2 1 T G C A

B

+71- +70= t69

+60-

+50- -+.*

FIG. 5. Comparison of exon 1 and 5’ flanking sequence of the human and chicken smooth muscle cz-actin genes. In this analysis sequences were compared 21 nucleotides at a time, and matches of 14 or more nucleotides were recorded as dots. The struc- ture of the chicken and human smooth muscle o-actin genes are shown on the uertical and horizontal axis, respectively. Positions of exon 1, sequences resembling the CArG box, and the TATA box are indicated. Marked sequence similarities (A-G) are discussed in the text.

diagonal lines and duplicated sequences as parallel diagonal lines.

Upstream segments exhibiting the greatest similarity are located in five noncontiguous blocks (designated A-E) that

28S-.

lES--

1234587

FIG. 6. Northern blot analysis. 10 pg of total RNA isolated from the following cell lines were fractionated on a 1.5% agarose/ formaldehyde gel, transferred to Gene Screen (Du Pont-New England Nuclear) membranes, and hybridized with nick-translated a-actin cDNA fragment. Lane I, human vascular smooth muscle cells; lane 2, K-HOS revertant cell line 312H; lane 3, K-HOS revertant 240 S cell line; lane 4, human foreskin fibroblasts; lane 5, KD human fibroblast cells; lune 6, VAl3-SV40 transformed human KD fibroblast cells; and lane 7, N-methyl-W-nitro-NWnitrosoguanidine-HOS cells.

extend through the first exon (A) to approximately 250 base pairs upstream of the cap site (E). The overall homology through this region is 72.6%; whereas, the homology between sequences located either further upstream or downstream (in the first intron) is 45.1 and 46.6%, respectively. For compar- ison, the homology between human and chicken smooth mus- cle a-actin coding sequences is 85.5%. Regions A through E encompass sequences required for expression and tissue-spe- cific regulation of chicken smooth muscle a-actin (24), sug- gesting that the conserved sequences are important for expres- sion of the human gene.

Homology region B includes a likely TATA box sequence (TATATAAA) located in a contiguous stretch of 19 conserved

by guest on August 19, 2020

http://ww

w.jbc.org/

Dow

nloaded from

1686 Human Smooth Muscle a-Actin cDNA and 5’ Upstream Region

nucleotides and one of two perfectly conserved sequences (CCTTGTTTGG) that resemble CArG elements. The second sequence (CCCTATATGG) resembling a CArG element is found in homology region C. As CArG elements have been found upstream of both cardiac (18) and skeletal muscle actin

sequence has been reported elsewhere (Kamada, S., and Kakunaga, T. (1989) Nucleic Acids Res. 17, 1767).

REFERENCES

1. Buckingham, M., Alonso, S., Bugaisky, G., Barton, P., Cohen, A., Daubas, P., Minty, A., Robert, B., and Weydert, A. (1985) Adu. Exp Med. 182,333-344

Hsu, C.-Y. J., and Frankel, F. R. (1987) J. Viol. Chern. 262, 9594-9600

genes (16, 17) in regions required for gene expression, and as muscle cells contain factors which bind sequences related to the CArG consensus (20-22), it is likely that the CArG elements in regions B and C play a role in the muscle-specific expression of the a-actin gene. Smooth muscle-specific expression, however, may require both muscle-specific and smooth muscle-specific cis-acting elements. It is possible that regions D and E contain regulatory sequences which are responsible for the unique expression pattern of the smooth muscle a-actin gene.

Two short, duplicated regions (F and G), located approxi- mately 800 and 750 base pairs upstream of the human gene, are similar to a region near the chicken CArG elements. The significance of this is not clear, since the corresponding region in the chicken gene is not duplicated. Finally, unlike the human a-skeletal (17) and a-cardiac (18) actin genes, se- quences similar to the CAAT box consensus are not present immediately upstream of the human smooth muscle a-actin gene.

Remarkably, sequences in the noncoding first exon are highly conserved. The last 20 nucleotides of exon 1 in the human and chicken genes are identical, and the overall ho- mology is 74.4%. In contrast, the untranslated portion of exon 2 is not conserved and varies in size (23 and 43 nucleotides in the human and chicken cDNAs, respectively). It seems un- likely that this homology exists simply by coincidence, and experiments to test whether exon 1 influences either the translation or stability of a-actin transcripts are in progress.

The 3’ untranslated segment constitutes the least con- served (66.7%) portion of the human and chicken smooth muscle a-actin transcripts. This accounts for the failure of probes derived from the 3’ end of the chicken gene to hybridize to Southern blots of human DNA (13).

Expression of Human Smooth Muscle a-Actin-Transcrip- tion of the human smooth muscle a-actin gene was investi- gated by Northern blot analysis (Fig. 6). Human vascular smooth muscle cells expressed a single RNA species of ap- proximately 1.4 kb in size. The size is similar to the length of the cDNA insert in pea. In contrast, the u-actin transcripts expressed in chicken smooth muscle cells utilize multiple polyadenylation signals, giving rise to at least four RNA species that range in size from 1.3 to 2.7 kb (13). Smooth muscle a-actin transcripts were not detected in human fibro- blasts or osteogenic sarcoma (HOS) cells. As HOS cells ex- press the smooth muscle isoform of myosin light chain-2, this suggests that smooth muscle isoforms of a-actin and myosin light chain may not be coordinately regulated.

Acknot&dgments-We wish to thank Dr. Richard J. Schwartz for the gift of uAC377, Dr. David Housman for the gift of a human co&id lib&y, Dr. Charles Seldon for the gift of the-human vascular smooth muscle cells, Launce Gouw and Mary Condello for technical assistance, and the Biopolymer Laboratory for the synthesis of the oligonucleotides.

No& Added in Proof-An identical smooth muscle a-actin cDNA

’ C. Kumar, manuscript in preparation.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18. 19.

20.

21. 22.

23.

24.

25.

26. 27. 28. 29.

30.

31.

32.

33.

34.

35.

36.

Owens, G. K., Loeb, A., Gordon, D., and Thompson, M. M. (1988) J. Cell Viol. 102, 343-352

Leavitt, J., Gunning, P., Kedes, L., and Jariwalla, R. (1985) Nature 316,840-842

Gabbiani. G.. Kocher. O., Bloom, W. S., Vandekerckhove, J.. and Weber,‘K.‘(l984) i C&. Iwe&. 73,‘148-152

Skalli. 0.. Rouraz. P.. Trzeciak. A.. Benzonana. G.. Gillenssen. D., ind’GaGbia;i, 6. (1986) J.’ Ceb Biol. 103, i78i-2796

Ueyama, H., Hamada, H., Battula, N., and Kakunaga, T. (1984) Mol. Cell. Biol4, 1073-1078

Hamada, H., Petrino, M. G., and Kakunaga, T. (1982) Proc. Natl. Acad. Sci. U. S. A. 79,5901-5905

Hanauer, A., Levin, M., Heilig, R., Daegelen, D., Kahn, A., and Mandel, J. L. (1983) Nucleic Acids Res. 11, 3503-3516

Cooper, A. D., and Grain, W. R., Jr. (1982) Nucleic Acids Res. 10,4081-4092

Fryberg, E. A., Bond, B. J., Hershey, N. D., Mixter, K. S., and Davidson, N. (1981) Cell 24, 107-116

Strauch, A. R., and Rubenstein, P. A. (1984) J. Biol. Chem. 259, 7224-7229

Carroll, S. L., Bergsma, D. J., and Schwartz, R. J. (1986) J. Biol. Chem.26 1,8965-8976

Vandekerckhove, J., and Weber, K. (1979) Differentiation 14, 123-133

Breathnach, R., and Chambon, P. (1981) Annu. Rev. Biochem. 50,349-383

Grichnik. J. M., French, B. A., and Schwartz, R. J. (1988) Mol. Cell. Biol, 8, 4587-4597

Muscat, G. E. O., and Kedes, L. (1987) Mol. Cell. Biol. 7, 4089- 4099

Minty, A., and Kedes, L. (1986) Mol. Cell. Biol. 6, 2125-2136 Gustafson, T. A., Miwa, T., Boxer, L. M., and Kedes, L. (1988)

Mol. Cell. Biol. 8, 4110-4119 Miwa, T., Boxer, L., and Kedes, L. (1987) Proc. Natl. Acad. Sci.

U. S. A. 84,6702-6706 Miwa. T.. and Kedes. L. (1987) Mol. Cell. Biol. 7.2803-2813 Musc& &. E. O., G&ta&on, ‘T. A., and Kedes; L. (1988) Mol.

Cell. Biol. 8, 4120-4133 Maize& J. V., and Lenk, R. P. (1981) Proc. N&l. Acud. Sci. U. S.

A. 78, 7665-7669 Carroll, S. L., Bergsma, D. K., and Schwartz, R. J. (1988) Mol.

Cell. Biol. 8, 241-250 Kumar, C. C., Mohan, S., Zavodny, P., Narula, S., and Leibowitz,

P. (1989) Biochemistry 28, 4027-4035 Hanahan, D., and Meselson, M. (1980) Gene (Am&.) 10,63-67 Sanger, F. (1981) Scierzce 214, 1205-1210 Henikoff, S. (1984) Gene (Amst.) 28, 351-359 Tavis, J. E., Walker, D. L., Gardner, S. D., and Frisque, R. J.

(1989) J. Viral. 63,901-911 Putney, S. D., Benk&ic, S. J., and Schimmel, P. R. (1981) Proc.

Natl. Acad. Sci. U. S. A. 78, 7350-7354 Birnboim, C., and Doly, J. (i979) Nucleic Acids Res. 7, 1513-

1523 Devereux, J., Haeberli, P., and Smithies, 0. (1984) Nucleic Acids

Res. 12,387-395 Dayhoff, M. O., Barker, W. C., and Hunt, L. T. (1983) Methods

Enzymol. 9 1,524-545 Chomczvnski. P.. and Sacchi. N. (1987) An&. Biochem. 162,

156-li9 Aviv, H., and Leder, P. (1972) Proc. Natl. Acad. Sci. U. S. A. 69,

1408-1412 Kingston, R. (1988) in Current Protocols in Mokcukzr Biology

(Ansubel, F., et ul., eds) Greene Publishing Associates and Wiley-Interscience, New York

by guest on August 19, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Human Smooth Muscle a-Actin cDNA and 5’ Upstream Region 1687

Sita Reddy, Kernal Ozgur, Melvin Lu, wen Ch*ng, Sbeel* tl. Moh*n, C. Chad,* K”,“*r *“d H. E*rl R”ley

MATEFdALS AND METHOOS

O,igo”“cleo,ide* Oligonucleo,ide* were prep*r*d by ,he S~opolymer* L*bor*tory a the

MIT Center ,w Cancer Resewch *nd in ,he Dep*r,men, of Mokcukw Smlogy, schemg Corp. The following ~,ig~““~,e~,id**.~*~* used ** probes to !*o- Iale genomlc *nd cDNA clones *nd in primer extension experiments: ER.001 (S GGCTGCTTCCTCCCTGTTTTCTATAGAATCCTGTGAAGCAGCTCCAGCTAT W, *nd EFX.002 (5 AGTTGTCAGGTAAGTGCCACAAATGCCCAATTACAGCTGAGGC TGCTTCCTC 3’), which corre*po”d to sequences ‘ram ,he second ext.” *nd the end of the firs1 intro” respectively, b**ed on * p*r,i*l se+*nc* 0, ,he hum*n a-*c,in gene (7)); SC.00, (5 CAGTACAGTGCTTGGCTG 2 ) which car. responds to a sequence from em” I deduced in lhe present *,udy; and SC.002 (5’ CATAGCTGGGAGCTGCTTCACAGGATTC 3’) which is compl*men,*ry to *so” 2 A description of oligonucleo,id** u**d for DNA sequencing I* a”mlable 0” req”e*t.

SC.001 *nd SC.002 were puri,ied by electrophores~s on 20% poly*cryl*mide-TM Ure* gels, viw*lized by UV *h*dowtng, elu,ed I” 0.W Ammonium acetate, ImM EDTA, *nd O,,% SDS *nd prectpi,*,ed with eth*nol.

I.25 picomoles of oliqonucleot~de were 5’ end-l*belled usmq T4 polwucleo,ide kin**e in * ,O pl reaction cont*ining 5 pmle y3sF’--ATP (6000 CVmM, New E”g,*nd N”cle*r), 50 “I,., T,i* PH g.5, 70 mM MgCl~ *nd 5 mM d,,hlo,brei,o,,

oligonuckeo,ide* complem&t*ry to sequences in intron I (ER.002) *nd exon I (ER.001) o, ,he bum*n *moo,h muscle a-*c,in gene. sotll probes *ep*. r*,ely hybridized to ,wo of ,he ,OO,OOO colonies screened. ON 0‘ these, c,o”e p’a, w** puri,ied by two cycles o, colony hybridizaion *nd ch*r. *c,*rized in ,be preset, *,udy.

DNA **quencing DNA sequences were determfned from bo,h sing,* *nd double *,r*nd

templ*,e* by the dideoxy ch*in termin*,ion me,bod (27,. usnng ,h* Sequenase kit (United State* Siochemic*l Corp.) Single *,r*nded ,empl*k* corresponding to ,be bwwtn *moo,h musck m-*c,in cDNA were preptared by subcloning the ,.4 Kb EcoRl in*er, 0, kg,ca into M,3tnP,S a”d M73”,Pl9. The ends 0, the cONA inser, were sequenced using commerci*!ly *v*il*bl* pent*dec*mer primers. Werior sequences w*re determmed !n * step-WI** manner by synlhesizing oligonucleotides complementary ,o sequenced regions to prime re*ction* extending into previously un**quenced regions.

Double-*,r*nd ,empl*te* were used to de,ermine genomic sequences of lhe human smooth muscle a-adin gene. A 3.6 Kb Be”,Hl,EcoR, ‘ragme”, containing sequences hybridizing ,o the promo,*r region o, ,he chtcken <I-

*c,in gene were subcfoned ,rom pm in,0 pSlue*cript KS- (paK) *nd SK-(pus). Subclones 0, paS con,*ining ne*,ed, unidir*c,ion*l deletions were gene,- aled by the me,hod of Henikoff (281, ** modi,i*d by T*vi* e, *I. ,291. Exonuclease Ill-re*i*,*n, ends were generaed by cl**v*g* wi,h Apa! (Iewing * 3’ overh*ng ) or by incorpor*,ing pho*phorothio*,e deoxynucleo- iides (301 inlo rec***ed 3’ end* (gener*,ed by Cj.91 or Not,) using Klenow pOl~lYl*~~**. Ends *e”*,,i”e ,,, exo”“cl**** !I, were ge”*r*ted by EcoR, or SemIIf cleavege, *nd *xpo**d ,o ,be enzym* for v*riou* ,ime*. Single- *tr*nded dele,ion* were m*de blunt *nd double-stwmded using Sl nuclease *“d Kle”ov, p,,,yme,**e, ONA was recwcul*rized with T4 lig**e *nd used ,o lra”*‘orrn O”5.m cells. Pkmid DNA* isolaed from 5 ml cul,ur** using ,he alkaline lysts procedure (Jl), were (t) *n*lyzed ,o identi+y subclones con. lainlng *ppropri*,e deletions *nd (ii) used ** sequencing templaes.

Tow RNA w** i*o!*,ed from cultured cell lines ** described (34). Sriefly, cells were lysed in * solution cont*ining 4 M Gu*nidinium ,hlo- cyanate, 2S mM sodium *ce,*,* pH 4.0, ,OO mM D-merc*p,o*,h*nol and 0.5% *erko*yl. Lysates were thoroughly mixed wi,h *n equ*l volume of water **,w*ted phenol *nd mcub*,ed on ice ,or ,5 minu,e*. A,,*, the *ddi,ion of o”e-te”th “Ol”nw Of chlorlJ‘onn, equeous *nd org*nic ph**e* were sep. *r*ted by cen,rifug*,ion *, ,2,000 x g for ,S minutes. F,NA “,a* pre. cipi,*,ed from the *queou* ph**e by *ddi,ion of *n equ*l volume of tsw pV2p~“Cll. RNA petlets were wshed Wice wi,h 70% e,hanol, re-Pre. c#plt*,ed *nd dissolved in OS% SDS. PolyA conmming RNA was puri,led by oligo (dT) *ffini,y chrom*,ogr*phy (35).

primer ex,en*oon *n*ly*i* WI* cwried ou, e***nti*lly ** described el*e”fhere (3S). Sriefly, 5 Kg of poly A-con,*ining RNA and 10 pMole* 0, end-labeled SC.003 or SC.002 oligo were mixed *nd precipi,*,ed twce I” ethanol to remove unincorporated nucleo,ide*. Pellets were dissolved 1” (50 pl) 50 mM Tris-HCI pH ~3.3, 50 mM N*Cl, 5mM MgCl3, *nd 5 mM di,hio- threilol. Deoxynucleotode ,rvpho*ph*te*(,mM e*ch), *nd 50 uni,* 0, AMV rewrse ,r*n*cript**e were *dded *nd the mix,ure* incub*ted *, 42oC for 90 nl,““WS. After phenol ex,r.actmn *nd etb*nol precipit*tion, the re*ction produc,* were dige*,ed wi,h p*ncre*,tc rtbonucle**e A (7 pg) for 30

mmu,e* *, 370’2 *nd fr*ctlon*ted on * 6% po!y*cryl*mid*-SM Ure* gel. The sizes of ,he *x,ended produe,* were de,ermined by comp*ri*on ,o * dideoxy-sequencing l*dd*r.

To,*1 RNA (,O ~g) ,rom e*ch cell Iin* w** electrophoresed on * ,.5% Agarose-formaldehyde gel ,r*n*,erred to nt,rocellulo*e *nd probed wi,h r*dlol*be!l*d a-*c,in CDNA probe *ccording ,o nla”“‘act”rer’* recommendaions.

by guest on August 19, 2020

http://ww

w.jbc.org/

Dow

nloaded from

S Reddy, K Ozgur, M Lu, W Chang, S R Mohan, C C Kumar and H E Ruley5' upstream region.

Structure of the human smooth muscle alpha-actin gene. Analysis of a cDNA and

1990, 265:1683-1687.J. Biol. Chem. 

  http://www.jbc.org/content/265/3/1683Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/265/3/1683.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on August 19, 2020

http://ww

w.jbc.org/

Dow

nloaded from