stress levels of glucocorticoids inhibit lhβ-subunit gene … · 2015-09-17 · stress levels of...

12/5/2014 Stress Levels of Glucocorticoids Inhibit LHβ-Subunit Gene Expression in Gonadotrope Cells

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3458227/?report=printable 1/24

Mol Endocrinol. Oct 2012; 26(10): 1716–1731.

Published online Jul 31, 2012. doi: 10.1210/me.2011-1327

PMCID: PMC3458227

Stress Levels of Glucocorticoids Inhibit LHβ-Subunit Gene Expression in

Gonadotrope Cells

Kellie M. Breen, Varykina G. Thackray, Tracy Hsu, Rachel A. Mak-McCully, Djurdjica Coss, and Pamela L. Mellon

Department of Reproductive Medicine and Center for Reproductive Science and Medicine, University of California, San Diego, La Jolla,

California 92093-0674

Corresponding author.

Address all correspondence and requests for reprints to: Pamela L. Mellon Ph.D., Department of Reproductive Medicine/Neuroscience,

University of California, San Diego, 9500 Gilman Drive, La Jolla, California 92093-0674., E-mail: [email protected].

Received November 18, 2011; Accepted July 2, 2012.

Copyright © 2012 by The Endocrine Society

Abstract

Increased glucocorticoid secretion is a common response to stress and has been implicated as a

mediator of reproductive suppression upon the pituitary gland. We utilized complementary in vitro and

in vivo approaches in the mouse to investigate the role of glucocorticoids as a stress-induced

intermediate capable of gonadotrope suppression. Repeated daily restraint stress lengthened the

ovulatory cycle of female mice and acutely reduced GnRH-induced LH secretion and synthesis of LH β-

subunit (LHβ) mRNA, coincident with increased circulating glucocorticoids. Administration of a stress

level of glucocorticoid, in the absence of stress, blunted LH secretion in ovariectomized female mice,

demonstrating direct impairment of reproductive function by glucocorticoids. Supporting a pituitary

action, glucocorticoid receptor (GR) is expressed in mouse gonadotropes and treatment with

glucocorticoids reduces GnRH-induced LHβ expression in immortalized mouse gonadotrope cells.

Analyses revealed that glucocorticoid repression localizes to a region of the LHβ proximal promoter,

which contains early growth response factor 1 (Egr1) and steroidogenic factor 1 sites critical for GnRH

induction. GR is recruited to this promoter region in the presence of GnRH, but not by dexamethasone

alone, confirming the necessity of the GnRH response for GR repression. In lieu of GnRH, Egr1

induction is sufficient for glucocorticoid repression of LHβ expression, which occurs via GR acting in a

DNA- and dimerization-independent manner. Collectively, these results expose the gonadotrope as an

important neuroendocrine site impaired during stress, by revealing a molecular mechanism involving

Egr1 as a critical integrator of complex formation on the LHβ promoter during GnRH induction and

GR repression.

Stress profoundly disrupts reproductive function. Whether the nature of the stressor is physical (e.g.

foot-shock, exercise), immunological (e.g. infection, administration of cytokines or endotoxins), or

psychological (e.g. isolation, mental performance tasks), each has been shown to decrease circulating

levels of gonadotropins in mammals (1–5). Associated with this reproductive disturbance is an

activation of the hypothalamic-pituitary-adrenal axis and an elevation in circulating glucocorticoids

from the adrenal cortex, the final hormonal effectors of the hypothalamic-pituitary-adrenal axis.

Evidence that the glucocorticoid receptor (GR) antagonist, RU486, attenuates the inhibitory effect of

immobilization stress on LH secretion in male rats or psychosocial stress on pituitary responsiveness to

GnRH in ovariectomized ewes implies a physiological role for glucocorticoids in mediating the

http://dx.doi.org/10.1210%2Fme.2011-1327

http://www.ncbi.nlm.nih.gov/pubmed/?term=Breen%20KM%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Thackray%20VG%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hsu%20T%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mak-McCully%20RA%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Coss%20D%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mellon%20PL%5Bauth%5D

mailto:[email protected]

http://www.ncbi.nlm.nih.gov/pmc/about/copyright.html



inhibitory effects of stress on LH secretion, although RU486 can also block the effects of progesterone

(6–8).

Although there is little doubt that glucocorticoids suppress gonadotropin secretion, the neuroendocrine

mechanism underlying this effect is not well understood. Inhibition at the hypothalamic level is

supported by evidence that glucocorticoids reduce the frequency of LH pulses in ovary-intact female

sheep, ovariectomized female rats, and women during the follicular phase of the ovulatory cycle (9–11).

Because LH pulse frequency is generally modulated by the GnRH neurosecretory system, these findings

suggest an action of glucocorticoids to suppress the frequency of GnRH pulses. A recent study in

follicular phase sheep provides the first definitive evidence that glucocorticoids inhibit GnRH pulses in

pituitary portal blood (12). GR is expressed within hypothalamic neurons implicated in GnRH

regulation (13), and such neurons provide a potential indirect target by which glucocorticoids may

inhibit GnRH secretion or GnRH synthesis (14); however, a direct action within the GnRH neuron

itself is supported by evidence that glucocorticoids blunt GnRH synthesis and release from immortalized

GnRH neurons, GT1–7 cells (15, 16). Thus, the mechanism whereby glucocorticoids suppress GnRH

and LH remains unclear and may involve direct actions upon the GnRH neuron itself, indirect actions

via another neuronal cell type, or actions upon an extrahypothalamic site.

With regard to a site outside of the central nervous system, the most obvious possibility is that

glucocorticoids act via GR located within gonadotrope cells of the anterior pituitary gland. Evidence

that glucocorticoids reduce the amplitude of the LH response to a GnRH challenge in rodents, pigs,

cows, and women is consistent with this possibility (17–20). Further, suppression of responsiveness to

GnRH in vitro has been observed in rodent, porcine, and bovine pituitary cell cultures, indicating that

glucocorticoids can act directly upon the gonadotrope cell to inhibit responsiveness to GnRH (19–21).

Consistent with an action upon the gonadotrope cell, GR has been identified in rat gonadotropes (22),

and studies in rat and pig primary cells suggest that glucocorticoids inhibit signaling mechanisms

downstream of the GnRH receptor, including protein kinase C and cAMP (20, 23). It is not known,

however, whether these nongenomic actions of glucocorticoids that inhibit intracellular signaling

pathways ultimately lead to a reduction in LH release. Alternatively, evidence suggests that

glucocorticoids can act genomically to suppress gonadotrope responsiveness by regulating transcription

and translation of the GnRH receptor gene (24, 25).

Another potential mechanism whereby glucocorticoids could diminish GnRH responsiveness of the

gonadotrope is via regulation of gonadotropin synthesis. At the molecular level, LH and FSH are

glycoprotein hormones that exist as heterodimers, consisting of a common and abundantly expressed

glycoprotein hormone alpha-subunit (αGSU) complexed with a unique β-subunit that confers biological

specificity (26). Synthesis of the β-subunit gene of each hormone is the rate-limiting step in the overall

production of LH and FSH (26, 27). Because expression of each β-subunit is tightly controlled by

endocrine, paracrine, and autocrine actions, including hypothalamic GnRH, the activin-inhibin-

follistatin system, and steroid hormones of gonadal origin (27, 28), it is possible that GR regulation of

transcriptional activity underlies the inhibitory effects of stress on the gonadotrope.

Transcriptional effects of steroid hormones within the gonadotrope have been shown for the

gonadotropin genes, including Cga, Fshb, and Lhb (29, 30). With regard to Lhb, androgen repression of

Lhb involves protein-protein interactions between the androgen receptor and steroidogenic factor 1

(SF1) and is localized to a bipartite SF1 element within the LHβ proximal promoter, critical for

mediating GnRH responsiveness (31, 32). Progesterone repression also involves indirect receptor binding

but differs from androgen repression of LHβ gene expression in that, rather than SF1 elements,

progesterone repression involves two novel promoter regions located upstream of the SF1 sites. Similar

to progestins and androgens, glucocorticoids have been shown to inhibit LHβ gene expression (29, 33),

although the mechanism is unclear, raising the possibility that stress impairs fertility by way of

disruption of gene expression within the gonadotrope cell.



We initiated two lines of investigation in the mouse to tease apart the mechanisms whereby elevated

glucocorticoids inhibit gonadotrope responsiveness during episodes of stress. First, we tested the

hypothesis that restraint stress, and/or an elevation in glucocorticoids mimicking the level induced by

restraint stress, can disrupt reproductive function and inhibit gonadotrope production of LH in female

mice. Second, we conducted a series of studies to examine the molecular mechanisms underlying

glucocorticoid regulation of the LHβ promoter utilizing the immortalized LβT2 gonadotrope cell line.

Materials and Methods

Animals

Female C57Bl/6 mice (6 wk of age) were purchased from The Jackson Laboratory (Bar Harbor, ME),

and housed in a UCSD vivarium animal facility under standard conditions. All animals were housed

under a 12-h light, 12-h dark cycle (lights on at 0700 h) and provided with food and water ad libitum.

Mice were group housed (four females per cage) for 2 wk of acclimatization. All experimentation was

performed between 0900 and 1300 h in a room within the vivarium. Care was taken to minimize pain

and discomfort for the animals. Mouse colonies were maintained in agreement with protocols approved

by the Institutional Animal Care and Use Committee at the University of California, San Diego. All

procedures were approved by the University of California, San Diego IACUC.

Determination of phase of estrous cycle

At 8 wk of age, vaginal lavage was performed daily (at 0900 h) by flushing the vagina with distilled

H O. Collected smears were mounted on glass slides and examined microscopically for cell type (34).

The smears were classified into one of three phases of estrus: diestrus, proestrus, or estrus. Female mice

exhibiting two consecutive 4- to 6-d estrous cycles, including positive classification of diestrus, proestrus,

and estrus, were used in animal experiments. Estrous cycle length was calculated as the length of time

between two successive occurrences of estrus. The time spent in each cycle stage was calculated as the

proportion of time classified in each cycle phase during the observation period, and values were

analyzed by two-way repeated measures ANOVA, group (no stress vs. stress) × time (d 1–d 18 vs. d 19–

d 36). All statistics were performed using JMP 7.0 (SAS Institute, Cary, NC), and significance was

established as P < 0.05.

Restraint stress protocol

After vaginal lavage and estrus classification, mice were either returned to their group home cage (no

stress) or placed individually into clear plastic restraint tubes (stress). The ventilated tubes (Harvard

Apparatus, Holliston, MA) are designed to be small enough to restrain a mouse so that it is able to

breathe but unable to move freely. The restraint devices were cleaned between uses with soap, water,

and ethanol (70%). Mice are continually observed by experienced personnel during the 180-min

restraint period. After the restraint period, stress mice are returned to individual home cages or killed by

decapitation, and trunk blood or pituitary tissue was collected from individual animals. Hormone values

were analyzed by one-way ANOVA followed by Tukey's post hoc test or two-way ANOVA, group (no

stress vs. stress) × time (vehicle vs. GnRH).

Corticosterone response protocol

Female mice (8 wk of age) were ovariectomized and allowed to recover for 2 wk before

experimentation. To test the LH response to a stress level of corticosterone, animals received a bolus

injection of corticosterone (200 ng/kg, sc) or vehicle. After 90 min, animals were killed by decapitation,

and trunk blood was collected from individual animals. Hormone values were analyzed by one-way

ANOVA followed by Tukey's post hoc test.

Hormone analysis

2



Trunk blood was collected and serum separated by centrifugation and stored frozen at −20 C before

analysis at the Center for Research in Reproduction Ligand Assay and Analysis Core at the University of

Virginia (Charlottesville, VA). Corticosterone concentrations were determined by RIA in single 25- to

50-μl aliquots of serum. Assay sensitivity averaged 20.0 ng/ml. LH concentrations were determined by

two-site sandwich immunoassay in duplicate 50-μl aliquots of serum. Assay sensitivity averaged 0.07

ng/ml.

Plasmids

The −1800 rat LHβ-luc in pGL3 was kindly provided by Dr. Mark Lawson. The 5′-truncations of the

−1800-bp LHβ-luc reporter plasmid were created by inserting fragments between KpnI and HindIII in

pGL3 have been partially described by Thackray et al. (35): −400, −300, −200, −150, −87. The 5′- and

3′-mutations of either Egr1 or SF1 binding sites in the −200 rat LHβ-luc have been reported previously

(35). The reporter plasmids with the multimerized consensus SF1 site (TGACCTTGA) or consensus Egr1

site (CGCCCCCGC) were created by ligating an oligonucleotide, containing four copies of the indicated

site, between KpnI and NheI in pGL3, upstream of the 81-bp thymidine kinase (TK) promoter. The

sequences of all promoter fragments were confirmed by dideoxynucleotide sequencing.

The mouse Ptx1 pcDNA3 expression vector has been previously described (36). The rat Egr1 and mouse

SF1 cDNA were kindly provided by Dr. Jacques Drouin and Dr. Bon-chu Chung, respectively. The cDNA

were cloned into the pCMV expression vector using the ClaI/XbaI restriction sites of both plasmids. The

human Egr1 cDNA was provided by Dr. Hermann Pavenstadt and was cut using XhoI/EcoRI and

inserted into pGEX-5X expression vector using the SmaI restriction site by blunt end cloning. Dr.

Douglass Forbes provided the green fluorescent protein (GFP) expression plasmid. The wild-type rat GR

pSG5 plasmid was provided by Dr. Keith Yamamoto. Both GR mutants are in pSG5 and have been

previously described; the GRdim4 mutant contains four point mutations that prevent dimerization and

DNA binding of the receptor (29), and the GR DNA-binding domain (DBD) mutant contains a

mutation in the DNA-binding domain (33).

Cell culture and transient transfection

LβT2 cells, cultured as previously described (29), were seeded into 12-well plates at 3 × 10 cells per well

and incubated overnight at 37 C. Each well was transfected with 400 ng of the luciferase-reporter

plasmid or control pGL3 vector and 100 ng of a β-galactosidase reporter gene regulated by the TK

promoter (TK-βgal) as a control for transfection efficiency using FuGENE 6 transfection reagent

(Roche Applied Science, Indianapolis, IN). In experiments utilizing Egr1, SF1, or Ptx1 to induce

promoter activity, cells were also transfected with 100 ng Egr1 (unless indicated otherwise) or empty

pCMV vector, 100 ng SF1 or empty pCMV vector, 50 ng Ptx1 or empty pcDNA3 vector. Eighteen hours

after transfection, cells were transferred to serum-free DMEM (supplemented with 0.1% BSA, 5 mg/liter

transferrin, and 50 nM sodium selenite) containing either the natural glucocorticoid, corticosterone (100

nM, Sigma Aldrich, St. Louis, MO), synthetic glucocorticoid, dexamethasone (100 nM, Sigma Aldrich), or

vehicle (0.1% ethanol). When cells were treated with GnRH (10 nM; Sigma Aldrich), treatment with

GnRH or vehicle (0.1% BSA) began 6 h before harvest. Cells were harvested and extracts were prepared

for assay of luciferase and β-galactosidase activity as previously described (33).

CV-1 cells, a monkey kidney cell line that does not express detectable endogenous GR (37), were seeded

into 12-well plates at 1.5 × 10 cells per well as previously described (38) and treated as indicated above

with the following addition. Each well was transfected with 50 ng of the GR expression vector (wild

type or mutant) or empty pGS5 vector.

Luciferase reporter experiments were performed in triplicate and were repeated at least three times. To

normalize for transfection efficiency, all luciferase values were divided by β-galactosidase, and the

triplicate values were averaged. To control for interexperimental variation, the control pGL3 reporter

5

5



plasmid was transfected with TK-βgal and any relevant expression vectors, and the average pGL3/βgal

value was calculated. Average luc/βgal values were divided by the corresponding pGL3/βgal value.

Individual values obtained from each independent experiment were averaged and analyzed by Student's

t test or one-way ANOVA followed by Tukey's post hoc test.

Quantitative real-time PCR

Preparation of cDNA from mouse pituitary or LβT2 cells was performed as previously described (39).

Briefly, RNA was extracted with Trizol reagent (Invitrogen/GIBCO, Carlsbad, CA) according to the

manufacturer's instructions, treated to remove contaminating DNA (DNA-free; Ambion, Austin, TX),

and reverse transcribed using Superscript III First-Strand Synthesis System (Invitrogen). Quantitative

real-time PCR was performed in an iQ5 Real-Time PCR instrument (Bio-Rad Laboratories, Inc.,

Hercules, CA) and used iQ SYBR Green Supermix (Bio-Rad Laboratories) with specific primers for

glyceraldehyde-3-phosphate dehydrogenase (GAPDH), LHβ, or Egr1 cDNA.

LHβ forward: CTGTCAACGCAACTCTGG

LHβ reverse: ACAGGAGGCAAAGCAGC

Egr1 forward: ATTTTTCCTGAGCCCCAAAGC

Egr1 reverse: ATGGGAACCTGGAAACCACC

GAPDH forward: TGCACCACCAACTGCTTAG

GAPDH reverse: GGATGCAGGGATGATGGTTC

The iQ5 real-time PCR program was as follows: 95 C for 15 min, followed by 40 cycles at 95 C for 15

sec, 55 C for 30 sec, and 72 C for 30 sec. Within each experiment, the amount of LHβ or Egr1 and

GAPDH mRNA was calculated by comparing a threshold cycle obtained for each sample with the

standard curve generated from serial dilutions of a plasmid containing GAPDH, ranging from 1 ng to 1

fg. All samples were assayed (in triplicate) within the same run, and the experiment was conducted

three times. Values were analyzed by one-way ANOVA followed by Tukey's post hoc test or two-way

ANOVA, group (no stress vs. stress) × time (vehicle vs. GnRH).

Dual immunofluorescence

Adult mouse pituitary paraffin tissue sections (Zyagen, San Diego, CA) were dewaxed in xylene,

rehydrated through a series of graded ethanol baths, and washed in H 0. Sections were immersed in 10

mM sodium citrate buffer (pH 6.0), heated in a standard microwave twice for 5 min, and allowed to

stand for 20 min at room temperature. After a brief wash in PBS, nonspecific binding was blocked with

5% goat serum/0.3% Triton X-100 for 60 min at room temperature. Dual fluorescence labeling was

tested on the same section with a guinea pig antirat LHβ primary antibody (anti-rβ LH-IC-2, NIDDK

NHPP; 1:200 dilution in 5% goat serum/0.3% Triton X-100) plus a rabbit antimouse GR primary

antibody (sc-1004, Santa Cruz Biotechnology, Inc., Santa Cruz, CA; 1:500 dilution) for 48 h at 4 C.

LHβ- and GR-containing cells were revealed using a goat rhodamine antiguinea pig IgG secondary

antibody (ab6905, 1:300 dilution; Abcam, Cambridge, MA) plus a goat fluorescein antirabbit IgG

secondary antibody (FI-1000; Vector Laboratories, Burlingame, CA; 1:300 dilution) for 60 min at room

temperature. After rinsing with PBS, sections were coverslipped with Vectashield HardSet mounting

medium with 4′,6-diamidino-2-phenylindole (Vector Laboratories). Exclusion of each primary antibody

was run as a negative control, and each antibody was run separately to confirm that each

immunostaining pattern was similar to published reports (40, 41). Specificity of the GR antibody was

confirmed by immunoblot analysis of LβT2 and CV-1 cell lysates, cell lines previously shown to contain

and lack GR (29, 37), respectively, which detected a single band of the expected size.

Sections were viewed using an inverted fluorescence microscope (Nikon Eclipse TE 2000-U; Nikon,

2



Tokyo, Japan), and digital images were collected using a Sony CoolSNAP EZ cooled charge-coupled

device camera (Roper Scientific, Trenton, NJ) and analyzed with Nikon Imaging System—Elements

image analysis system (version 2.3; Nikon).

Western blot analysis

Nuclear extracts were prepared as previously described (36) from LβT2 cells treated with

dexamethasone (100 nM, 18 h), GnRH (10 nM, 45 min), GnRH + dexamethasone or vehicle (0.1%

BSA/0.1% ethanol). Nuclear extract (20 μg) was boiled for 5 min in 5× Western-loading buffer,

fractionated on a 10% SDS-PAGE gel, and electroblotted for 90 min at 300 mA onto polyvinylidene

difluoride (Millipore Corp., Billerica, MA) in 1× Tris-glycine-sodium dodecyl sulfate/20% methanol.

Blots were blocked overnight at 4 C in 3% BSA and then probed for 1 h at room temperature with rabbit

antihuman Egr1 antibody (sc-110, Santa Cruz Biotechnology) diluted 1:750 in blocking buffer. Blots

were then incubated with a horseradish peroxidase-linked secondary antibody (Santa Cruz

Biotechnology), and bands were visualized using the SuperSignal West Pico chemiluminescent substrate

(Pierce Biotechnology, Inc., Rockford, IL). Bio-Rad Pre-stained Protein Ladder Plus serves as a size

marker.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed as previously described (29, 35). Briefly, confluent LβT2 cells in 10-cm

plates were treated with dexamethasone (100 nM, 1 h), GnRH (10 nM, 1 h), GnRH + dexamethasone

(cotreatment 1 h), or vehicle (0.1% BSA/0.1% ethanol) and cross-linked with 1% formaldehyde. The

nuclear fraction was obtained, and chromatin was sonicated to an average length of 300–500 bp using

a Branson Sonifier 250 (Branson Ultrasonics Corp., Danbury, CT). Protein-DNA complexes were

incubated overnight with nonspecific rabbit IgG (sc-2027, Santa Cruz Biotechnology) or rabbit

antihuman GR (ab3579, Abcam) and precipitated with protein A/G beads. Immunoprecipitated DNA

and DNA from input chromatin were analyzed by quantitative PCR using primers specific for a 220-bp

sequence of the mouse LHβ proximal promoter (−180 LHβ/+40 LHβ). Primers specific to the mouse

FSHβ promoter (−223 FSHβ/+57 FSHβ) and FSHβ coding region were used as positive and negative

controls, respectively. DNA from immunoprecipitated samples was quantified relative to a standard

curve representing percent of input chromatin. For ChIP assays comparing chromatin from hormone-

treated LβT2 cells, the fold enrichment of antibody signal over IgG was calculated for each primer set,

and data from each independent experiment were normalized to the indicated negative control gene.

ChIP and input samples were quantified using a standard curve made from ChIP input DNA. ChIP

samples were normalized to their appropriate input samples and are expressed as fold enhancement

over nonspecific IgG.

−180 LHβ-forward: CGAGTGTGAGGCCAATTCACTGG

+40 LHβ-reverse: GGCCCTACCCATCTTACCTGGAGC

−223 FSHβ-forward: GGTGTGCTGCCATATCAGATTCGG

+57 FSHβ-reverse: GCATCAAGTGCTGCTACTCACCTGTG

FSHβ-coding forward: GCCGTTTCTGCATAAGC

FSHβ-coding reverse: CAATCTTACGGTCTCGTATACC

The iQ5 real-time PCR program was as follows: 95 C for 15 min, followed by 40 cycles at 95 C for 15

sec, 55 C for 30 sec, and 72 C for 30 sec. All samples were assayed within the same run, and the

experiment was conducted three times. Individual values obtained from each independent experiment

were averaged and analyzed by one-way ANOVA followed by Tukey's post hoc test.



Glutathione-S-transferase (GST) interaction assay

S-labeled proteins were produced using the TnT Coupled Reticulolysate System (Promega Corp.,

Madison, WI). Bacteria transformed with the GST plasmids were grown to an OD of 0.6 and then

induced with isopropyl-β-d-thiogalactoside overnight at 30 C. The bacterial pellets were sonicated in

0.1% Triton X-100 and 5 mm EDTA in 1× PBS and centrifuged, and the supernatant was bound to

glutathione Sepharose 4B resin (Amersham Pharmacia Biotech, Piscataway, NJ). The beads were

washed four times in PBS and then in HEPES/Nonidet P-40/dithiothreitol (HND) buffer [10 mg/ml

BSA, 20 mm HEPES (pH 7.8), 50 mm NaCl, 5 mm dithiothreitol, and 0.1% Nonidet P-40]. For the

interaction assay, S-labeled in vitro-transcribed and -translated GR (20 μl), SF1 (5 μl), or GFP (5 μl)

was added to the beads with 400 μl HND buffer. The beads were incubated for 1 h at 4 C and then

washed twice with HND buffer and twice with 0.1% Nonidet P-40 in PBS. Thirty microliters of 2×

Laemmli load buffer were added, and the samples were boiled and then electrophoresed on a 10%

sodium dodecyl sulfate-polyacrylamide gel. One tenth of the S-labeled in vitro-transcribed and -

translated product was loaded onto the gel as input. The gel was dried, and the proteins were visualized

by autoradiography.

Results

Chronic restraint stress compromises estrous cyclicity

To evaluate the mechanism whereby elevated glucocorticoids impair reproduction, we developed a

model to assess whether daily restraint stress disrupts estrous cyclicity. Vaginal cytology was examined

daily by vaginal lavage in a cohort of female mice during an 18-d control period (d 1–d 18). After this

period of observation, mice were randomly assigned to either the stress or no stress group (n =

9/group), and estrous cyclicity was monitored for an additional 18 d (d 19–d 36). Figure 1A illustrates

profiles of vaginal histological classification during the prestress and stress period of three female mice

exposed to 180 min of daily restraint stress. In mice not subjected to stress, cycle length was not

significantly different between the two periods of assessment (P > 0.05; d 1–d 18 vs. d 19–d 36, 5.33 ±

0.31 vs. 4.81 ± 0.45 d, Fig. 1B). In contrast, stressed mice exhibited a significant increase in average

cycle length in the stress period compared with the prestress period (P < 0.05; d 1–d 18 vs. d 19–d 36,

5.25 ± 0.35 vs. 6.75 ± 0.55 d). Specifically, exposure to daily restraint stress significantly increased the

time spent in diestrus during the stress period, d 19–d 36, without altering the time spent in estrus or

proestrus as compared with the prestress period, d 1–d 18 (P > 0.05; Fig. 1C).

Acute restraint stress disrupts gonadotrope function

Having found that repeated exposure to stress compromises reproductive neuroendocrine activity as

evidenced by a disruption in estrous cyclicity in female mice, the next step was to focus on the role of

the pituitary gland and test whether gonadotrope responsiveness, as assessed by GnRH-induced LH

synthesis or secretion, is diminished by acute restraint stress. Separate cohorts of female mice, in which

estrus cyclicity was confirmed and diestrus females selected, were used to assess gonadotrope

responsiveness to GnRH in the absence or presence of stress. In the first study, GnRH-induced LH

secretion was monitored in groups of control mice (no stress) or mice exposed to 180 min of restraint

stress (Fig. 2A). Blood was collected before stress, as well as 30 and 180 min after the initiation of the

control or stress period for measurement of corticosterone (n = 7 per time point per group). To assess

LH release in response to GnRH, female diestrus mice were administered GnRH (200 ng/kg, sc; n = 7

per group per treatment) or saline vehicle and killed 10 min after injection. Blood was collected and

processed for measurement of LH at 180 min after the initiation of stress. This GnRH dose was selected

because it has been shown to produce a significant, yet submaximal, LH response, that peaks 10 min

after administration in a mouse model of diestrus in which female mice are ovariectomized and

estrogen primed (42, 43). Serum levels of corticosterone remained low in no stress control animals (

Fig. 2B, open circles); corticosterone levels were significantly increased in stressed mice at 30 min (P <

35

35

35

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3458227/figure/F1/







0.05; stress vs. no stress, 588.6 ± 26.4 vs. 108.8 ± 35.5 ng/ml) and remained significantly elevated 180

min after initiation of restraint (Fig. 2B, gray circles). Stress did not significantly induce serum levels of

progesterone at either 30 min or 180 min after the initiation of restraint (data not shown). Mean LH in

the no stress diestrus females receiving vehicle was not significantly different from values in the vehicle-

treated stress animals, indicating that stress does not significantly impair responsiveness to endogenous

GnRH in this animal model (P > 0.05; stress Veh vs. no stress Veh, Fig. 2C). In the no stress group,

exogenous GnRH caused a robust increase in circulating LH levels as compared with vehicle-treated

animals (P < 0.05; 1.83 ± 0.23 vs. 0.56 ± 0.11 ng/ml, Fig. 2C). GnRH also significantly increased LH in

stressed animals (P < 0.05, Fig. 2C). However, the LH response to exogenous GnRH was significantly

blunted in restraint-stressed animals compared with the response in no stress controls (P < 0.05; stress

GnRH vs. no stress GnRH, 1.19 ± 0.18 vs. 1.83 ± 0.23 ng/ml; Fig. 2C), suggesting that stress diminishes

the ability of the pituitary to respond to GnRH. Taken together, these experiments reveal an interplay

between GnRH and stress and implicate responsiveness of the pituitary gonadotrope as a potential

neuroendocrine site of LH suppression.

We further investigated the response of the gonadotrope by analyzing GnRH-induced LHβ mRNA

transcript level in mice exposed to restraint stress. Initially, diestrus female mice received saline vehicle

or GnRH (200 ng/kg, sc; n = 7 per group per treatment) and were subsequently sorted into no stress or

stress treatment groups (Fig. 2D). Animals were killed and the pituitary glands were collected for mRNA

analysis by quantitative RT-PCR. Stress did not alter basal LHβ transcript levels compared with

expression in no stress vehicle controls (P < 0.05; stress Veh vs. no stress Veh; Fig. 2E). In the absence

of stress, exogenous GnRH resulted in a 4-fold increase in LHβ mRNA compared with values in vehicle-

treated animals (P < 0.05; Fig. 2E). In stressed mice, the LHβ transcript level in response to GnRH was

significantly reduced by approximately 45% (P < 0.05; no stress GnRH vs. stress GnRH, 16.5 ± 2.3 vs.

8.9 ± 1.1; Fig. 2E). Collectively, these observations raise the possibility that stress can interfere with

ovarian cyclicity by disrupting the synthesis and secretion of LH at the level of the anterior pituitary

gonadotrope cell.

Glucocorticoids impair LH secretion in vivo potentially via receptors expressed in mousegonadotrope cells

Our studies thus far demonstrate that circulating glucocorticoids are increased within 30 min and

remain significantly elevated for the 180-min stress paradigm (Fig. 2). Because stress likely induces a

host of inhibitory intermediates, any of which could alter reproductive activity, we directly assessed the

role of glucocorticoids by testing the hypothesis that a stress-like level of glucocorticoid in female mice

reduces LH secretion. Pilot studies were conducted to identify a dose of glucocorticoid that approximated

a stress level (∼750 ng/ml) and an animal model that eliminated confounding effects of ovarian

steroids. Blood was collected 90 min after a bolus administration of vehicle or corticosterone (200

ng/kg, sc; n = 6 per treatment) to ovariectomized female mice (Fig. 3A). Corticosterone remained low

in mice treated with vehicle, yet values were markedly elevated after administration of corticosterone (P

< 0.05; Fig. 3B). Treatment with corticosterone significantly reduced mean LH as compared with the

value in mice treated with vehicle (P < 0.05; Cort vs. Veh, 3.4 ± 0.3 vs. 1.9 ± 0.6 ng/ml, Fig. 3C),

demonstrating sufficiency of glucocorticoids to disrupt reproductive neuroendocrine function and

relevancy as an inhibitory factor induced during stress.

Evidence that GR is expressed in gonadotrope cells in the rat (22) supports our hypothesis of a direct

action of glucocorticoids via GR within mouse gonadotrope cells. To confirm the presence of this

receptor in mouse gonadotrope, we used dual-label immunofluorescence of adult mouse anterior

pituitary sections for LHβ and GR (rhodamine- and fluorescein isothiocyanate-conjugated secondary

antibodies, respectively; Fig. 3, D–F). LHβ immunostaining identified gonadotropes that accounted for a

small proportion of labeled anterior pituitary cells (Fig. 3D), whereas GR immunostaining occurred in

an extensive population of pituitary cells (Fig. 3E). Of interest, numerous LHβ-containing gonadotropes



















showed GR staining, confirming the presence of GR in this anterior pituitary cell type in the mouse

(merge, white stars, Fig. 3F).

Glucocorticoids regulate LHβ gene expression in gonadotrope cells

Having confirmed the presence of GR in adult mouse pituitary gland, we next tested the hypothesis that

the stress-induced decrease in LHβ mRNA expression could be recapitulated in cultured gonadotrope

cells. As expected, immortalized pituitary gonadotrope cells, LβT2, responded to GnRH with a 2-fold

increase in endogenous LHβ mRNA as measured by quantitative RT-PCR (Fig. 4A). Treatment of LβT2

cells with a physiological, stress level of corticosterone decreased GnRH-induced LHβ mRNA expression

(P < 0.05; GnRH vs. GnRH + Cort, 2.1 ± 0.3 vs. 1.6 ± 0.1; Fig. 4A); however, corticosterone alone did

not reduce LHβ expression. These findings indicate that repression by glucocorticoids occurs in the

presence of GnRH and confirm the LβT2 gonadotrope cell is an appropriate model for investigating the

role of glucocorticoid-induced suppression of LHβ gene expression.

We began to dissect out the mechanism whereby glucocorticoids reduce LHβ-subunit induction in LβT2

cells, by investigating the regulation of an LHβ-luciferase reporter after incubation with either natural

or synthetic glucocorticoids. For this purpose, LβT2 cells were transiently transfected with −1800 bp of

the rat LHβ regulatory region fused upstream of a luciferase reporter gene (LHβ-luc) or pGL3 control

plasmid and treated with corticosterone (100 nM), dexamethasone (100 nM), or vehicle (0.1% ethanol)

for 24 h before harvest. Neither the natural glucocorticoid, corticosterone, nor the synthetic

glucocorticoid, dexamethasone, significantly altered basal expression of the −1800-bp LHβ promoter (P

> 0.05; Veh vs. Cort or Dex; Fig. 4B). In contrast, both glucocorticoids significantly blunted the robust

increase in promoter activity induced by GnRH (10 nM, final 6 h of glucocorticoid treatment; P < 0.05;

Fig. 4B). Specifically, GnRH resulted in a 4.6-fold induction of LHβ-luc, which was reduced 35% by

corticosterone, or 45% by dexamethasone. Although both glucocorticoids are capable of transcriptional

repression of GnRH induction of the LHβ promoter, we focused on the synthetic glucocorticoid,

dexamethasone, based on the intensity of its effect and evidence for its potent interaction with the

endogenous steroid receptor, GR, expressed in LβT2 cells (29) and identified in mouse gonadotrope cells

(Fig. 3).

Using a promoter truncation approach, we identified regions of the LHβ gene that are functionally

involved in glucocorticoid regulation. LβT2 cells were transiently transfected with a series of truncated

LHβ reporter plasmids, ranging in length from −1800 to −87 bp of the 5′-regulatory sequence. Figure 4

C illustrates the effect of treatment with GnRH in the presence or absence of dexamethasone on

progressive 5′-LHβ promoter truncations. As observed previously, GnRH induction of the LHβ gene

declined incrementally as the promoter was progressively truncated from −1800 to −87 (Fig. 4C and

Ref. 44). Dexamethasone repressed LHβ promoter activity by approximately 40% when the region

contained at least −150 bp of the proximal promoter. Interestingly, further truncation of the region

from −150 to −87, which removed the proximal GnRH responsive elements [such as early growth

response factor 1 (Egr1) and SF1], resulted in a loss of GnRH induction and elimination of

dexamethasone repression, indicating that GnRH responsiveness of the LHβ gene is required for

glucocorticoid repression. Collectively, these data suggest that GR exerts its inhibitory effects upon the

LHβ proximal promoter, likely via interactions with GnRH-responsive factors, such as Egr1 and SF1.

Proximal binding elements are important for glucocorticoid repression

The proximal 150 bp of the rat LHβ promoter contain multiple binding elements that are critically

important for GnRH regulation of LHβ transcription (Fig. 5A), including tandem elements for both

Egr1 and SF1 that are arranged on either side of a homeobox element, previously shown to bind

pituitary homeobox factor 1 (Ptx1). Ptx1 is expressed throughout pituitary development and plays a

critical role in activation of a number pituitary genes, including Lhb (45). SF1 is specifically expressed in

the gonadotrope of the anterior pituitary gland, and its importance for reproduction is underscored by a












lack of gonads in SF1-null mice (46). Although highly important for LHβ transcription, SF1 and Ptx1

are not regarded as factors induced or regulated by GnRH (47). On the other hand, Egr1 is rapidly

induced by GnRH and considered a critical regulator of LHβ gene expression (47), because Egr1 null

mice lack LHβ expression in the pituitary gonadotropes (48). Therefore, we focused on the role of Egr1

in glucocorticoid repression of LHβ gene expression and tested the hypothesis that glucocorticoids

interfere with GnRH induction of LHβ by blunting the GnRH-stimulated increase in Egr1 mRNA and

protein. To investigate hormone regulation of Egr1 mRNA, LβT2 cells were treated with hormone, and

after 45 min, RNA was harvested for Egr1 mRNA analysis by quantitative RT-PCR. Egr1 mRNA was

low in vehicle-treated control cells, and expression was unchanged by treatment with dexamethasone

alone (Fig. 5B). As expected, GnRH caused a dramatic 27.2-fold induction in Egr1 mRNA (P < 0.05 vs.

Veh). This increase in GnRH-induced Egr1 transcript, however, was not significantly decreased by

dexamethasone (P > 0.05; GnRH vs. GnRH + Dex, 27.2± 4.6 vs. 23.1 ± 4.5; Fig. 5B). Because we

found that treatment with glucocorticoids does not suppress levels of GnRH-induced Egr1 transcript, we

next tested the hypothesis that dexamethasone regulates translation or degradation of Egr1 in LβT2 cells

using Western blot analysis. Protein expression of Egr1 was undetectable in nuclear extracts of LβT2

cells after treatment with vehicle or dexamethasone (Fig. 5C). After treatment with GnRH, Egr1 protein

was readily detected, yet protein expression did not significantly change after cotreatment with GnRH

and dexamethasone, indicating that GR does not interfere with GnRH induction of Egr1 protein.

We further examined how glucocorticoids might influence GnRH-induced LHβ expression by

performing ChIP assays on the endogenous mouse LHβ promoter in LβT2 cells. Cells were treated with

dexamethasone or GnRH alone or in combination for 60 min before cross-linking. Sonicated chromatin

was immunoprecipitated using either anti-GR or nonspecific IgG. Cross-linking was reversed and

precipitates analyzed by quantitative PCR for 220 bp of the LHβ promoter (−180 to +40).

Dexamethasone treatment alone did not increase GR binding to the proximal promoter over vehicle

treatment (P < 0.05; Veh vs. Dex; Fig. 5D). However, we can only rule out a change in GR occupancy

of the LHβ promoter at 60 min, and that later (or earlier) changes in the response to glucocorticoids are

still possible. In contrast, GnRH treatment increased GR binding 3.8-fold compared with vehicle (P <

0.05; Veh vs. GnRH), indicating that recruitment of GR to the LHβ promoter is not dependent on

dexamethasone binding, but rather is dependent on a GnRH-responsive factor. No difference in GR

binding was observed when the cells were concomitantly stimulated with dexamethasone and GnRH as

compared with GnRH alone, suggesting that a change in GR conformation or recruitment due to

ligand does not underlie the mechanism of glucocorticoid repression of LHβ transcription.

Glucocorticoids interfere with Egr1 actions at the level of the promoter

Having determined that GR recruitment is dependent on GnRH (i.e. a responsive factor such as Egr1),

yet the inhibitory effect of glucocorticoids is downstream of GnRH-induced Egr1 mRNA or protein, we

investigated the role of Egr1 at the level of the LHβ promoter. We began by testing the hypothesis that

glucocorticoids reduce activity of the LHβ promoter when induced by Egr1 itself, in the absence of

GnRH. Egr1 is a potent activator of LHβ transcription, and transfection of an Egr1 expression plasmid

in LβT2 cells treated with vehicle caused a robust 35-fold increase in LHβ activity (P < 0.05; Veh:

Empty Vec vs. Egr1; Fig. 6A). Treatment with dexamethasone significantly blunted the increase in LHβ

activity induced by Egr1 compared with the response in cells treated with vehicle (P < 0.05; Egr1 (black

bars): Dex vs. Veh; Fig. 6A), indicating that glucocorticoids can interfere with activation by Egr1 at the

level of the LHβ promoter in gonadotrope cells and that GR suppression does not require factors

involved in GnRH signaling upstream of Egr1.

We next attempted to rescue the glucocorticoid repression of GnRH-induced LHβ activity in LβT2 cells.

We hypothesized that if Egr1 were the sole factor affected by glucocorticoids, then titrating increasing

amounts of Egr1 into LβT2 cells would restore full induction and prevent diminishment by

glucocorticoids. LHβ-luc/βgal values are represented as fold induction of GnRH or GnRH + Dex relative









to the vehicle control condition containing the same amount of Egr1. In the absence of exogenous Egr1,

dexamethasone significantly blunted GnRH-induced LHβ activity (P < 0.05; empty vector: GnRH vs.

GnRH + Dex; Fig. 6B). In the presence of increasing amounts of overexpressed Egr1 (50–200 ng), the

percent repression significantly decreased (P < 0.05; empty vector vs. 100 or 200 ng Egr1; Fig. 6C),

indicating that repression occurs, in part, via interfering with Egr1 function on the promoter.

We focused our attention on the action of glucocorticoids at the level of the LHβ promoter and analyzed

the necessity of known GnRH-responsive elements within the proximal 150 bp of the LHβ gene for

glucocorticoid repression by creating cis mutations in the 5′-SF1, 3′-SF1, 5′-Egr1, and 3′-Egr1 binding

elements in the context of a minimal −200 bp LHβ promoter (WT). We used this minimal LHβ

promoter because it is sufficient for responsiveness to GnRH and glucocorticoids. cis mutation of either

the 5′- or 3′-SF1 or the 5′-Egr1 site preserved significant GnRH induction and was sufficient for

glucocorticoid repression, suggesting that these elements are not required for either GnRH induction or

GR repression (P < 0.05; *, significant induction by GnRH; #, significant repression of GnRH

induction; Fig. 6D). In contrast, the 3′-Egr1 cis mutation was the only mutation to abrogate

glucocorticoid repression (Fig. 6D, 3′-Egr1 mutation). Of interest to our study, this Egr1 binding site has

been shown to be critical for GnRH induction as well (49), and cis mutation of this element eliminated

significant induction by GnRH in our hands, implying that GnRH responsiveness is necessary for

repression by glucocorticoids.

Interaction and involvement of Lhb promoter proximal binding factors

Egr1 conveys GnRH induction of the LHβ promoter by interaction with other regulators of gene

expression in the gonadotrope (47, 49–51). To assess the complex and cooperative roles of Egr1, SF1,

and Ptx1, we used heterologous CV-1 cells. Unlike gonadotrope cells, CV-1 cells lack GnRH receptors, an

Egr1 response to GnRH, and are devoid of endogenous SF1, Ptx1, and GR, which allowed us to

reconstitute these factors and determine the necessity and sufficiency of proteins involved in suppression

by dexamethasone. In addition to GR, CV-1 cells were cotransfected with 1800-bp LHβ-luc reporter

plasmid or pGL3 control plasmid and Egr1, SF1, or Ptx1 alone, or in combination, and tested for

activation of LHβ transcription in the presence of dexamethasone or vehicle. As shown in Fig. 7A (white

bars), overexpression of Egr1, SF1, or Ptx1 alone induced small increases in LHβ transcription, with

induction by Egr1 reaching significance. Dexamethasone significantly diminished induction by Egr1 (P

< 0.05; Egr1: Dex vs. Veh). Interestingly, dexamethasone also significantly repressed LHβ induction

when Egr1 was cotransfected with SF1 alone or SF1 plus Ptx1 (P < 0.05; Egr1: Dex vs. Veh, Egr1/SF1:

Dex vs. Veh; Fig. 7A).

To address whether the Egr1-binding site is sufficient for glucocorticoid repression of LHβ transcription,

reporter constructs containing four copies of the Egr1 consensus site ligated into pGL3 upstream of a

minimal TK promoter were created (Egr1 multimer, Fig. 7B). CV-1 cells were cotransfected with the

Egr1 multimer or control TKluc pGL3 plasmid, GR, and either Egr1 alone, or Egr1 in combination with

SF1 and Ptx1, to test for sufficiency to activate transcription in the presence or absence of

dexamethasone. Egr1 was sufficient to induce transcriptional activation of the Egr1 multimer, and this

effect was blunted by glucocorticoids (P < 0.05; #, significant repression by Dex; Fig. 7B). Of interest,

this site was sufficient to allow for enhanced activation by the combination of Egr1, SF1, and Ptx1, an

affect that was also diminished by glucocorticoids. In contrast to the sufficiency of the Egr1 site, a

consensus SF1-binding site multimer does not convey responsiveness to dexamethasone when induced

by SF1 alone, but activation of the SF1 site by the combination of Egr1, SF1, and Ptx1 is disrupted by

dexamethasone. Taken together, these findings indicate that the Egr1 site activated by Egr1 alone is

sufficient for mediating repression. In contrast, the SF1 site activated by SF1 alone is not sufficient

although a complex with SF1, Egr1, and Ptx1 on the SF1 site can be repressed.

Role of the GR at the level of the Lhb promoter











Because CV-1 cells lack GR, this cell model allowed us to determine the necessity of DNA binding or

dimerization by GR for repression in gonadotrope cells. In the absence of transfected GR in CV-1 cells,

dexamethasone does not inhibit LHβ promoter activity (P > 0.05; no GR: Veh vs. Dex; Fig. 8A),

confirming that GR is necessary for repression of LHβ by glucocorticoids. To determine whether direct

DNA binding by GR plays a critical role in the repression of LHβ by glucocorticoids, we transfected CV-1

cells with two different GR mutants that are incapable of binding DNA. The first mutant, GR Dim mut,

contains four point mutations in the dimerization domain of GR. These mutations prevent

homodimerization of GR, but do not prevent indirect DNA binding through interactions with other

transcription factors (52, 53). The second GR mutant, GR DBD mut, prevents direct DNA binding by

the mutant. Dexamethasone elicited suppression in the presence of either transfected GR mutant,

indicating that GR dimerization and DNA binding are not necessary for repression of GnRH-induced

LHβ promoter activity (P < 0.05; Dim mut or DBD mut: Veh vs. Dex; Fig. 8A).

After demonstrating that GR does not require DNA binding to elicit repression upon the LHβ promoter,

we investigated the ability of GR to be tethered to DNA by a GnRH-induced factor, by testing the

hypothesis that GR is capable of binding Egr1. We asked whether in vitro-transcribed and -translated

GR could bind bacterially expressed GST-Egr1 in pull-down experiments. Figure 8B demonstrates

precipitation of S-labeled GR with GST-Egr1, as compared with GST alone, illustrating a physical

interaction between GR and Egr1. As a positive control, we show that S-labeled SF1 binds GST-Egr1,

a strong interaction that has been previously reported (54). In contrast, the interaction between S-

labeled GFP with either GST construct was undetectable. Together with the ChIP results in Fig. 5D,

these findings indicate that GR does not directly bind the LHβ promoter; rather it physically interacts

with Egr1 and thus is recruited to the LHβ promoter as a complex with Egr1, identifying Egr1 as a

critical factor mediating GnRH induction and GR repression of LHβ gene expression.

Discussion

Utilizing a restraint stress paradigm that robustly stimulates corticosterone to investigate stress-induced

suppression of gonadotrope function in female mice, we demonstrate that chronic exposure to stress

impairs estrous cyclicity and reduces GnRH-induced LH synthesis and secretion in diestrus female mice.

Whether the increase in glucocorticoids is induced by stress or exogenously administered, both

conditions lead to repression of gonadotrope function, confirming the inhibitory role of glucocorticoids

within the reproductive axis and demonstrating the capacity for suppression during stress. Although we

acknowledge that stress likely increases a variety of mediators, including other hormones of the adrenal

stress axis that have been shown to alter reproductive function during stress (2, 55, 56), we conclude,

based on our current investigation, that glucocorticoids are sufficient to disrupt reproductive

neuroendocrine function.

Seminal work by Dr. Neena Schwartz and colleagues (57) clearly identified inhibitory effects of

glucocorticoids within the reproductive neuroendocrine axis and postulated that glucocorticoids may

alter hypothalamic and pituitary function. Indeed, in vivo analyses demonstrated that glucocorticoids

could prevent the postcastration rise in LH in rats but also blunt the response to GnRH in anterior

pituitary fragments in culture (20, 57). Our present investigation expands upon these early studies by

demonstrating that glucocorticoids can act directly upon the anterior pituitary gonadotrope cell to

suppress GnRH induction of LHβ gene expression. Intriguingly, we observe a similar suppression in

LHβ gene expression after stress, but it remains to be determined whether this is a direct effect of

glucocorticoids within the pituitary gland. With regard to direct actions within the gonadotrope, we

demonstrate a novel mechanism whereby GR is recruited to the 5′-region of the mouse LHβ gene in

live LβT2 cells and blunts GnRH induction of LHβ by interfering with the genomic effects of Egr1 on the

proximal LHβ promoter.

Glucocorticoid repression via GR maps to a highly active region of the LHβ promoter, which contains

35

35

35







elements critical for GnRH induction. Promoter analyses revealed that glucocorticoid-mediated

repression is lost upon 5′-truncation of the bipartite SF1 and Egr1 elements in the LHβ proximal

promoter. Truncation of this region, however, also eliminated GnRH induction of the promoter (Fig. 4

C, −87 LHβ-luc), suggesting that the ability of glucocorticoids to repress is closely tied to the highly

coordinated and complex mechanism of GnRH action on Lhb. Not surprisingly, the only cis mutation

that relieved suppression by glucocorticoids (Fig. 6D, the 3′-Egr site) also prevented significant

induction of the LHβ promoter by GnRH, supporting the conclusion that glucocorticoid-induced

repression is dependent on the response to GnRH and highlights the importance of Egr1 for repression

by glucocorticoids.

Glucocorticoids have the potential to interfere with GnRH induction of LHβ via interference of GnRH

receptor signaling upstream and downstream of Egr1 induction. For example, studies performed using

rat and pig pituitary cell cultures suggest that chronic exposure to glucocorticoids can disrupt GnRH

receptor-signaling mechanisms involved in gonadotropin release, including activation of protein kinase

C and cAMP (20, 23). Further, GR has been shown to interact rapidly with c-Jun N-terminal kinase, a

kinase implicated in mediating effects of GnRH in gonadotrope cells (58). In contrast to these actions of

glucocorticoids on GnRH signaling, our findings support an action of glucocorticoids downstream of

Egr1 induction by GnRH via GR acting within the LHβ chromatin. Glucocorticoids do not alter GnRH-

induced Egr1 mRNA or protein in LβT2 cells, demonstrating that the pathway between GnRH binding

its receptor and induction of the immediate early gene, Egr1, is intact. Furthermore, glucocorticoids

blunt the ability of overexpressed Egr1 to induce LHβ activity, providing evidence that GR inhibition

does not require elements upstream of Egr1 and focus our attention on a mechanism involving Egr1 at

the promoter level. We show that titrating in increasing amounts of Egr1 partially overcomes

glucocorticoid repression of Lhβ in LβT2 cells, solidifying a mediatory role of Egr1.

With regard to the mechanism of repression, similar to other steroid hormone receptors, GR mediates

transcriptional regulation of target genes via a host of direct and indirect mechanisms. For example,

within the gonadotrope cell, induction of either the murine FSHβ or human αGSU gene occurs via

direct GR binding to DNA at conserved glucocorticoid response elements (29, 30). In contrast, using cell

models either devoid of or expressing GR (CV-1 vs. LβT2 cells, respectively), we find that neither an

intact DBD nor dimerization domain is necessary for GR repression of the rat LHβ gene, implicating a

genomic action that occurs via indirect GR binding. In addition, GR is recruited to the LHβ promoter

chromatin by GnRH induction in the presence or absence of glucocorticoids. Coupled with our findings

that GR physically interacts with Egr1 in GST-pulldown experiments, this provides evidence in support

of our hypothesis that GR is tethered to the LHβ promoter via a GnRH-induced factor, and in particular

by Egr1.

The requirement for a GnRH-induced factor may also contribute to the differential effect of

glucocorticoids on transcription within the gonadotrope cell. On the one hand, genes encoding FSHβ,

αGSU, and GnRH receptor are each induced by glucocorticoids alone (30, 33, 59). On the other hand,

our data reveal that GR repression requires GnRH, likely due to the deficiency of GR recruitment to the

proximal promoter in the absence of GnRH. On the GnRH receptor gene in gonadotrope cells, GnRH-

induced GR recruitment has been shown to be involved in glucocorticoid induction of transcription

(59). In that case, however, the recruitment of GR to the GnRH receptor promoter is dependent on

rapid phosphorylation of GR by GnRH-signaling pathways, which differs from our finding that GR

repression of LHβ transcription does not require GnRH signaling upstream of Egr1 activation. Rather,

we conclude that GR is recruited by a factor induced by GnRH and hypothesize that Egr1 itself

mediates the balance between GnRH induction and GR repression of the LHβ promoter.

In summary, the present study shows that restraint stress potently activates the adrenal stress axis in

mice and interferes with gonadotropin synthesis and secretion. We expand upon this finding by

demonstrating that administration of a stress level of glucocorticoids inhibits LH secretion in female





mice and detailing a mechanism whereby glucocorticoids repress activity of the anterior pituitary gland

via regulation of LHβ gene expression in gonadotrope cells. We identify GR in native gonadotrope cells

in the mouse and demonstrate that the recruitment of GR to the mouse LHβ promoter via Egr1

interferes with the tripartite transcriptional complex necessary for mediating responsiveness of this

gonadotropin gene to GnRH. Utilizing dual in vivo and in vitro approaches, collectively, this work

reveals new insights regarding the interaction between the adrenal stress and reproductive

neuroendocrine axes by identifying a mechanism whereby LHβ expression is dampened after a stress

elevation in glucocorticoid.

Acknowledgments

We thank Dr. Alexander (Sasha) Kauffman (University of California, San Diego, La Jolla, CA) and Dr.

Catherine Rivier (Salk Institute, La Jolla, CA) for insightful discussions regarding the in vivo

experiments. We are grateful to Dr. Jacques Drouin (University of Montreal, Quebec, Canada) for

generously providing the mouse Ptx1 and rat Egr1 cDNAs; to Dr. Hermann Pavenstadt (University of

Munster, Munster, Germany) for providing the human Egr1 cDNA; and to Dr. Douglass Forbes

(University of California, San Diego, La Jolla, CA) for providing the GFP expression plasmid. The

mouse SF1 pCMV expression plasmid was a kind gift of Dr. Bon-chu Chung (Academia Sinica, Taipei,

Taiwan), and the rat LHβ-luciferase plasmid was kindly provided by Dr. Mark Lawson (University of

California, San Diego, La Jolla, CA). We thank Dr. Keith Yamamoto (University of California, San

Francisco, San Francisco, CA) for providing the rat GR plasmid and Dr. Al Parlow of the National

Hormone and Peptide Program for providing the NIDDK-anti-rβ LH-IC-2 antibody. We also thank

Jason Meadows, Emily Witham, Chuqing (Carol) Yao, Courtney Benson, and Dr. Suzanne Rosenberg

(University of California, San Diego, La Jolla, CA) for technical assistance and helpful discussions

throughout this work.

This work was supported by National Institutes of Health (NIH) grants R01 HD020377, R01

HD072754, and R01 DK044838 (to P.L.M.) and by the Eunice Kennedy Shriver National Institute of

Child Health and Human Development/NIH through cooperative agreement (U54 HD012303) as part

of the Specialized Cooperative Centers Program in Reproduction and Infertility Research (to P.L.M.).

P.L.M. was also partially supported by P30 CA023100, P30 DK063491, and P42 ES010337. K.M.B. was

partially supported by NIH Grant K99 HD060947. V.G.T. was partially supported by NIH Grants K01

DK080467, and R01 HD067448. D.C. was partially supported by NIH Grants R01 HD057549, R21

HD058752, and R03 HD054595. The LHβ antibody was provided by Dr. A. F. Parlow from the National

Hormone and Pituitary Program, Harbor-UCLA Medical Center. DNA sequencing was performed by

the DNA-sequencing shared resource, University of California, San Diego, Cancer Center, which is

funded in part by National Cancer Institute Cancer Support Grant P30 CA023100. Serum hormone

assays were performed by The University of Virginia Ligand Assay Core Laboratory, which is supported

through National Institute of Child Health and Human Development Grant U54 HD028934.

Disclosure Summary: The authors have nothing to disclose.

Notes

NURSA Molecule Pages :

Ligands: Corticosterone.

Annotations provided by Nuclear Receptor Signaling Atlas (NURSA) Bioinformatics Resource. Molecule Pages can be

accessed on the NURSA website at www.nursa.org.

Abbreviations:

†

†

http://www.nursa.org/molecule.cfm?molType=ligand&molId=1031

http://www.nursa.org/



ChIP Chromatin immunoprecipitation

DBD DNA-binding domain

Egr1 early growth response factor 1

GAPDH glyceraldehyde-3-phosphate dehydrogenase

GFP green fluorescent protein

GR glucocorticoid receptor

GST glutathione-S-transferase

αGSU glycoprotien hormone alpha-subunit

SF1 steroidogenic factor 1

TK thymidine kinase.

References

1. Ferin M. 1999. Clinical review 105: Stress and the reproductive cycle. J Clin Endocrinol Metab

84:1768–1774. [PubMed: 10372662]

2. Rivier C, Rivest S. 1991. Effect of stress on the activity of the hypothalamic-pituitary-gonadal axis:

peripheral and central mechanisms. Biol Reprod 45:523–532. [PubMed: 1661182]

3. Tilbrook AJ, Turner AI, Clarke IJ. 2002. Stress and reproduction: central mechanisms and sex

differences in non-rodent species. Stress 5:83–100. [PubMed: 12186687]

4. Tilbrook AJ, Turner AI, Clarke IJ. 2000. Effects of stress on reproduction in non-rodent mammals:

the role of glucocorticoids and sex differences. Rev Reprod 5:105–113. [PubMed: 10864855]

5. Dobson H, Smith RF. 2000. What is stress, and how does it affect reproduction? Anim Reprod Sci

60–61:743–752. [PubMed: 10844239]

6. Briski KP, Vogel KL, McIntyre AR. 1995. The antiglucocorticoid, RU486, attenuates stress-induced

decreases in plasma-luteinizing hormone concentrations in male rats. Neuroendocrinology 61:638–645.

[PubMed: 7659189]

7. Dong Q, Salva A, Sottas CM, Niu E, Holmes M, Hardy MP. 2004. Rapid glucocorticoid mediation of

suppressed testosterone biosynthesis in male mice subjected to immobilization stress. J Androl 25:973–

981. [PubMed: 15477372]

8. Breen KM, Oakley AE, Pytiak AV, Tilbrook AJ, Wagenmaker ER, Karsch FJ. 2007. Does cortisol

acting via the type II glucocorticoid receptor mediate suppression of pulsatile luteinizing hormone

secretion in response to psychosocial stress? Endocrinology 148:1882–1890. [PubMed: 17204556]

9. Saketos M, Sharma N, Santoro NF. 1993. Suppression of the hypothalamic-pituitary-ovarian axis in

normal women by glucocorticoids. Biol Reprod 49:1270–1276. [PubMed: 8286608]

10. Breen KM, Billings HJ, Wagenmaker ER, Wessinger EW, Karsch FJ. 2005. Endocrine basis for

disruptive effects of cortisol on preovulatory events. Endocrinology 146:2107–2115.

[PubMed: 15625239]

11. Li XF, Edward J, Mitchell JC, Shao B, Bowes JE, Coen CW, Lightman SL, O'Byrne KT. 2004.

Differential effects of repeated restraint stress on pulsatile lutenizing hormone secretion in female

Fischer, Lewis and Wistar rats. J Neuroendocrinol 16:620–627. [PubMed: 15214865]

12. Oakley AE, Breen KM, Clarke IJ, Karsch FJ, Wagenmaker ER, Tilbrook AJ. 2009. Cortisol reduces

gonadotropin-releasing hormone pulse frequency in follicular phase ewes: influence of ovarian steroids.

Endocrinology 150:341–349. [PMCID: PMC2630911] [PubMed: 18801903]

13. Dufourny L, Skinner DC. 2002. Progesterone receptor, estrogen receptor α, and the type II

glucocorticoid receptor are coexpressed in the same neurons of the ovine preoptic area and arcuate

nucleus: a triple immunolabeling study. Biol Reprod 67:1605–1612. [PubMed: 12390894]



14. Gore AC, Attardi B, DeFranco DB. 2006. Glucocorticoid repression of the reproductive axis: effects

on GnRH and gonadotropin subunit mRNA levels. Mol Cell Endocrinol 256:40–48.

[PubMed: 16839661]

15. Attardi B, Tsujii T, Friedman R, Zeng Z, Roberts JL, Dellovade T, Pfaff DW, Chandran UR, Sullivan

MW, DeFranco DB. 1997. Glucocorticoid repression of gonadotropin-releasing hormone gene expression

and secretion in morphologically distinct subpopulations of GT1–7 cells. Mol Cell Endocrinol 131:241–

255. [PubMed: 9296383]

16. DeFranco DB, Attardi B, Chandran UR. 1994. Glucocorticoid receptor-mediated repression of GnRH

gene expression in a hypothalamic GnRH-secreting neuronal cell line. Ann NY Acad Sci 746:473–475.

[PubMed: 7825918]

17. Melis GB, Mais V, Gambacciani M, Paoletti AM, Antinori D, Fioretti P. 1987. Dexamethasone

reduces the postcastration gonadotropin rise in women. J Clin Endocrinol Metab 65:237–241.

[PubMed: 3110200]

18. Pearce GP, Paterson AM, Hughes PE. 1988. Effect of short-term elevations in plasma cortisol

concentration on LH secretion in prepubertal gilts. J Reprod Fertil 83:413–418. [PubMed: 3294397]

19. Li PS, Wagner WC. 1983. In vivo and in vitro studies on the effect of adrenocorticotropic hormone

or cortisol on the pituitary response to gonadotropin releasing hormone. Biol Reprod 29:25–37.

[PubMed: 6311297]

20. Suter DE, Schwartz NB, Ringstrom SJ. 1988. Dual role of glucocorticoids in regulation of pituitary

content and secretion of gonadotropins. Am J Physiol 254:E595–E600. [PubMed: 3129945]

21. Suter DE, Orosz G. 1989. Effect of treatment with cortisol in vivo on secretion of gonadotropins in

vitro. Biol Reprod 41:1091–1096. [PubMed: 2516471]

22. Kononen J, Honkaniemi J, Gustafsson JA, Pelto-Huikko M. 1993. Glucocorticoid receptor

colocalization with pituitary hormones in the rat pituitary gland. Mol Cell Endocrinol 93:97–103.

[PubMed: 8319836]

23. Li PS. 1994. Modulation by cortisol of luteinizing hormone secretion from cultured porcine anterior

pituitary cells: effects on secretion induced by phospholipase C, phorbol ester and cAMP. Naunyn

Schmiedebergs Arch Pharmacol 349:107–112. [PubMed: 8139698]

24. Maya-Núñez G, Conn PM. 2003. Transcriptional regulation of the GnRH receptor gene by

glucocorticoids. Mol Cell Endocrinol 200:89–98. [PubMed: 12644302]

25. Adams TE, Sakurai H, Adams BM. 1999. Effect of stress-like concentrations of cortisol on estradiol-

dependent expression of gonadotropin-releasing hormone receptor in orchidectomized sheep. Biol

Reprod 60:164–168. [PubMed: 9858501]

26. Pierce JG, Parsons TF. 1981. Glycoprotein hormones: structure and function. Annu Rev Biochem

50:465–495. [PubMed: 6267989]

27. Kaiser UB, Conn PM, Chin WW. 1997. Studies of gonadotropin-releasing hormone (GnRH) action

using GnRH receptor-expressing pituitary cell lines. Endocr Rev 18:46–70. [PubMed: 9034786]

28. Vale W, Rivier C, Brown M. 1977. Regulatory peptides of the hypothalamus. Annu Rev Physiol

39:473–527. [PubMed: 15499]

29. Thackray VG, McGillivray SM, Mellon PL. 2006. Androgens, progestins and glucocorticoids induce

follicle-stimulating hormone β-subunit gene expression at the level of the gonadotrope. Mol Endocrinol

20:2062–2079. [PMCID: PMC2941439] [PubMed: 16675544]



30. Sasson R, Luu SH, Thackray VG, Mellon PL. 2008. Glucocorticoids induce human glycoprotein

hormone α-subunit gene expression in the gonadotrope. Endocrinology 149:3643–3655.

[PMCID: PMC2453092] [PubMed: 18403486]

31. Curtin D, Jenkins S, Farmer N, Anderson AC, Haisenleder DJ, Rissman E, Wilson EM, Shupnik MA.

2001. Androgen suppression of GnRH-stimulated rat LHβ gene transcription occurs through Sp1 sites in

the distal GnRH-responsive promoter region. Mol Endocrinol 15:1906–1917. [PubMed: 11682622]

32. Jorgensen JS, Nilson JH. 2001. AR suppresses transcription of the LHβ subunit by interacting with

steroidogenic factor-1. Mol Endocrinol 15:1505–1516. [PubMed: 11518799]

33. McGillivray SM, Thackray VG, Coss D, Mellon PL. 2007. Activin and glucocorticoids synergistically

activate follicle-stimulating hormone β-subunit gene expression in the immortalized LβT2 gonadotrope

cell line. Endocrinology 148:762–773. [PMCID: PMC2932480] [PubMed: 17082263]

34. Becker KL. 1995. Principles and practice of endocrinology and metabolism. 2nd ed Philadelphia:

Lippincott.

35. Thackray VG, Hunnicutt JL, Memon AK, Ghochani Y , Mellon PL. 2009. Progesterone inhibits basal

and GnRH induction of luteinizing hormone β-subunit gene expression. Endocrinology 150:2395–2403.

[PMCID: PMC2671912] [PubMed: 19106225]

36. Rosenberg SB, Mellon PL. 2002. An Otx-related homeodomain protein binds an LHβ promoter

element important for activation during gonadotrope maturation. Mol Endocrinol 16:1280–1298.

[PMCID: PMC2932471] [PubMed: 12040015]

37. Hollenberg SM, Evans RM. 1988. Multiple and cooperative trans-activation domains of the human

glucocorticoid receptor. Cell 55:899–906. [PubMed: 3191531]

38. Corpuz PS, Lindaman LL, Mellon PL, Coss D. 2010. FoxL2 is required for activin induction of the

mouse and human follicle-stimulating hormone β-subunit genes. Mol Endocrinol 24:1037–1051.

[PMCID: PMC2870942] [PubMed: 20233786]

39. Coss D, Hand CM, Yaphockun KK, Ely HA, Mellon PL. 2007. p38 mitogen-activated kinase is

critical for synergistic induction of the FSH β gene by gonadotropin-releasing hormone and activin

through augmentation of c-Fos induction and Smad phosphorylation. Mol Endocrinol 21:3071–3086.

[PMCID: PMC2932484] [PubMed: 17823303]

40. Larder R, Clark DD, Miller NL, Mellon PL. 2011. Hypothalamic dysregulation and infertility in mice

lacking the homeodomain protein Six6. J Neurosci 31:426–438. [PMCID: PMC3103738]

[PubMed: 21228153]

41. Miyamoto J, Matsumoto T, Shiina H, Inoue K, Takada I, Ito S, Itoh J, Minematsu T, Sato T,

Yanase T, Nawata H, Osamura YR, Kato S. 2007. The pituitary function of androgen receptor

constitutes a glucocorticoid production circuit. Mol Cell Biol 27:4807–4814. [PMCID: PMC1951475]

[PubMed: 17470551]

42. Chappell PE, Schneider JS, Kim P, Xu M, Lydon JP, O'Malley BW, Levine JE. 1999. Absence of

gonadotropin surges and gonadotropin-releasing hormone self-priming in ovariectomized (OVX),

estrogen (E2)-treated, progesterone receptor knockout (PRKO) mice. Endocrinology 140:3653–3658.

[PubMed: 10433223]

43. Bronson FH, Vom Saal FS. 1979. Control of the preovulatory release of luteinizing hormone by

steroids in the mouse. Endocrinology 104:1247–1255. [PubMed: 571329]

44. Coss D, Thackray VG, Deng CX, Mellon PL. 2005. Activin regulates luteinizing hormone β-subunit

gene expression through Smad-binding and homeobox elements. Mol Endocrinol 19:2610–2623.



[PMCID: PMC2932483] [PubMed: 15961509]

45. Tremblay JJ, Lanctôt C, Drouin J. 1998. The pan-pituitary activator of transcription, Ptx1 (pituitary

homeobox 1), acts in synergy with SF-1 and Pit1 and is an upstream regulator of the Lim-

homeodomain gene Lim3/Lhx3. Mol Endocrinol 12:428–441. [PubMed: 9514159]

46. Zhao L, Bakke M, Parker KL. 2001. Pituitary-specific knockout of steroidogenic factor 1. Mol Cell

Endocrinol 185:27–32. [PubMed: 11738791]

47. Tremblay JJ, Drouin J. 1999. Egr-1 is a downstream effector of GnRH and synergizes by direct

interaction with Ptx1 and SF-1 to enhance luteinizing hormone β gene transcription. Mol Cell Biol

19:2567–2576. [PMCID: PMC84049] [PubMed: 10082522]

48. Topilko P, Schneider-Maunoury S, Levi G, Trembleau A, Gourdji D, Driancourt MA, Rao CV,

Charnay P. 1998. Multiple pituitary and ovarian defects in Krox-24 (NGFI-A, Egr-1)-targeted mice. Mol


49. Weck J, Anderson AC, Jenkins S, Fallest PC, Shupnik MA. 2000. Divergent and composite

gonadotropin-releasing hormone-responsive elements in the rat luteinizing hormone subunit genes. Mol


50. Dorn C, Ou Q, Svaren J, Crawford PA, Sadovsky Y . 1999. Activation of luteinizing hormone β gene

by gonadotropin-releasing hormone requires the synergy of early growth response-1 and steroidogenic

factor-1. J Biol Chem 274:13870–13876. [PubMed: 10318795]

51. Kaiser UB, Halvorson LM, Chen MT. 2000. Sp1, steroidogenic factor 1 (SF-1), and early growth

response protein 1 (egr-1) binding sites form a tripartite gonadotropin-releasing hormone response

element in the rat luteinizing hormone-β gene promoter: an integral role for SF-1. Mol Endocrinol

14:1235–1245. [PubMed: 10935547]

52. Rogers SL, Nabozny G, McFarland M, Pantages-Torok L, Archer J, Kalkbrenner F, Zuvela-Jelaska

L, Haynes N, Jiang H., Four mutations in the GR dimerization domain result in perinatal lethal mice.

In: Nuclear Receptors: Steroid Sisters, Keystone, CO 2004, p 194 (Abstract 316)

53. Heck S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P, Cato AC. 1994. A distinct

modulating domain in glucocorticoid receptor monomers in the repression of activity of the

transcription factor AP-1. EMBO J 13:4087–4095. [PMCID: PMC395330] [PubMed: 8076604]

54. Halvorson LM, Ito M, Jameson JL, Chin WW. 1998. Steroidogenic factor-1 and early growth

response protein 1 act through two composite DNA binding sites to regulate luteinizing hormone β-

subunit gene expression. J Biol Chem 273:14712–14720. [PubMed: 9614069]

55. Cates PS, Li XF, O'Byrne KT. 2004. The influence of 17beta-oestradiol on corticotrophin-releasing

hormone induced suppression of luteinising hormone pulses and the role of CRH in hypoglycaemic

stress-induced suppression of pulsatile LH secretion in the female rat. Stress 7:113–118.

[PubMed: 15512855]

56. Rivier C, Rivier J, Vale W. 1986. Stress-induced inhibition of reproductive functions: role of

endogenous corticotropin-releasing factor. Science 231:607–609. [PubMed: 3003907]

57. D'Agostino J, Valadka RJ, Schwartz NB. 1990. Differential effects of in vitro glucocorticoids on

luteinizing hormone and follicle-stimulating hormone secretion: dependence on sex of pituitary donor.

Endocrinology 127:891–899. [PubMed: 2115436]

58. Yokoi T, Ohmichi M, Tasaka K, Kimura A, Kanda Y , Hayakawa J, Tahara M, Hisamoto K, Kurachi

H, Murata Y . 2000. Activation of the luteinizing hormone β promoter by gonadotropin-releasing

hormone requires c-Jun NH2-terminal protein kinase. J Biol Chem 275:21639–21647.



[PubMed: 10787426]

59. Kotitschke A, Sadie-Van Gijsen H, Avenant C, Fernandes S, Hapgood JP. 2009. Genomic and

nongenomic cross talk between the gonadotropin-releasing hormone receptor and glucocorticoid

receptor signaling pathways. Mol Endocrinol 23:1726–1745. [PubMed: 19812390]

Figures and Tables

Fig. 1.

Daily stress disrupts estrous cy clicity in the mouse. A, Representative profiles depicting estrous cy clicity , as

measured by vaginal cy tology , during the prestress period (d 1–d 18) and subsequent daily restraint stress

period (d 19–d 36) in three female mice subjected to 180 min of daily restraint stress. E, Estrus; P, proestrus; D,

diestrus. Shading indicates period of exposure to daily restraint stress. B, Average estrous cy cle length in the

no stress group and stress group (n = 9/group) during the two periods of assessment, d 1–d 18 and d 19–d 36. C,

Time spent in each stage of the cy cle in stress mice during the prestress period, d 1–d 18, and stress period, d

19–d 36. *, Significant (P < 0.05) group (no stress vs. stress) × time (d 1–d 18 vs. d 19–d 36) interaction.

Fig. 2.



Acute stress disrupts pituitary responsiveness to GnRH. A, Schematic depicting events during the 180-min

observation period in which animals were maintained in no stress conditions (white bar) or subjected to

restraint stress (gray bar) for measurement of circulating corticosterone and GnRH-induced LH. Time of

euthanasia and blood collection (Blood coll'n) are indicated: 0, 30, and 180 min. At 17 0 min, no stress and

stressed animals (group) are div ided into two treatments (n = 7 /group per treatment) receiv ing either GnRH

(200 ng/kg, sc) or vehicle (Veh). B, Serum corticosterone (ng/ml) was measured in no stress (white circles) and

stress animals (gray circles). *, Significant (P < 0.05) effect of stress. C, Serum LH (ng/ml) was measured in no

stress (white bars) and stressed (gray bars) animals that received vehicle or GnRH, respectively , 10 min before

euthanasia. *, Significant (P < 0.05) effect of GnRH; #, difference between no stress and stress. D, Schematic

depicting events during 180-min observation period in which animals are maintained in no stress conditions

(white bar) or subjected to restraint stress (gray bar) for measurement of GnRH-induced LHβ mRNA. No stress

and stressed animals are div ided into two groups (n = 7 /group) receiv ing either GnRH (200 ng/kg, sc) or

vehicle (Veh) at 0 min of observation. Time of euthanasia and blood collection (Blood coll'n) occurred at 180

min. E, Quantitative RT-PCR analy sis of LHβ mRNA was performed on indiv idual mouse pituitary glands, and

the amount of LHβ mRNA was compared with the amount of GAPDH mRNA and expressed as relative transcript

level. *, Significant (P < 0.05) effect of GnRH; #, difference between no stress and stress. grp, Group; trt,

treatment.

Fig. 3.



Glucocorticoids inhibit LH and GR are expressed in mouse gonadotrope cells. A, Schematic depicting

experimental events in which animals were administered corticosterone (200 ng/kg, sc; gray bar) or vehicle

(white bar), 90 min before euthanasia and blood collection (Blood coll'n). B and C, Serum corticosterone

(ng/ml, panel B) or LH (ng/ml, panel C) measured in animals administered vehicle (white bars) or

corticosterone (gray bars). *, Significant (P < 0.05) effect of treatment. D–F, Photomicrographs of

representative mouse pituitary sections subjected to two-color immunofluorescence staining using a

fluorescein isothiocy anate-conjugated anti-GR (green fluorescent signal), followed by rhodamine-conjugated

anti-LHβ (red fluorescent signal). Red (panel D), green (panel E), and merge (panel F) immunofluorescence

images were taken of the same microscopic field using appropriate filters. White stars, GR-positive/LHβ-

positive cells. Scale bar, 20 μm. Cort, Corticosterone; trt, treatment; Veh, vehicle.

Fig. 4.

Glucocorticoid repression localizes to the LHβ proximal promoter. A, Quantitative RT-PCR analy sis of LHβ

mRNA extracted from LβT2 cells cultured in the presence of GnRH (10 nM, 6 h), corticosterone (Cort; 100 nM,

24 h), GnRH + corticosterone [Cort (100 nM, entire 24 h); GnRH (10 nM, final 6 h)], or vehicle (Veh; 0.1%

BSA/0.1% ethanol). Results are expressed as LHβ mRNA levels normalized to GAPDH mRNA levels and are the

mean of three separate experiments performed in triplicate. Results shown are average ± SEM relative to the

vehicle treatment. *, Significant (P < 0.05) effect of GnRH; #, significant repression by corticosterone. B, The

−1800-bp rat LHβ-luc reporter gene was transfected into LβT2 cells, and cells were subsequently treated with

corticosterone (Cort; 100 nM, 24 h), dexamethasone (Dex; 100 nM, 24 h), or vehicle alone (Veh; 0.1% BSA/0.1%

ethanol) or either glucocorticoid (100 nM, entire 24 h) in combination with GnRH (10 nM, final 6 h), and

harvested for luciferase as a measure of LHβ promoter activ ity . Results are depicted as fold induction by

hormone treatment relative to vehicle (dashed line) as indicated. *, Significant induction by GnRH vs. vehicle

control; #, significant repression by glucocorticoid treatment on GnRH-induced LHβ expression. C, LβT2 cells

were transfected with a series of 5′-truncated LHβ-luc reporter plasmids and treated with GnRH (10 nM, final 6

h) or GnRH + dexamethasone [Dex (100 nM, entire 24 h); GnRH (10 nM, final 6 h)] to determine regions of the

LHβ promoter that are responsive to glucocorticoids. Results for each truncation are depicted as LHβ fold

induction relative to vehicle of that truncation (dashed line). #, Significant repression by glucocorticoid

treatment on GnRH-induced LHβ expression.

Fig. 5.



GnRH-responsive factor necessary for GR recruitment. A, Schematic of the proximal 150 bp of the rat LHβ 5′-

regulatory region illustrating the known promoter elements involved in expression of the LHβ gene. Proteins

binding each site are indicated. B, Quantitative RT-PCR analy sis of Egr1 mRNA extracted from LβT2 cells

cultured in the presence of dexamethasone (Dex; 100 nM, 18 h), GnRH (10 nM, 45 min), GnRH + dexamethasone

[Dex (100 nM, entire 18 h); GnRH (10 nM, final 45 min)], or vehicle (Veh; 0.1% BSA/0.1% ethanol). Results are

expressed as Egr1 mRNA levels normalized to GAPDH mRNA levels and are the mean of three separate

experiments performed in triplicate. Results shown are average ± SEM. *, Significant induction by GnRH vs.

vehicle control. C, Western blotting analy sis of nuclear extracts from LβT2 cells treated with dexamethasone

(Dex; 100 nM, 18 h), GnRH (10 nM, 2 h), GnRH + dexamethasone [Dex (100 nM, entire 18 h); GnRH (10 nM, final 2

h)], or vehicle (Veh; 0.1% BSA/0.1% ethanol) was performed using an antibody for Egr1 . A protein band was

detected at the expected size of 82 kDa for Egr1 . The experiment was repeated three times with similar results,

and a representative gel is shown. D, ChIP was performed using cross-linked chromatin from LβT2 cells treated

with dexamethasone (Dex; 100 nM, 1 h), GnRH (10 nM, 1 h), GnRH + dexamethasone [Dex (100 nM, 1 h); GnRH

(10 nM, 1 h)], or vehicle (Veh; 0.1% BSA/0.1% ethanol) and antibodies directed against GR or nonspecific IgG as

a negative control. ChIP and input DNA were analy zed by quantitative PCR using primers encompassing the

proximal promoter of Lhb to determine the amount of immunoprecipitated DNA. ChIP samples were

normalized to the respective input samples and then expressed as fold enrichment relative to the nonspecific

IgG ChIP samples.

Fig. 6.

Glucocorticoids interfere with Egr1 actions at the level of the proximal promoter. A, To test whether



glucocorticoids can interfere with Egr1-induced LHβ expression, Egr1 (black bars) or empty vector (Empty

Vec, open bars) was transfected with the −1800-bp LHβ-luc reporter plasmid into LβT2 cells and subsequently

treated with dexamethasone (Dex; 100 nM, 24 h) or vehicle (Veh; 0.1% BSA/0.1% ethanol). Data are shown

relative to vehicle-treated in the absence of Egr1 . *, Significant induction by Egr1 vs. vector control; #,

significant repression by glucocorticoid treatment on Egr1-induced LHβ expression. B, To determine whether

titrating in increasing levels of Egr1 can rescue glucocorticoid repression of −1800-bp LHβ-luc activ ity , LβT2

cells were transfected with empty vector (EV, 200 ng) or increasing amounts of Egr1 [50 ng (plus 150 ng empty

vector), 100 ng (plus 100 ng empty vector), 200 ng] and treated with GnRH (white hatched bars, 10 nM, final 6

h) or GnRH + dexamethasone [gray hatched bars, Dex (100 nM, entire 24 h); GnRH (10 nM, final 6 h)]. Results

are depicted as LHβ-fold induction relative to the vehicle-treated condition in the presence of the same amount

of Egr1 (dashed line) as indicated. *, Significant induction by GnRH; #, significant repression by glucocorticoid

treatment on GnRH-induced LHβ expression. C, The effect of increasing Egr1 on the ratio of LHβ-fold induction

in cells treated with GnRH alone vs. GnRH with dexamethasone was calculated and expressed as percent

repression. *, Significant difference in the ratio as compared with EV determined by Student's t test. D, LβT2

cells were transfected with either the −200-bp LHβ-luc reporter plasmid (WT) or reporter plasmids containing

the −200-bp LHβ region with mutations in SF1 or Egr1 binding elements as indicated and cultured in the

presence of GnRH (white hatched bars) or GnRH + Dex (gray hatched bars). Data are shown for each mutant

promoter, relative to its own vehicle treatment. See Fig. 6B legend for more details. n.s., Not significant P =

0.08; WT, wild ty pe.

Fig. 7.

Interruption of LHβ transcriptional complex formation by glucocorticoids. A, To investigate glucocorticoid-

mediated interference of Egr1 , SF1, and/or Ptx1 induction of LHβ promoter activ ity , CV-1 cells were transfected

with a GR expression vector and the −1800-bp LHβ-luc reporter plasmid, along with Egr1 , SF1, or Ptx1 alone or

in combination, as indicated, and treated with dexamethasone (gray bars, Dex; 100 nM, 24 h) or vehicle (white

bars, Veh; 0.1% BSA/0.1% ethanol). *, Significant induction of LHβ promoter activ ity vs. vector control

(dashed line); #, significant repression by glucocorticoid treatment. B and C, Induction of the Egr1 multimer (B)

or SF1 multimer (C) by the indicated Egr1 or SF1 alone, respectively , or in combination with Ptx1 , was assessed

after treatment with dexamethasone (gray bars, Dex; 100 nM, 24 h) or vehicle (white bars, Veh; 0.1% BSA/0.1%

ethanol) and depicted as fold induction relative to induction of the control luciferase reporter driven by the TK

promoter. *, Significant induction of multimer activ ity vs. vector control (dashed line); #, significant repression

by glucocorticoid treatment.

Fig. 8.




GR does not require dimerization or DNA binding, but is capable of phy sically interacting with Egr1 . A, The

necessity of dimerization or DNA binding by GR, or by GR itself, was assessed in CV-1 cells. The −1800-bp LHβ-

luc reporter plasmid was maximally induced with a combination of Egr1 , SF1, and Ptx1 in CV-1 cells

cotransfected with empty vector (No GR), wild-ty pe GR (WT GR), GR dimerization mutant (Dim mut), or GR DBD

mutant (DBD mut) and subsequently treated with dexamethasone (gray bars, Dex; 100 nM, 24 h) or vehicle

(open bars, Veh; 0.1% BSA/0.1% ethanol). Data are presented relative to the −1800-bp LHβ-luc reporter

cotransfected with the empty vectors for Egr1 , SF1, and Ptx1 for each GR expression vector. #, Significant

repression by glucocorticoid treatment. B, GST interaction assay s were performed using bacterially expressed

Egr1-GST fusion protein and S-labeled in vitro translated GR, SF1, or GFP as a control. One tenth of the

protein input (10% Input) and the GST tag-alone (GST, negative control) are shown (note that the SF1 complex

with GST-Egr1 has spilled over into the intermediate empty lane between the GST and the GST-Egr1 lanes).

Articles from Molecular Endocrinology are provided here courtesy of The Endocrine Society

3 5

stress levels of glucocorticoids inhibit lhβ-subunit gene … · 2015-09-17 · stress levels of...

Documents