strep-tag the leading affinity tag in recombinant protein...

6

Strep-tag® –The leading affinity tag in recombinant protein technology

● high specificity● high activity● high purity

patented or patent pending – world-wide

1

7

Content Page

Strep-tag® ProductsExpression, purification, detection and assay of bioactive proteins

Introduction ………………………………………………………………………………………………… 9

Examples ………………………………………………………………………………………………………11

Strep-tag® Expression System………………………………………………………………………13

Strep-tag® Purification System ……………………………………………………………………20Strep-Tactin Sepharose® ……………………………………………………………………………………………23Ready-to-use Strep-Tactin Sepharose® Column………………………………………………………………………24Strep-Tactin MacroPrep® ……………………………………………………………………………………………25Strep-Tactin POROS® ………………………………………………………………………………………………26Strep-tag® Starter Kit …………………………………………………………………………………………………27

Strep-tag® Detection System …………………………………………………………………………28Strep-tag® II polyclonal antiserum ……………………………………………………………………………………29Strep-Tactin® HRP conjugate …………………………………………………………………………………………29Strep-Tactin® AP conjugate …………………………………………………………………………………………30

Strep-tag® Assay System Strep-Tactin® coated microplates ……………………………………………………………………………………31Strep-Tactin® …………………………………………………………………………………………………………32

Strep-tag® Custom ServiceProduction of Strep-tag proteins in E. coli and insect cells

Requirements ………………………………………………………………………………………………………33Cloning ……………………………………………………………………………………………………………34Expression and Strep-tag purification ………………………………………………………………………………35Proteolytic trimming to generate an authentic protein ………………………………………………………………36General procedure …………………………………………………………………………………………………36Additional Custom Services ………………………………………………………………………………………38

Strep-tag References ……………………………………………………………………………………40

Recombinant Proteins/Strep-tag

Strep-tag® ProductsExpression, purification, detection and assay of bioactive proteins

The tag● Just 8 amino acids ● Balanced amino acid composition - generally no effect on protein

structure or activity● Highly selective and easily controllable binding properties● C- or N-terminal fusion● Must not be removed

The technology● Efficient and versatile bacterial expression vectors with standardized

cloning strategy ● Affinity chromatography under physiological conditions● Column regeneration and activity status is visualized by color change● Over 99% purity can be achieved ● Assays on microplates

The proteinsStrep-tag is the method of choice for:● metalloproteins● membrane proteins● sensitive protein complexes with multiple subunits● and any other protein!

+

N

NH

NH

NH

NH

O

O

O

NH2

CH

2

O

OO

H3N O

O

NH

NCH

2

NH

H3N

NH

NH

CH

2O

CH2

OHO

O

O

+

Strep-tag II NH2-WSHPQFEK-COOH

Large proteinsOat phytochrome A,124 kDa

MetalloenzymesE. coli alkaline phosphatase▼

Peak performance in affinity tag technology

▼

Four examples demonstrating the power of the Strep- tagpurification technology. Left lane, total protein extract;right lane, protein after single-step purification.

Tel. +49 551 50672-0 ● Fax +49 551 50672-181 ● info@iba -go.de ● www.iba -go.de8


1

Introduction

In the post genomic era, the study of bioactive recombinant proteins will play amajor role in all fields of biotechnology. During the past five years IBA has deve-loped in close collaboration with Prof. Arne Skerra, TU Munich, a universal platform technology called Strep-tag® for the convenient production and use ofrecombinant proteins.Strep-tag is a short peptide (8 amino acids) with highly selective binding propertiesfor engineered streptavidin called “Strep-Tactin®“. Using a simple and universal cloning strategy provided by the pASK-IBA expression vectors, Strep-tag can begenetically fused to a protein’s N- or C-terminal end. After functional expression ofthe protein, Strep-tag allows affinity chromatography on immobilized Strep-Tactinunder physiological conditions. In contrast to other tags, this preserves bioactivityand can yield over 99 % purity after a single chromatographical step. The detectionsystems based on Strep-Tactin directly conjugated to reporter enzymes or antibodiesare fast, selective and sensitive. Furthermore, the specific interaction enables theselective and oriented immobilization of the target protein on Strep-Tactin coatedsurfaces. Thus, microplates coated with Strep-Tactin are a general platform forstraightforward assays of tagged target proteins, including high throughput screening assays.

Principle and properties

The Strep-tag® purification system is based on the highly selective and easily con-trollable interaction between the Strep-tag II peptide and specially engineeredstreptavidin called Strep-Tactin. The binding affinity of Strep-tag II to Strep-Tactinis nearly 100 times higher than to streptavidin. The tagged protein binds to immo-bilized Strep-Tactin during affinity purification. Physiological buffers like PBS incombination with a wide range of additives can be used (see Table 1). After ashort washing step, gentle elution of purified recombinant protein is performed by addition of minute quantities (2.5 mM) of desthiobiotin in the same buffer.Desthiobiotin is an inexpensive, reversibly binding and stable analog of biotin - thenatural ligand of streptavidin. This competitive elution is the second step conferringspecificity thus enabling unparalleled purification factors. The system is save andeasy to use; column regeneration and activity status are visualized by a color changeon the purification column.Convenient detection of Strep-tag fusion proteins can be performed in Westernblots, ELISA, electron or fluorescence microscopy. Appropriate Strep-Tactin enzymeconjugates and polyclonal rabbit antiserum against Strep-tag II are available.

Heterodimeric proteinsH. pylori urease

Multimeric membrane protein complexesP. denitrificans cytochrome c oxidase ▼▼

Tel. +49 551 50672-0 ● Fax +49 551 50672-181 ● info@iba -go.de ● www.iba -go.de 9

Table 1. Reagents compatible with Strep-tag II/ Strep-Tactin interaction

Up to 1 M guanidine0.1 % v/v Triton X-100, Tween 20, CHAPS and N-lauryl sarcosine Non-ionic detergents used for the solubilization of membrane proteins5 mM ß-mercaptoethanol, DTT1 M NaCl10 % glycerol

Higher concentrations were not tested but might be possible.

Tel. +49 551 50672-0 ● Fax +49 551 50672-181 ● info@iba -go.de ● www.iba -go.de


10

Strep-tag® IIThe short peptide tag (8 amino acids) has negligible effect on the recombinant pro-tein due to its chemically balanced amino acid composition (WSHPQFEK). Thetag can be placed at the C- or N-terminus. Generally, it does not interfere with fol-ding or bioactivity, does not react with heavy metal ion buffer impurities, has noion exchange properties and does not induce protein aggregation. Thus, there isno need for removing the tag. It can be exploited efficiently in many downstreamapplications including the mild, oriented and standardized immobilization ofrecombinant proteins on Strep-Tactin coated microplates for various assays.

Strep-Tactin®

Strep-Tactin is a derivative of streptavidin which is one of the most stable proteins.Streptavidin is stable to treatment with 8 M urea or guanidine, 0.5 M NaOH aswell as 50 % formamide (t = 1 h; T = 37 °C). Proteases (proteinase K, pepsin,papain, subtilisin, thermolysin, elastase) do not cleave Streptavidin during a 2 hincubation at a 1:50 w/w ratio and 37 °C. In the presence of SDS Streptavidinbegins to break up into monomers only at temperatures above 60 °C. As far astested until now, we have been able to confirm these extraordinary properties forStrep-Tactin as well enabling long-lived affinity columns which can be re-usedmany times. Furthermore, the neutral pI of Strep-Tactin minimizes non-specific pro-tein or nucleic acid binding.

Benefits ● Purification of bioactive recombinant proteins ● Physiological purification with desthiobiotin for elution● Protein aggregation is avoided● Broad range of detergents, chelators, salt or redox conditions allowed● Avoids interaction with heavy metal ions which are toxic and may catalyze

protein oxidation

Biotin

Desthiobiotin

Request our IBAAcademy program

(page 101) for information on coursesabout recombinant protein

production



1

11

Examples

Strep-tag fusion protein Strep-tag application (References see page 40)

VH domain of the lysozyme- Purification of the intact Fv fragment (12)

binding D1.3 Fv fragment Detection of the Fv fragment via ELISA (12) and Western blotting (12)

(mouse hybridoma)

VL domain of the D1.3 Fv fragment Purification of the intact Fv fragment (12)

(mouse hybridoma) Detection of the Fv fragment via ELISA (12) and Western blotting (12)

Capture of the Fv:antigen complex (12)

Azurin (P. aeruginosa) Purification of the functional metalloprotein (13)

Cytochrome b562 (E. coli) Purification of the functional heme protein (13)

Cystatin (chicken) Purification of the functional protein (13)

Retinol-binding protein (pig) Purification of the functional protein (16)

Bilin-binding protein and mutants Purification of the functional protein (18, 35)

(Pieris brassicae) ELISA applications (18, 35)

Fragment of the growth-promoting activity Purification of the functional protein fragment (17)

receptor A (chicken)

Fragment of the ciliary neurotrophic Purification of the functional protein fragment (17)

factor receptor (chicken)

VH domain of the cytochrome C oxidase- Purification of the intact Fv fragment (15)

binding 7E2 Fv fragment Capture of the intact cytochrome C oxidase (4 subunits) (14)

(mouse hybridoma) Detection of the Fv fragment via immunoelectron microscopy (41)

and immunofluorescence microscopy (44)

VH domains of the ubiquinol:cytochrome Purification of the intact Fv fragment (41)

Coxidoreductase-binding 7D3 and 2D6 Capture of the intact ubiquinol:cytochrome C oxidoreductase (3 subunits) (14)

Fv fragments (mouse hybridomas) Detection of the Fv fragment via immunoelectron microscopy (41, 42)

and immunofluorescence microscopy (44)

VH domain of the photosystem I - binding Purification of the intact Fv fragment (19)

1E7 Fv fragment (mouse hybridoma) Capture of the intact photosystem I (3 subunits) (19)

Detection of the Fv fragment via Western blotting (19)

and immunoelectron microscopy (19)

Phytochrome A (oat) Purification of the functional apo-protein

(expressed in yeast) (23)

Alkaline phosphatase (E. coli) Purification of the active metalloenzyme (22, 24)

Green fluorescent protein (A. victoria) Purification of the functional protein (2)

Detection in Western blot

Subunit B of H. pylori urease Copurification of expressed A and B subunits (1)

Detection in Western blot (Subunit B)

Curli assembly factor CsgG Purification of the native outer membrane protein (25)

(E. coli outer membrane)

Phytochrome Cph1 Purification of the active, light-regulated histidine kinase (27)

(Cyanobacteria)

Glutathione S-transferase and fusion Purification of the dimeric fusion enzyme (26)

proteins Detection in ELISA (26)

VH domain of the cytochrome C oxidase- Purification of the intact Fv fragment (28)

binding 7E2C50S Fv fragment Capture of the cytochrome c oxidase subunits I and II (28)

(mouse hybridoma)

Hydrogenase precursor (E. coli) Purification of the active precursor (80 %) with N-terminal Strep-tag II (30)

PdxA and PdxJ (E. coli) Purification of the active enzymes for vitamin B6 synthesis (34)

Hyaluronate synthase (group A streptococci) Purification of the active enzyme, probably in membrane-anchored

form (5)



12

Examples

Strep-tag fusion protein Strep-tag application (References)

SP1 and SP3 transcription factors Purification of the soluble proteins (expressed in SF9 cells) (5)

Ligase I, III, IV, and XRCC4 (human) Purification of the active enzymes (expressed in HeLa cells) (5)

T7 RNA polymerase (E. coli) Purification of the active enzyme (5)

CPP32 (human) Purification of the active cysteine protease (5)

BetP (C. glutamicum) Purification of this integral membrane protein for glycine betaine uptake

exhibiting the same transport characteristics compared to

the wild-type protein (37)

NADH dehydrogenase fragment of the Purification of the correctly assembled complex composed

so called complex I (E. coli) of 3 subunits, one containing the Strep-tag II (38)

BHLHzip domain of c-Myc (human) Purification of the correctly folded protein domain binding

to its cognate ligand "Max" (33)

Tissue transglutaminase, the major Purification of the active enzyme which had been expressed

autoantigen of gluten-sensitive enteropathy in the human embryonic kidney cell line 293-EBNA (36)

(human)



1

13

Strep-tag® Expression SystemOne cloning strategy - many options

Features and benefits● High-level expression in E. coli with pASK-IBA vectors● Tightly regulated expression due to the tet promoter● Enhanced stability of cytotoxic genes● Universal cloning strategy with one restriction enzyme● N- or C-terminal Strep-tag II fusion● Cytosolic or periplasmic expression● Inexpensive induction with anhydrotetracycline

The pASK-IBA expression plasmids and their properties

Plasmid Strep-tag II Secretion Removal of the tagpASK-IBA2 C-terminal Yes NopASK-IBA3 C-terminal No NopASK-IBA4 N-terminal Yes NopASK-IBA5 N-terminal No NopASK-IBA6 N-terminal Yes YespASK-IBA7 N-terminal No YesOrder information see page 19.


pASK-IBA vectors work with the tightly regulated tet promoter. The tet repressor isencoded on the pASK-IBA plasmids and is constitutively expressed from the β-lactamase promoter. This special arrangement guarantees a balanced stochio-metry between repressor molecules and plasmid copy number. Expression of theforeign gene is stringently repressed until efficient chemical induction with a lowconcentration of anhydrotetracycline. In contrast to the lac promoter – which isleaky, susceptible to catabolite repression (cAMP-level, metabolic state), and influenced by chromosomally encoded repressor molecules – the tetA promoter/operator istightly controlled and not functionally coupled to any cellular regulation mechanisms or genetic background.These facts preclude the need for special E. coli strains or extra plasmids and allowa broad range of culture media and conditions. For example, glucose minimalmedia and even the XL1-Blue bacterial strain, which carries an episomal copy ofthe tetracycline resistance gene, can be used for expression. The pASK-IBA expres-sion system is stable under many conditions, including fermentation, and is easyto handle.Further elements of the vectors are a tandem ribosome binding site (RBS) whichensures efficient initiation of translation, the strong terminator of the lipoproteingene in order to prevent read-through, the intergenic region of the bacteriophagef1 which provides a means for preparing ssDNA and a β-lactamase resistancegene. The vectors do not mediate resistance against tetracycline.Some vectors provide an N-terminal fusion of the ompA signal peptide which mediates the secretion of the recombinant protein to the periplasmic space of E. coli. There the signal peptide is selectively cleaved by the E. coli signal peptidase. The secretion strategy is essential for the functional production of proteinscontaining structural disulfide bonds that are often present in naturally secreted proteins. The reducing conditions in the cytoplasm of E. coli prevent disulfide bond formation which can lead to aggregation or degradation of unfolded polypeptides.

The following E. coli strains have already been successfullyused for Strep-tag expression with our pASK-IBA vectors:JM83, WK6, B, BL21, MG1655, W3110, BL21(DE3),BLR(DE3), XL1-Blue, BL21-CodonPlusTM-RILPlease note that we are not aware of an E. coli strain thatis incompatible with the Strep-tag expression system.

pASK-IBAvectors

pASK-IBA vector maps see pages 15-19.



14

Furthermore, periplasmic secretion separates the recombinant protein from cyto-solic proteases. Since the E. coli outer membrane can be selectively degraded bymild treatment (EDTA, lysozyme etc.) the cytosolic components can be easily re-moved by centrifugation. In addition, the periplasmic space is accessible to molecules < 600 Da whichmakes it possible to influence folding or stability of the recombinant protein duringexpression by adding active substances to the culture media (e.g. redox compo-nents, non-metabolizable sugars, ligands of the recombinant protein etc.).As long as a cytoplasmic recombinant protein does not include stop-transfersequences, the advantages of periplasmic secretion are also amenable to thistype of protein. However, because stop-transfer sequences are difficult to predict,it is advisable to try both strategies in parallel. Using the vectors for N-terminal Strep-tag II fusion, the change from cytoplasmic to periplasmic expression (andvice versa) can be achieved by a simple cloning step via the NheI/BstBI and theEcoRV/HindIII restriction sites on the 5'- and 3'- end, respectively (see pages 17-19).For special applications requiring an authentic protein, your vector of choiceshould be either pASK-IBA6 or pASK-IBA7. Both encode the factor Xa proteasecleavage site adjacent to Strep-tag II allowing the complete removal of the tag.Please note, that in most cases it is superfluous to remove the tag.

Special cloning procedure

The polylinkers of the expression vectors carry the restriction sites BsaI (isoschizo-mer Eco31I) and BsmFI (New England Biolabs, MBI Fermentas) which allow theprecise fusion of the structural gene with the vector-encoded functional elementsincluding the Strep-tag II and - depending on the vector - OmpA-signal sequence,start codon, or stop codon (see page 15). This is easily achieved by adapting thestructural gene at both ends of the coding region via PCR (see page 16). To avoidthe incorporation of base substitutions, PCR should be performed with a proof-reading DNA polymerase such as Pfu (Stratagene). 3' phosphorothioate-protectedprimers should be used in order to avoid 3'➔ 5' degradation by the proof-readingactivity. The cloning strategy is described for pASK-IBA3 (see page 16). If a different vector is to be used, the cloning strategy has to be adapted accordingly.The essential primer sequences for each vector are described on pages 17-19.

In cases where other restrictions sites are intended to be used for cloning, caremust be taken to ensure the in-frame fusion of the structural gene and vector encoded functional element reading frames. In the vectors with N-terminal Strep-tag II, Strep-tag II is followed by the linker sequence 5'-GGCGCC-3', which is recognized by4 different restriction enzymes. Cleavage with the suitable enzyme and a subse-quent filling reaction enable the production of blunt ends in all reading frames.

Protein beforeXa treatment

1 h 2 h 4 h An authentic proteinwas generated after 16 hours incubation.

Factor Xa processing:

Protein gel demonstrating the treatment of the 15 kDaselenoprotein (carrying a N-terminal Strep-tag) with fac-tor Xa (1:1000, w/w) at 22°C. The gene encoding theprotein had been cloned into pASK-IBA6, which containsa Xa cleavage site adjacent to Strep-tag II (see polylinkerpage 19). Lane 1, protein before Xa processing; lane 2, after 1 hourincubation; lane 3, after 2 hours; lane 4, after 4 hours;lane 5, after 16 hours: homogenous authentic proteinwithout Strep-tag II.

kDa

- 18.4- 14.4



1

15

Structure of the pASK-IBA expression vectors. MCS, f1-IG, bla, ori, tlpp, and tetR denote the multiple cloning site,intergenic region of phage f1, β-lactamase gene, originof replication of the pUC family of plasmids, lpp termina-tor of transcription, and tet repressor gene, respectively.The expression cassette is under transcriptional control ofthe tetA promoter/operator. The tet repressor gene hasbeen placed as a second cistron immediately behind thecistron encoding ß-lactamase and is thus under transcrip-tional control of the constitutive β-lactamase promoter.Digesting the vector with one of the type IIS restrictionenzymes BsaI, Eco31I, or BsmFI leads to the generationof defined 5' overhangs in the upstream and downstreamelements, which are not mutually compatible and can the-refore not re-ligate. Upstream elements may be DNAsequences encoding the OmpA signal peptide, an initia-tor methionine, Strep-tag II, or the factor Xa recognitionsequence, while downstream elements may be the Strep-tag II or a stop codon. The gene to be cloned must beequipped with compatible overhangs, e. g. by incorpo-ration of appropriate restriction sites by PCR and sub-sequent cleavage (see page 16).Order information see page 19.

MCS

MCS

MCS

MCS

MCS

MCS

OmpA

OmpA

OmpA

Strep-tag II

Strep-tag II

Strep-tag II

Strep-tag II

Strep-tag II

Strep-tag II

Stop

Stop

Stop

Stop

Stop

Stop

ATG

ATG

ATG

ATG

ATG

ATG

pASK-IBA2

pASK-IBA3

pASK-IBA4

pASK-IBA5

pASK-IBA6

pASK-IBA7

Xa

Xa

Eco31I/ Bsal

Eco31I/ Bsal

Xbal HindIII

tlpp

Ncol / SacllEcoRlSstlKpnlSmalBamHlXholSallPstlNcol

tet p/o

ori

f1

Amp R

tet-repressor

pASK-IBA 3226-3306 bp

pASK-IBA representing the Strep-tag II vectors(the pASK-IBA vectors differ only in between the XbaI and HindIII restriction sites)

The pASK-IBA expression system offers many options

vector upstream MCS/insert downstream periplasm/ removalelement element cytoplasm of the tag



16

Cloning scheme (only applicable for pASK-IBA3)

Cloning diagram of C-terminal Strep-tag fusion with a given target gene and the vector pASK-IBA3 using BsaI or Eco31I. The procedure must be adapted with suitable primers when one of the other vectors is used (see expression cassettes on pages 17-19).



1

17

Expression cassettes of pASK-IBA vectors

General remarks● Restriction enzymes with two recognition sites are denoted in bold, all other

recognition sites mentioned in the MCS are unique● The overhangs which have to be generated via the PCR strategy (see page 16)

are indicated in lower case● BsaI and Eco31I are isoschizomers● Short linker sequences SerAla or GlyAla are essential in order to ensure steric

accessibility of Strep-tag II

pASK-IBA2● Recombinant protein with C-terminal Strep-tag II● Periplasmic localization of recombinant protein● Strep-tag II cannot be removed● Recommended for proteins which are also secreted in the original host

RBS XbaI RBS5'-TAGAGAAAAGTGAAATGAATAGTTCGACAAAAATCTAGATAACGAGGGCAAAAAATGAAAAAGACAGCTATCGCG

tetA: MetAsnSerSerThrLysIleEnd MetLysLysThrAlaIleAla

Eco31I PshAI

BsaI NcoI BsmFI EcoRI SstI KpnI

ATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAggccGGAGACCATGGTCCCGAATTCGAGCTCGGTACC

IleAlaValAlaLeuAlaGlyPheAlaThrValAlaGlnAlaGlyAspHisGlyProGluPheGluLeuGlyThr

OmpA

PshAI Eco31I

SmaI BamHI XhoI SalI PstI BsmFI NcoI BsaI Eco47III BstBI

CGGGGATCCCTCGAGGTCGACCTGCAGGGGGACCATGGTCTCAgcgcTTGGAGCCACCCGCAGTTCGAAAAATAA

ArgGlySerLeuGluValAspLeuGlnGlyAspHisGlyLeuSerAlaTrpSerHisProGlnPheGluLysEndlink Strep-tag II

HindIII

TAAGCTTGACCTGT-3'

(N20)

Cloning primers: Forward 5'-NNNNNNGGTCTCNG GCC NNN NNN ...

(N20)Reverse 5'-NNNNNNGGTCTCNGC GCT NNN NNN ...

pASK-IBA3● Recombinant protein with C-terminal Strep-tag II● Cytosolic localization of recombinant protein● Strep-tag II cannot be removed

Eco31I PshAI

RBS XbaI RBS BsaI SacII BsmFI

5'-TAGAGAAAAGTGAAATGAATAGTTCGACAAAAATCTAGATAACGAGGGCAAAAaatgGGAGACCGCGGTCCC

tetA: MetAsnSerSerThrLysIleEnd MetGlyAspArgGlyPro

PshAI Eco31I

EcoRI SstI KpnI SmaI BamHI XhoI SalI PstI BsmFI NcoI BsaI Eco47III

GAATTCGAGCTCGGTACCCGGGGATCCCTCGAGGTCGACCTGCAGGGGGACCATGGTCTCAgcgcTTGGAGCCAC

GluPheGluLeuGlyThrArgGlySerLeuGluValAspLeuGlnGlyAspHisGlyLeuSerAlaTrpSerHis

link

BstBI HindIII

CCGCAGTTCGAAAAATAATAAGCTTGACCTGTG-3'

ProGlnPheGluLysEnd Strep-tag II

(N17)*

Cloning primers: Forward 5'-NNNNNNGGTCTCNA ATG NNN NNN

(N20)Reverse 5'-NNNNNNGGTCTCNGC GCT NNN NNN...

* The ATG start codon is already included in the vector defined part

MCSOmpA Strep-tag IIStopATG

Eco31I/ Bsal

Eco31I/ Bsal

Xbal HindIII

tlpp

Ncol EcoRlSstlKpnlSmalBamHIXholSallPstlNcol

tet p/o

ori

f1

Amp R

tet-repressor

pASK-IBA2 3286 bp

InsertOmpA Strep-tag IIStopATGA2

MCS Strep-tag IIStopATG

Eco31I/ Bsal

Eco31I/ Bsal

Xbal HindIII

SacllEcoRlSstlKpnlSmalBamHIXholSallPstlNcol

tet p/o

ori

f1

Amp R

tet-repressor

pASK-IBA3 3226 bp

vector defined part

gene defined part

vector defined part

gene defined part

Eco31I/BsaIType IIS enzymes

5’...GGTCTCN...3’3’...CCAGAGNNNNN...5’

cleavage

recognition site

cleavage

order information see page 19

order information see page 19



18

pASK-IBA4● Recombinant protein with N-terminal Strep-tag II● Periplasmic localization of recombinant protein● Strep-tag II cannot be removed● Recommended for proteins which are also secreted in the original host

XbaI RBS

5'-ATCTAGATAACGAGGGCAAAAAATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACC

MetLysLysThrAlaIleAlaIleAlaValAlaLeuAlaGlyPheAlaThr

OmpA

BbeI

EheI

NarI Eco31I PshAI

NheI BstBI KasI BsaI SacIIBsmFI EcoRI SstI

GTAGCGCAGGCCGCTAGCTGGAGCCACCCGCAGTTCGAAAAAGgcgcCGAGACCGCGGTCCCGAATTCGAGCTC

ValAlaGlnAlaAlaSerTrpSerHisProGlnPheGluLysGlyAlaGluThrAlaValProAsnSerSerSeOmpA Link Strep-tag II Link ArgProArgSerArgIleArgAlaA

AspArgGlyProGluPheGluLeu

PshAI Eco31I

KpnI SmaI BamHI XhoI SalI PstI BsmFI NcoI BsaI EcoRV HindIII

GGTACCCGGGGATCCCTCGAGGTCGACCTGCAGGGGGACCATGGTCTCTgataTCTAACTAAGCTTGACCTGTGA-3'

rValProGlyAspProSerArgSerThrCysArgGlyThrMetValSerAspIleEndrgTyrProGlyIleProArgGlyArgProAlaGlyGlyProTrpSerLeuIleSerAsnEndGlyThrArgGlySerLeuGluValAspLeuGlnGlyAspHisGlyLeuEnd

(N20)

Cloning primers: Forward 5'-NNNNNNGGTCTCNGC GCC NNN NNN ...

(N20)Reverse 5'-NNNNNNGGTCTCNTA TCA NNN NNN ...

pASK-IBA5● Recombinant protein with N-terminal Strep-tag II● Cytosolic localization of recombinant protein● Strep-tag II cannot be removed

RBS XbaI RBS NheI

5'-TAGAGAAAAGTGAAATGAATAGTTCGACAAAAATCTAGATAACGAGGGCAAAAAATGGCTAGCTGGAGCCAC

tetA: MetAsnSerSerThrLysIleEnd MetAlaSerTrpSerHis

Link Strep-

BbeI

EheI

NarI Eco31I PshAI

BstBI KasI BsaI SacII BsmFI EcoRI SstI KpnI SmaI BamHI XhoI SalI

CCGCAGTTCGAAAAAGgcgcCGAGACCGCGGTCCCGAATTCGAGCTCGGTACCCGGGGATCCCTCGAGGTCGACC

ProGlnPheGluLysGlyAlaGluThrAlaValProAsnSerSerSerValProGlyAspProSerArgSerThrtag II Link ArgProArgSerArgIleArgAlaArgTyrProGlyIleProArgGlyArgPr

AspArgGlyProGluPheGluLeuGlyThrArgGlySerLeuGluValAspL

PshAI Eco31I

PstI BsmFI NcoI BsaI EcoRV HindIII

TGCAGGGGGACCATGGTCTCTgataTCTAACTAAGCTTGACCTGTGAAGTGAAAAA-3'

CysArgGlyThrMetValSerAspIleEndoAlaGlyGlyProTrpSerLeuIleSerAsnEndeuGlnGlyAspHisGlyLeuEnd

(N20)

Cloning primers: Forward 5'-NNNNNNGGTCTCNGC GCC NNN NNN ...

(N20)

Reverse 5'-NNNNNNGGTCTCNTA TCA NNN NNN ...


Eco31I/ Bsal

Eco31I/ Bsal

Xbal HindIII


tet p/o

ori

f1

Amp R

tet-repressor

pASK-IBA4 3299 bp

Insert

Insert

Insert

MCS

OmpA

OmpA

Strep-tag II

Strep-tag II

Strep-tag II

Strep-tag II

Stop

Stop

Stop

Stop

ATG

ATG

ATG

ATG

pASK-IBA2

pASK-IBA3

pASK-IBA4

Eco31I/ Bsal

Eco31I/ Bsal

Xbal HindIII


tet p/o

ori

f1

Amp R

tet-repressor

pASK-IBA5 3239 bp

vector defined part

gene defined part

vector defined part

gene defined part

Insert

Insert

MCSOmpA

OmpA Strep-tag II

Strep-tag II

Strep-tag II

Stop

Stop

Stop

ATG

ATG

ATG

ASK IBA4

ASK-IBA5

Xa

Eco31I/ Bsal

Eco311/ Bsal

Xbal HindIII


tet p/o

ori

f1

Amp R

tet-repressor

pASK-IBA6 3306 bp

Insert

Insert

Insert

MCS

OmpA

OmpA Strep-tag II

Strep-tag II

Strep-tag II

Strep-tag II

Stop

Stop

Stop

Stop

ATG

ATG

ATG

ATG

ASK-IBA4

ASK-IBA5

ASK-IBA6Xa

Xa

Eco31I/ Bsal

Eco31I/ Bsal

Xbal HindIII


tet p/o

ori

f1

Amp R

tet-repressor

pASK-IBA7 3246 bp



1

19

pASK-IBA6● Recombinant protein with N-terminal Strep-tag II● Periplasmic localization of recombinant protein● Strep-tag II can be removed by cleavage with factor Xa● Recommended for proteins which are also secreted in the original host

XbaI RBS

5'-ATCTAGATAACGAGGGCAAAAAATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACC

MetLysLysThrAlaIleAlaIleAlaValAlaLeuAlaGlyPheAlaThr

OmpA

BbeI

EheI

NarI Eco31I PshAI

NheI BstBI KasI BsaI SacII BsmFI EcoRI

GTAGCGCAGGCCGCTAGCTGGAGCCACCCGCAGTTCGAAAAAATCGAAGGgcgcCGAGACCGCGGTCCCGAATTC

ValAlaGlnAlaAlaSerTrpSerHisProGlnPheGluLysIleGluGlyArgArgAspArgGlyProGluPhe

OmpA Link Strep-tag II Faktor Xa GluThrAlaValProAsnSeArgProArgSerArgIleA

PshAI Eco31I

SstI KpnI SmaI BamHI XhoI SalI PstI BsmFI NcoI BsaI EcoRV HindIII

GAGCTCGGTACCCGGGGATCCCTCGAGGTCGACCTGCAGGGGGACCATGGTCTCTgataTCTAACTAAGCTTGAC-3'

GluLeuGlyThrArgGlySerLeuGluValAspLeuGlnGlyAspHisGlyLeuEndrSerSerValProGlyAspProSerArgSerThrCysArgGlyThrMetValSerAspIleEndrgAlaArgTyrProGlyIleProArgGlyArgProAlaGlyGlyProTrpSerLeuIleSerAsnEnd

(N20)Cloning primers: Forward: 5'-NNNNNNGGTCTCNG CGC NNN NNN ...

(N20)Reverse: 5'-NNNNNNGGTCTCNTA TCA NNN NNN ...

pASK-IBA7● Recombinant protein with N-terminal Strep-tag II● Cytosolic localization of recombinant protein● Strep-tag II can be removed by cleavage with factor Xa

RBS XbaI RBS NheI

5'-GAGAAAAGTGAAATGAATAGTTCGACAAAAATCTAGATAACGAGGGCAAAAAATGGCTAGCTGGAGCCAC

tetA: MetAsnSerSerThrLysIleEnd MetAlaSerTrpSerHisLink Strep-

BbeI

EheI

NarI Eco31I PshAI

BstBI KasI BsaI SacII BsmFI EcoRI SstI KpnI SmaI BamHI XhoI

CCGCAGTTCGAAAAAATCGAAGGgcgcCGAGACCGCGGTCCCGAATTCGAGCTCGGTACCCGGGGATCCCTCGAG

ProGlnPheGluLysIleGluGlyArgArgAspArgGlyProGluPheGluLeuGlyThrArgGlySerLeuGlutag II Faktor Xa GluThrAlaValProAsnSerSerSerValProGlyAspProSerAr

ArgProArgSerArgIleArgAlaArgTyrProGlyIleProArgG

PshAI Eco31I

SalI PstI BsmFI NcoI BsaI EcoRV HindIII

GTCGACCTGCAGGGGGACCATGGTCTCTgataTCTAACTAAGCTTGACCTGTGAAGTGAAA-3'

ValAspLeuGlnGlyAspHisGlyLeuEndgSerThrCysArgGlyThrMetValSerAspIleEndlyArgProAlaGlyGlyProTrpSerLeuIleSerAsnEnd

(N20)Cloning primers: Forward 5'-NNNNNNGGTCTCNG CGC NNN NNN ...

(N20)Reverse 5'-NNNNNNGGTCTCNTA TCA NNN NNN ...

plasmid amount cat. no. price pASK-IBA2 5 µg 2-1301-000 150.00 3pASK-IBA3 5 µg 2-1302-000 150.00 3pASK-IBA4 5 µg 2-1303-000 150.00 3pASK-IBA5 5 µg 2-1304-000 150.00 3pASK-IBA6 5 µg 2-1305-000 150.00 3pASK-IBA7 5 µg 2-1306-000 150.00 3

vector defined part

gene defined part

vector defined part

gene defined part

Order information

▼



20

Strep-tag® Purification SystemPure and functional proteins after one simple chromatographicalstep

Features and benefits

● Simple one-step purification from crude lysate to > 99% pure protein under physiological conditions possible (see Figure on page 23)

● High and selective binding affinity and high capacity due to special Strep-Tactin® resins

● Resins for gravity flow, low pressure or HPLC applications● Co-purification of non-covalently bound ligands possible!● Column regeneration and activity status is visualized by color change

Application Recommended resins Pagegravity flow Strep-Tactin Sepharose® 23, 24low pressure Strep-Tactin Macroprep® 25FPLC or HPLC Strep-Tactin POROS® 26


The Strep-tag purification system is based on the highly selective binding ofengineered streptavidin, called Strep-Tactin, to Strep-tag II fusion proteins. This technology allows one-step purification of almost any recombinant protein underphysiological conditions, thus preserving its bioactivity. The Strep-tag system canbe used to purify Strep-tag II proteins from any expression system including baculo-virus, mammalian cells, yeast, and bacteria.

Procedure

The purification of Strep-tag II fusion proteins is very simple and user-friendly. The com-plete procedure can be performed under nearly physiological conditions, e.g. in PBSbuffer and 2.5 mM desthiobiotin in PBS buffer during elution.● Once the tagged protein has bound specifically to the column the unspecific proteins

are rapidly washed away with small amounts of physiological washing buffer.● Then, small amounts of the specific competitor desthiobiotin are added in order to

elute the Strep-tag protein. Since the buffer conditions during elution essentiallyremain unchanged, potentially unspecifically binding proteins (without Strep-tag) willnot be eluted and, thus, will not contaminate the protein of interest.

● To regenerate the column desthiobiotin is displaced by adding the yellow solution HABA (hydroxyazophenyl benzoic acid). After the removal of desthiobiotin thecolumn turns red. This clear color change indicates the regeneration and activitystatus of the column (see page 21).

● HABA can be removed simply by using washing buffer. Once the red color has disappeared the column can be re-used. On page 21 the procedure is docu-mented for the purification of GFP (Green Fluorescent Protein).

in solution complexed withStrep-Tactin



21

The Strep-tag II protein purification

cycle

Strep-Tactin Sepharose column(new or regenerated)

Binding of Strep-tag II protein and purification by physiological washing

Desthiobiotin

HABA (bound)

*4-hydroxy azobenzene-2-carboxylic acid

Application of an extract containing Strep-tag II protein (in this case GFP)

Mild elution:Displacement of Strep-tag II

protein by desthiobiotin(specific competitor)

Simple and fast removal of HABA using washing buffer

recombinant protein

host proteins

Strep-Tactin®

Strep-tag II

1

2

3

4

5

6

HABA* in excess displaces desthiobiotin

(color change from yellow to red due to the accumulation of

HABA/Strep-Tactin complexes)

1

HABA (not bound)

HABA saturated column (desthiobiotin-free)



22

Due to the mild purification conditions not only tagged recombinant protein itself canbe purified but also natural non-covalently bound ligands can be co-purified and characterized. This has been demonstrated for several proteins. One of the most spectacular examples was the purification of a tagged recombinant antibody FV frag-ment complexed with P. denitrificans cytochrome c oxidase. The complex, consistingof 6 proteins (4 of them being derived from the oxidase which is an integral membraneprotein), was purified in a single step in the presence of mild detergents keeping themembrane protein solubilized and intact.In other cases where such a copurification is not desired, more stringent conditions canbe applied; for example up to 1 M NaCl, detergents (0.1% v/v Tween 20, Triton X-100, CHAPS, lauryl sarcosine), reducing agents (5 mM mercaptoethanol, DTT), or chelators, such as up to 10 mM EDTA (see Table 1, page 9).

Applications

The Strep-tag protein purification system provides the reliable one-step purification ofproteins suitable for any application, including:

● Structural and functional investigations● Crystallization for determination of 3D structure● Immunization to produce antibodies

Thanks to the mild conditions Strep-tag II recombinant proteins can also be used for:

● Assays involving protein-protein and protein-DNA interactions● Investigating ligand-receptor interactions under physiological conditions● Separating living cells for re-culturing purposes

Strep-Tactin® Resins - Specifications

Three resin versions are available which differ in their properties and applications:Strep-Tactin Sepharose® is preferentially used for purification of Strep-tag II proteinsby gravity flow chromatography; Strep-Tactin MacroPrep® is preferentially used forpurification of Strep-tag proteins by low pressure chromatography, and Strep-Tactin POROS® is preferentially used for purification of Strep-tag proteins by FPLCor HPLC. For further information see Table 2.

Table 2: Specifications of Strep-Tactin Resins

Strep-Tactin Strep-Tactin Strep-TactinSepharose MacroPrep POROS

Gravity flow column Yes Yes NoFPLC No (Yes) YesHPLC No (Yes) YesBinding capacity 50 - 100 nmol/ml 50 - 100 nmol/ml 25 - 50 nmol/mlSupport Sepharose 4B MacroPrep 50 POROS 20Bead structure agarose polymethacrylate polystyreneBead size 45 - 165 µm 50 µm 20 µmExclusion limit 2 x 107 1 x 106 n.d.*Max. linear flow rate 30 cm/h 3000 cm/h n.d.*Recommended linear flow rate max 30 cm/h up to 300 cm/h 300 - 1000 cm/hpH stability 4 - 9 2 - 12 1 - 13

Extreme pH may be used for short cleaning procedures but should be changed to 8.0 for storage

Max. pressure Gravity flow n.d* 170 barForm buffered 50% buffered 50% buffered 50%

suspension suspension suspensionAntimicrobial agent NaN3 NaN3 NaN3

Storage 4 °C, do not freeze 4°C, do not freeze 4 °C, do not freeze* not determined

Tagged FV fragment complexed withcytochrome c oxidase was isolated in asingle step (4 subunit membrane protein)

Reference: Kleymann G, Ostermeier C, Ludwig B, Skerra A,Michel H (1995). Bio/Technology 13, 155-160.Engineered Fv fragments as a tool for the one-step purification of integral multisubunit membrane proteincomplexes.

▼

Left lane, total protein extract; right lane, protein aftersingle-step purification.



1

23

Strep-Tactin® Sepharose®

for the purification of Strep-tag® II proteins by gravity-flow columnchromatography

Strep-Tactin concentration 5 mg/ml sedimented resinBinding capacity > 300 nmol biotin/ml sedimented resin

1 ml sedimented resin is useful for the one-step purification of 50 to 100 nmol recombinant protein (up to 3 mg in case of a 30 KDa protein)

Support Sepharose 4B, 4 % agaroseBead size 45 - 165 µmLinear flow rate gravity flow up to 30 cm/h is recommended for

Strep-tag purificationExclusion limit 2 x 107 DaForm 50 % suspension in 100 mM Tris/HCl pH 8.0,

1 mM EDTA, 0.02 % NaN3

Storage 4 °C, DO NOT FREEZE

For detailed information on the Strep-tag purification system, see page 20.

Strep-Tactin Sepharose provides high binding capacity and minimal non-specificbinding (see Figure on the right). This material can be used for gravity flow or lowpressure column purification. Strep-Tactin Sepharose is available in bulk or pre-packed in 1 ml columns (see page 24) which are also part of our Strep-tag StarterKit (see page 27). Column regeneration is described on pages 20 -21.

product amount cat. no. price Strep-Tactin Sepharose 2 ml 2-1201-001 80.00 3(50 % suspension) 4 ml 2-1201-002 130.00 3

10 ml 2-1201-005 290.00 320 ml 2-1201-010 460.00 3

A 36 kDa enzyme and a mutant, both with C-terminalStrep-tag II, were expressed in the cytoplasm of E. coli.The crude lysate was chromatographically separated onStrep-Tactin Sepharose (5 mg/ml) under gravity flow andphysiological conditions (100 mM Tris-Cl, pH 8.0). Thepurification is documented on a Coomassie stained SDSgel where samples from the crude lysate (lane 1), from theflow through (lane 2), and from the elution with 2.5 mM desthiobiotin (lane 3) had been applied. Thewild type enzyme is shown to be over 99 % pure (lane 3contains 50 µg protein vs 0.5 µg protein per band in themolecular size standard). The mutant - although expressedat low level only - could be obtained at high purity underthe same conditions.

1: Sample of crude lysate after cytosolic expression withpASK-IBA3

2: Sample of flow through during chromatography3: Sample after the addition of 2.5 mM desthiobiotinM: Molecular size standard (kDa)

- 97.4

- 45.0

- 31.0

- 66.2

- 21.5

- 14.4

Wild type

Pure Strep-tag proteins

Mutant

kDa1 2 3 1 2 M3

In one step: over 99% purity and highpurification factors



24

Ready-to-use Strep-Tactin®

Sepharose® Columnfor the direct purification of Strep-tag® II proteins by gravity-flow

Strep-Tactin 5 mg/ml sedimented resinBinding capacity > 300 nmol biotin per ml sedimented resin;

appropriate for the one-step purification of 50 to 100 nmol recombinant protein (up to 3 mg in caseof a 30 kD protein)

Bed-volume 1 mlSupport Sepharose 4B, 4 % agaroseBead size 45 - 165 µmLinear flow rate Gravity flowExclusion limit 2 x 107 DaColumn re-use > 10 timesForm Prepacked column, overlayed with 100 mM

Tris/HCl pH 8.0, 1 mM EDTA, 0.02 % NaN3



Strep-Tactin Sepharose provides high binding capacity and minimal non-specificbinding (see page 23). Ready-to-use columns can not run dry, allowing a step-by-step purification procedure without the need for further equipment. Simply add thecell extract, washing buffer and elution buffer and collect the eluate in 0.5 ml fractions. After purification, columns are regenerated with a yellow, 1 mM HABA(hydroxyazophenyl benzoic acid) containing buffer. The regeneration process onthe column can be followed visually by color change from yellow to red. Prior tothe next run the dye is washed off with fast kinetics by equilibration buffer (seepage 21).

product amount cat. no. price Ready-to-use Strep-Tactin 1 column 2-1202-001 130.00 3Sepharose column 2 columns 2-1202-002 230.00 3(1 ml, 5 mg/ml) 5 columns 2-1202-005 450.00 3

Säule S1

Ready-to-use column with Strep-Tactin Sepharose

Coming soon:Strep-Tactin Spin

ColumnsDetails at www.iba-go.de



1

25

Strep-Tactin® MacroPrep®

for purification of Strep-tag® II proteins by low pressure chromatography stations

Binding capacity 1 ml sedimented resin (corresponds to 2 ml of a 50 % suspension) can be used for the one-step purification of 50 to 100 nmol recombinant protein

Support MacroPrep® 50Bead size 50 µmLinear flow rate Up to 300 cm/h can be used for Strep-tag

purificationForm 50 % suspension in 100 mM Tris/HCl pH 8.0,

1mM EDTA, 0.02 % NaN3



Strep-Tactin MacroPrep closes the gap between soft gels for gravity flow purification(Sepharose, see pages 22-24) and pressure resistant media for high performanceliquid chromatography (POROS, see pages 22+26). It is the material of choice forall low pressure chromatography applications. The MacroPrep resin exhibits non-specific binding properties differing from those of Sepharose® and thus can alsobe recommended in cases where unsatisfactory results are obtained with Sepha-rose and vice versa (see Figure on the right).

product amount cat. no. price Strep-Tactin MacroPrep 2 ml 2-1505-001 90.00 3(50 % suspension) 4 ml 2-1505-002 150.00 3

10 ml 2-1505-005 320.00 320 ml 2-1505-010 510.00 3

Ready-to-use Strep-Tactin 1 column 2-1506-001 140.00 3MacroPrep column 2 columns 2-1506-002 250.00 3(1 ml bed volume) 5 columns 2-1506-005 480.00 3

The Coomassie stained SDS gel shows the purification ofa recombinant protein which exhibits exceptionally highnon-specific protein binding. In this case, we have beenable to remove the contaminants nearly quantitativelyusing the Strep-Tactin MacroPrep resin while the contami-nants co-eluted with the recombinant protein after thesame purification protocol using the Strep-Tactin Sepharoseresin. (Please note, that normally behaving recombinantproteins can be purified in a single step to homogeneityusing Strep-Tactin Sepharose; see page 23). This exam-ple shows that it may be reasonable to change the resinif non-specific protein binding occurs.Lane 1, molecular weight standard (kDa); lane 2, Strep-Tactin MacroPrep purified protein sample;lane 3, Strep-Tactin Sepharose purified protein sample;lane 4, soluble raw lysate as applied on each column.

For some recombinant proteins, puri-fication characteristics on Strep-TactinMarcoPrep differ from those on Strep-Tactin Sepharose

Strep-Tactin MacroPrep

kDa

116.0

66.2

45.0

35.0

25.0

18.4

14.4

1 2 3 4

Strep-Tactin Sepharose

raw lysate

purified protein

The green fluorescent protein (GFP) with C-terminal Strep-tag II was expressed in the cytoplasm of E. coli. After sterile filtration the crude lysate was separated viaPerfusion Chromatography® on StrepTactin POROS (5mg/ml) under physiological conditions (100 mM Tris-ClpH 8.0, 1 mM EDTA). Elution was performed by theaddition of 5 mM desthiobiotin in the same buffer andchromatography was monitored by measuring the absorbance of the eluate at 280 nm.



26

Strep-Tactin® POROS®

for purification of Strep-tag® proteins by FPLC or HPLC

Binding capacity > 300 nmol biotin/ml sedimented medium;1.7 ml column can be used for the one-step purification of 40 to 80 nmol recombinant protein

Support POROS 20Bead size 20 µmLinear flow rate 300 - 1000 cm/h is possible for Strep-tag

purificationForm 50 % suspension in 100 mM Tris/HCl pH 8.0,

1mM EDTA, 0.02 % NaN3



Strep-Tactin POROS optimally combines high flow rates with selective binding andhigh dynamic capacity (see figures on the left). This material can be used for FPLCor HPLC applications. Strep-Tactin POROS is available in bulk or prepacked in a1.7 ml column.

product amount cat. no. priceStrep-Tactin POROS 2 ml 2-1203-001 150.00 3(50 % suspension) 4 ml 2-1203-002 260.00 3

10 ml 2-1203-005 490.00 320 ml 2-1203-010 870.00 3

Ready-to-use 1 columnStrep-Tactin POROS (bed volume 2-1203-017 820.00 3column = 1.7 ml)

minutes0 1 2 3 4 5 6 7 8

5 mM desthiobiotin

1.0 -

0.8 -

0.6 -

0.4 -

0.2 -

0.0 -

A280

Semi-preparative purification withinminutes

Säule 11

Pre-packed column with Strep-Tactin POROS and accessories.

crude protein lysate

after Strep-TactinPOROS column

GFP

GFP

The purification is documented on a coomassie stainedSDS gel where samples from the crude lysate (lane 1) andfrom the elution peak at 6.7 minutes (lane 2) had beenapplied. 3 mg GFP could be obtained in one step whenrunning a 1.7 ml column on a BioCAD® work-station.



1

27

Strep-tag® Starter KitComplete system for expression, purification and detection

Content (for 8 applications):

● 1 ready-to-use column with Strep-Tactin Sepharose® (see page 24)● Control plasmid with 15 kD protein insert● Anhydrotetracycline for induction of expression ● Fractionation buffer for the preparation of a periplasmic extract● Washing buffer for column chromatography or for the preparation of a

cytoplasmic extract● Elution buffer for displacing the Strep-tag protein from the column● Column regeneration buffer● Strep-Tactin alkaline phosphatase conjugate for Western blot detection

(see page 30)● Sequencing primers to verify cloning● Comprehensive manual


This kit includes the complete set of reagents essential for the expression, purificationand detection of Strep-tag proteins. The expression vector of choice has to bepurchased separately (see pages 15-19). For applications and specifications ofthe column as well as its regeneration see pages 20-24.

product quantity cat. no. priceStrep-tag Starter Kit 1 Kit 2-1101-000 190.00 3Forward sequencing primer for 1nmol, 10 pmol/µl 5-0000-101 20.00 3pASK-IBA vectors HPLC purified5’-AGAGTTATTTTACCACTCCCT-3’Reverse sequencing primer for 1 nmol, 10 pmol/µl 5-0000-102 20.00 3pASK-IBA vectors HPLC purified5’- GACGCAGTAGCGGTAAACG-3’Forward and reverse sequencing 1 nmol each 5-0000-103 35.00 3primers for pASK-IBA vectors 10 pmol/µl

HPLC purifiedD-Desthiobiotin 0.107 g 2-1000-001 30.00 3

for 200 ml 2.5 mM bufferD-Desthiobiotin 25 ml 2-1000-025 38.50 3solution 10 x buffer for 250 ml 1 x bufferStrep-tag protein purification 100 ml buffer W, 2-1002-000 70.00 3buffer set (W=washing)(10 x concentrated buffer) 100 ml buffer R

(R=regeneration)25 ml buffer E

(E=elution)Strep-Tactin regeneration buffer 100 ml buffer R 2-1002-100 25.00 3(with HABA= 4-Hydroxyazo- (R=regeneration)benzene-2-carboxylic acid)(10 x concentrated buffer)Anhydrotetracycline 50 mg (for 2-0401-001 110.00 3(inducer) 250 liter E.coli culture)

Anhydrotetracycline 25 mg 2-0401-002 55.00 3

Strep-tag Starter Kit

50 % discount on avector of choice

with the purchase of a Starter Kit

Ready-to-use cycle sequencingprimers for 50 reactions

order information for vectors see page 19

Starter Kit

▼



28

Strep-tag® Detection SystemHighly selective, fast and sensitive


● Versatile detection of N-terminal, C-terminal or internal Strep-tag II ● Selective detection via labeled Strep-Tactin® or polyclonal antibodies (rabbit)● Reagents suitable for use in Western blot, ELISA, electron microscopy and

fluorescence microscopy ● Strep-Tactin conjugates for fast protocols ● Strep-tag II polyclonal antiserum for high sensitivity

Application ST-HRP ST-AP Polyclonal ASDot blot + (5 ng/dot) + (0.5 ng/dot) +Western blot + (5 ng/band) + (2 ng/band) +ELISA + + +EM - - +FM - - +Where determined, sensitivity data are denoted in parantheses.EM, FM, ST, HRP, AP, AS denote electron microscopy, fluorescence microscopy, Strep-Tactin, horse radish peroxidase, alkaline phosphatase, antiserum (rabbit), respectively.


The Strep-tag detection system is based on labeled Strep-Tactin which can bedetected directly, or on non-labeled antibodies which must be detected by asecondary antibody that carries the label. Highly selective and fast detection ispossible with the Strep-Tactin reagents whereas antibody-based detection enableshigher sensitivity. IBA offers detection kits which include all buffers and reagents(see pages 29+30).

Procedure

Current procedures for equivalent systems based on streptavidin or antibodies can beused. A specific advantage over streptavidin/biotin systems is that the Strep-tag is notrecognized by avidin. This enables the specific blocking of all biotinylated proteins inthe sample by avidin and the detection of the Strep-tag fusion protein only (see Westernblot on the left). Our kits include optimized buffers, reagents and protocols for Strep-tagdetection on Western blots.

Applications

The Strep-tag protein detection system provides a means for a broad variety ofassays, including:

● Colony blot, dot blot, Western blot and ELISA procedures● Screening for positive expression clones● Monitoring expression levels and stability of Strep-tag proteins● Immunocytochemistry and immunohistochemistry● Protein localization and targeting studies

+VV97.tif+VV97b.tif

Azubl.tif

Western blot detection of the azurin/Strep-tag II fusionprotein with Strep-Tactin-HRP conjugate. Azurin with a C-terminal Strep-tag II was produced at 30 °C using theplasmid pASK-IBA2, and the cytosolic E. coli extract wasprepared via sonication. 4 µl of this extract (lane 1),together with 2 µg purified azurin/Strep-tag II (lane 2)and a biotinylated molecular size standard (Sigma, laneM; kDa) were separated by 15 % SDS-PAGE. Proteinswere transferred to nitrocellulose and, after blocking over-night, the membranes were incubated with Strep-Tactin/HRP conjugate in the presence or absence of avidin. Theaddition of egg-white avidin almost eliminated the signalresulting from the biotin carboxyl carrier protein at 22.5kDa. The signals resulting from Strep-tag II displayed bythe mature azurin (15 kDa) or some of its preprotein (17 kDa), with the OmpA signal sequence still attached,remained unchanged.

Fluorescence microscopy: CV1 cells were transfectedwith a recombinant Vaccinia virus expressing a viralStrep-tag protein. The protein is not entering the nucleusand is only present in the cytoplasm. To detect the Strep-tag protein the Strep-tag II polyclonal antiserum and aTexas Red labeled secondary anti-rabbit antibody wereused.Photos kindly provided by M. Wagner, Max vonPettenkofer Institut, Lehrstuhl Virologie, Genzentrum derLMU München.

kDa M 1 2 1 2

- Avidin + Avidin

205.097.4

58.1

39.8

29.0

20.1

14.3

6.5



1

29

Strep-tag® II polyclonal antiserum

for a very sensitive detection of Step-tag II proteins

Host animal Rabbit Specificity Strep-tag IIDetection N- or C-terminal or internal Strep-tag II Sensitivity in dot blots < 0.5 ng/spot using a HRP-labeled goat anti-rabbit

immunoglobulin (DAKO)Sensitivity in Western blots n.d.Cross reactivity None for E. coli or mammalian cell extractsForm Stabilized serum, can be diluted 1:2000 for

Western blotting and 1:4000 for ELISAStability 1 yearStorage -20°C

product amount cat. no. priceStrep-tag II polyclonal antiserum 0.5 ml 2-1504-001 150.00 3

Strep-Tactin® HRP conjugate

for a fast detection of Strep-tag II proteins by Western blot or ELISA

Detection N- or C-terminal or internal Strep-tag IISensitivity in dot blots 5 ng/dotSensitivity in Western blots 5 ng/bandCross reactivity Reacts with biotin carboxyl carrier protein

(22.5 kDa) in E. coli extracts. Generally, biotinylatedproteins can be sufficiently masked by a 10 minute preincubation with 2 µg/ml avidin.

Form Suspended in 0.01 M phospate buffered saline pH 7.4 containing BSA and 0.01 % Thimerosal as preservative. Can be diluted 1:10,000 for detection of Strep-tag II fusion proteins bound to microplates or 1:4,000 for detection of Step-tag II fusion proteins after Western blotting.

Stability 1 yearStorage 4 °C

Strep-tag® HRP Detection Kit

The Strep-tag HRP Detection Kit is used to detect Strep-tag II fusion proteins transferred to a blotting membrane. The ready-to-use system includes all buffersand reagents required for blocking, washing and the chromogenic reaction on atotal of 1000 cm2 membrane. Please note that the Strep-Tactin HRP (horse radishperoxidase) conjugate included in the kit is also available separately.

product amount cat. no. price Strep-Tactin HRP conjugate 0.5 ml 2-1502-001 100.00 3Strep-tag HRP Detection Kit 1 kit 2-1502-000 220.00 3

The recombinant Strep-tag II proteins GFP (Green Fluores-cent Protein) and E. coli alkaline phosphatase were indi-rectly detected in a whole cell extract using the Strep-tag IIpolyclonal antiserum and a secondary peroxidase labeledanti-rabbit antibody.

The Strep-tag HRP Detection Kit

Direct detection of recombinant Strep-tag II GFP (GreenFluorescent Protein) in a Western blot using Strep-TactinHRP conjugate.

Direct detection of the recombinant Strep-tag II proteinsGFP and E. coli alkaline phosphatase in a dot blot usingStrep-Tactin HRP conjugate.

AP

GFP

GFP

AP

500 100 50 20 10 5 2 1 0.5

ng/spot

1000 500 100 75 50 20 10 5 2 1

ng/lane



30

Strep-Tactin® AP conjugate

for a fast detection of Strep-tag II proteins by Western blot

Alkaline Phosphatase Calf intestineDetection N- or C-terminal or internal Strep-tag IISensitivity in dot blots 0.5 ng/dotSensitivity in Western blots 2 ng/bandCross reactivity Reacts with biotin carboxyl carrier protein

(22.5 kDa) in E. coli extracts. Generally, biotinylated proteins can be sufficiently masked bya 10 minute preincubation with 2 µg/ml avidin.

Form Suspended in 0.01 M phospate buffered saline pH 7.4 containing BSA and 0.01 % Thimerosal as preservative. Can be diluted 1:4,000 for detectionof Strep-tag II fusion proteins after Western blotting. (Please note that for ELISA we recommend to use the Strep-Tactin HRP conjugate mentioned on page 29).

Stability 1 yearStorage 4 °C

Strep-tag® AP Detection Kit

The Strep-tag AP Detection Kit is used to detect Strep-tag fusion proteins transferredto a blotting membrane. The ready-to-use system includes all buffers and reagentsrequired for blocking, washing and the chromogenic reaction on a total of 1000 cm2 membrane. Please note, that the Strep-Tactin AP (alkaline phosphatase) conjugate included in the kit is also available separately.

product amount cat. no. priceStrep-Tactin AP conjugate 0.5 ml 2-1503-001 100.00 3Strep-tag AP Detection Kit 1 kit 2-1503-000 220.00 3

Direct detection of recombinant Strep-tag II GFP (GreenFluorescent Protein) in a Western blot using Strep-TactinAP conjugate.

The Strep-tag AP Detection Kit

Direct detection of the recombinant Strep-tag II proteinsGFP and E. coli alkaline phosphatase in a dot blot usingStrep-Tactin AP conjugate.

GFP

AP

500 100 50 20 10 5 2 1 0.5

1000 500 100 75 50 20 10 5 2 1

ng/spot

ng/lane



1

31

Strep-tag® Assay System

Strep-Tactin® Coated Microplates

Fast, selective and sensitive assay for 8 to 96 samples

Ready-to-use Strep-Tactin coated 8-well strips provide the power of our Strep-tagsystem in a solid-phase, multi-well format for convenient assays and high throughputscreenings of biomolecules tagged with Strep-tag II. The strips are supplied framed insets of 12, resulting in a 96-well configuration compatible with standard multichannelpipettes and automated plate washers and plate readers.


● Oriented immobilization of recombinant proteins with N-terminal, C-terminal orinternal Strep-tag II

● Effective screening procedures ● Minimal non-specific binding● High and constant activity● Minimal coefficients of variation (cv)


The Strep-tag assay system uses 8-well strips coated with Strep-Tactin, allowingStrep-tag fusion proteins to be selectively captured from complex mixtures of mole-cules. The biomolecules are presented to interacting partners in a uniform mannerwhich results in reliable and reproducible assay formats.

Procedure

Strep-Tactin coated microplates (12 x 8-well strips) are offered freeze dried andready-to-use. Solutions containing the Strep-tag II fusion protein can be appliedwithout any prior wetting step.

Applications

● Antibody or serum screening (see Figure on page 32, top)● Diagnostic assays● Expression cloning● Protein interaction studies● Screening of engineered enzymes● Drug screening

Platte D (oder H)

Microplate consisting of twelve 8-well strips coated withStrep-Tactin.

Determination of an alkaline phosphatase (AP)/Strep-tag II fusion protein

General conditions1. Strep-Tactin coated microplate was incubated with

different amounts of recombinant E. coli alkaline phosphatase/Strep-tag II fusion protein.

2. Washing cycles.3. Colorimetric determination of bound AP-activity.

High stability of interaction

2.0

0

2 4 6 8 104

0.5

AP (µg/well)

OD

uni

ts

1.0

21

washing cycles

Low intra-assay variance (after 3 washing cycles)

initial conc. 10 pmol/wellcv = 1.56%

initial conc. 5 pmol/wellcv = 1.35%



32

Specifications

Strep-tag® fusion protein binding capacity 100 ng Strep-tag II fusion protein Intra- and inter-assay variance (cv) < 1.6% and < 3.0%,

respectivelyMax. volume per well 300 µlOptimal pH 8.0Stability > 1 year at 4 °CRecommended storage 4 °C

product amount cat. no. price Strep-Tactin coated microplates 1 plate 2-1501-001 40.00 3(12 x 8 wells) 5 plates 2-1501-005 160.00 3

Strep-Tactin®

Not conjugated to support or enzyme

Form Lyophilized powder from a 20 mg/ml solution in 10 mM potassium phosphate pH 6.5

Binding capacity > 60 nmol biotin per mg proteinExtinction coefficient per subunit ε280 = 35600 M-1cm-1

MW per subunit 13342 DaProteolytic activity Not detectableStorage (lyophilized) - 20 °CReconstitution Can be dissolved in water Storage (dissolved) 4 °C; for longer storage in dissolved form

add 1 mM EDTA and/or 0.02 % NaN3 or filter sterilize.

For detailed information on Strep-Tactin, see pages 9, 10 and 20.

product amount cat. no. priceStrep-Tactin 1 mg 2-1204-001 40.00 3

2 mg 2-1204-002 60.00 35 mg 2-1204-005 120.00 3

10 mg 2-1204-010 200.00 3100 mg 2-1204-100 1800.00 3

Specific determination of H. pylori infection

Human anti H. pylori

posit

ive

seru

m

nega

tive

seru

m

2.5-

2.0-

1.5-

1.0-

0.5-

0-

OD

450

units

SDS gel showing the excellent purity of our Strep-Tactinpreparations. Lane 1, molecular size standard; lane 2, Strep-Tactin monomer (boiled prior to electrophoresis),lane 3, Strep-Tactin tetramer (not boiled).

General conditions1. Strep-Tactin coated microplate was incubated with

recombinant H. pylori urease/Strep-tag II fusion protein, followed by 3 washing cycles.

2. Second incubation with human sera followed by 3 washing cycles.

3. Third incubation with rabbit anti-human lgG conjugated to peroxidase, followed by 3 washing cycles.

4. Colorimetric determination of bound peroxidaseactivity.

kDa

Strep-Tactin(tetramer)

Strep-Tactin(monomer)

1 2 3

Coming soon:Strep-Tactin® coated

magnetic beads

H. pylori urease as antigen in a solid phase immunoassay

Details at www.iba-go.de



1

33

Strep-tag® Custom ServiceProduction of Strep-tag proteins in E. coli and insect cells

A unique service involving IBA's proprietary Strep-tag technology

As IBA holds all intellectual property rights for Strep-tag we can provide exclusiveapplication services using this technology and sublicense such to our customers ifrequired. We offer a comprehensive service from genes to recombinant Strep-tagfusion proteins comprising:

● Complete cloning service including control sequencing● Expression in E. coli or insect cells (Baculovirus)● Purification of the recombinant fusion proteins via Strep-tag● Generation of the authentic protein by proteolytic digest and purification

Outsourcing - fast and cost-effective

Because of the complexity of the technology, expression cloning and protein purification can be expensive and difficult to set up in-house. Such a project requires a number of critical techniques to be executed at a high level for successfulcompletion. Therefore, outsourcing is an attractive proposition for rapid and cost-effective biological discoveries.

Quality service and communication

IBA is a competent research partner and one of the foremost providers of expressioncloning and protein purification technology. We are committed to providing flexible, timely, and quality service. Our contract services can be customizedaccording to your needs.Typically, we complete a project from subcloning to delivery of a full-scale batchof purified protein in 1-2 months. We start working on new projects immediatelyafter receiving materials. Communication with our clients is a priority. Therefore, we take a collaborativeapproach in establishing effective working relationships with key client represen-tatives.

Requirements ● The complete gene sequence of interest in electronically readable form or its

“Genbank“ accession number.● A suitable cDNA library (in case of eukaryotic genes) or● A culture of the corresponding organism, viable or sterilized in 70 % ethanol

(in case of prokaryotic genes).

Vectors with cloned genes are also welcome.In addition, any information concerning the biochemistry of the protein of interestwould be helpful for planning a suitable expression strategy. Custom service in IBA's laboratories.

▼▼

NEW! Source it out!



34

CloningThis service comprises the precise cloning of the desired gene in IBA's proprietarybacterial expression vectors with optimal control of expression (tet promoter). Thenatural gene is modified by appending the Strep-tag II peptide to either the N-orthe C-terminus. If desired, a protease recognition site can also be introducedwhich allows us to generate an authentic protein.

Steps performed:

● Consulting● Planning of the cloning strategy● Primer synthesis● PCR with proof-reading DNA-polymerase● Purification of the PCR product● Cleavage of the PCR product and subcloning into the appropriate vector● Screening for positive clones● Control sequencing

This work is performed until a clone is isolated encoding the desired polypeptide,or until 2 clones from 2 independent PCRs yielded the same sequence.

product cat. no. priceCloning in Basic costs 2-2000-001 2500.00 3E. coli expression Additional costs depending on 2-2000-002 0.55 3plasmids gene length per baseCloning in Basic costs 2-2000-003 2500.00 3Baculovirus Additional costs depending on 2-2000-004 0.55 3expression plasmids gene length per baseBasic fee (cloning) This fee is only charged to cover our 2-2001-000 600.00 3

expenses, if the PCR attempts were not successful.

Cloning is planned in close consultation with the client. For example, we can introduce specific base modifications (such as the introduction of restriction sites)into the termini of the gene via the PCR cloning step.

20 µg of the expression plasmid and a 3.5'' diskette with the corresponding vector sequence are supplied. The original printouts of the control sequencing ofthe gene insert can be provided on request. IBA does not guarantee that the encodedgene will be expressed.

If for any reason a successful PCR product cannot be obtained from a template provided by the customer and/or the sequence information, the customer pays the“basic fee (cloning)“ only.

Baculovirus

▼


Eco31I/ Bsal

Eco31I/ Bsal

Xbal HindIII

tlpp

Ncol EcoRlSstlKpnlSmalBamHIXholSallPstlNcol

tet p/o

ori

f1

Amp R

tet-repressor

pASK-IBA2 3286 bp

Map of one pASK-IBA vector. More vector descriptionson pages 15-19.

NEW



1

35

Expression and Strep-tag®

purificationSteps performed:

E. coli● Culture of E. coli in the appropriate scale and induction of protein expression● Cell harvesting and lysate preparation● Optimization of expression and purification if required; see also general

procedure (page 36)● Strep-Tactin affinity purification in the desired scale

product amount delivered cat. no. price

Expression 100 µg protein 2-2100-001 1400.00 3and protein purification Expression plasmid, 2-2100-002 1400.00 3in E. coli E. coli strain, production protocol for the- 100 µg scale - 100 µg scale (only available in

combination with 2-2100-001)Each additional 100 µg 2-2100-003 260.00 3(only available in combination with2-2100-001)

Expression and 1 mg protein 2-2100-004 3100.00 3protein production Expression plasmid, E. coli strain, 2-2100-005 3100.00 3in E. coli production protocol for the 1 mg scale- 1 mg scale - (only available in combination with

2-2100-004)Each additional 1 mg (only available in 2-2100-006 1100.00 3combination with 2-2100-004)

Expression and 10 mg protein 2-2100-007 10000.00 3protein purification Expression plasmid, E. coli strain, 2-2100-008 5100.00 3in E. coli production protocol for the 10 mg scale- 10 mg scale - (only available in combination with

2-2100-007)Each additional 10 mg protein 2-2100-009 4100.00 3(only available in combination with 2-2100-007)

Basic fee This fee is only charged to cover our 2-2001-001 800.00 3E. coli expression expenses, if the expression attempts are

not successful (see cases A to D on pages 36-37)

Insect cellsDetails on the generation of the recombinant virus stock (cat. no. 2-2200-001)

● Co-transfection of Sf insect cells with transfer vector DNA and linear Baculovirus DNA● Plaque purification of 6 recombinant viruses from co-transfection supernatant● Infection of 3 x 106 Sf cells with each recombinant virus and preparation

of initial virus stock● Infection of3x106Sf cells with initial virus stock to generate supernatant and cell pellet● SDS-PAGE and Western blot analysis of all insect cell supernatants or cell lysates by

Strep-tag detection or by an antibody provided by the customer (if available)● If the result is negative at this stage, the customer has now the possibility to decide

whether the project will be continued● Infection of 0.75 x 108 insect cells with a most positive recombinant virus

(100 ml viral stock production)

product amount delivered cat. no. priceExpression and Generation of the recombinant virus; 2-2200-001 5200.00 3protein purification (see above)in insect cells (Baculovirus) Infection of 0.75 x 109 insect cells 2-2200-002 900.00 3

(1000 ml) with the positive recombinantvirus (only available in combinationwith 2-2200-001)Preparation of cell extract from 1 l cell 2-2200-003 2600.00 3culture and protein purification (only available in combination with 2-2200-001 and 2-2200-002)100 ml high titer viral stock from a 2-2200-004 5200.00 3detected positive virus plaque withestimated titer by plaque assay(only available in combinationwith 2-2200-001)

Basic fee This fee is only charged to cover our 2-2001-002 800.00 3insect cell expression expenses, if the purification attempts

(2-2200-003) are not successful

Baculovirus▼ NEW



36

Proteolytic trimming to generate anauthentic proteinSteps required:1. Buffer change for proteolytic digest and desthiobiotin removal2. Optimization of reaction conditions3. Separation of product from non-cleaved fusion protein, cleaved Strep-tag® II

and protease

product amount delivered cat. no. priceProteolytic trimming 100 µg protein 2-2300-001 470.00 3of recombinant Each additional 100 µg 2-2300-002 260.00 3proteins (only available in combination

with 2-2300-001)1 mg protein 2-2300-003 1300.00 3Each additional 1 mg 2-2300-004 770.00 3(only available in combination with 2-2300-003)10 mg protein 2-2300-005 4100.00 3Each additional 10 mg 2-2300-006 2300.00 3(only available in combination with 2-2300-005)

General procedure for expression and Strep-tag® purification service

After PCR cloning, one sequenced clone is subjected to a standard expression pro-cedure. The prepared lysate is then subjected to a standard Strep-Tactin®

affinity chromatography. A small amount of the purified material with the expectedmolecular weight is checked in terms of purity (IBA) and bioactivity (client).Depending on these results, the client decides whether to proceed further. The following cases are possible:

Case A: Recombinant protein is active and pure

● Expression is optimized and the ordered quantity is purified.● The purified protein as eluted from the Strep-Tactin affinity column is supplied.

Original printouts of the control sequencing are available on request. Please note that plasmid DNA or clone are not included.

● An aliquot of the plasmid DNA can also be ordered (10 µg). However, this option incurs an additional fee as indicated under the prices listed on the previouspage for the different scales. Following this option, the client receives IBA's pro-duction protocol for the desired scale and the appropriate E. coli host strain.

● If larger scales than 100 µg protein have been ordered, but we are not successfulin producing this quantity of protein, the client receives 100 µg of the purified recombinant protein. The charges are as indicated above (2500.00 3 + 0.55 3per base + 1400.00 3). Additionally, 10 µg of the expression plasmid are delivered at no further costs. For your reference, the original printouts of the control sequencing reaction are provided on request.

Case B: Recombinant protein is pure but inactive

● We attempt to optimize the expression and/or purification assay. If we succeed insolving the problem, the procedure continues as described for Case A.

● If we do not succeed in solving the problem, the client receives the original printouts of the insert sequencing and a scan of a SDS gel documenting the production of the recombinant protein. The client does neither receive plasmidDNA nor clone. Charges are limited to cloning costs (including 0.55 3 per base) plus a fee of 800.00 3 for our expression attempts.



1

37

Case C: Recombinant protein is active but does notmeet our purity standards (> 90%)

● We attempt to optimize the purification step. If we succeed in solving theproblem, the procedure continues as described for Case A.

● In rare cases, however, it might be possible, that we do not succeed in solving the problem even after optimization. If it is certain that the contaminationsare Strep-tag® carrying fragments of the recombinant protein resulting from internal initiation of translation or from premature termination of translation orfrom proteolytic cleavage, the client chooses from the following two options:1. The grade of purity is accepted by the client. IBA performs the service in

accordance with case A, and a price reduction of up to 10 % is agreed upon.● 2. The grade of purity is not accepted by the client. Then the client receives the

original printouts of insert sequencing and a scan of a SDS-gel documenting the production of the recombinant protein. The client does not receive plas-mid DNA. Charges are limited to cloning costs (including 0.55 3 per base)plus a fee of 800.00 3 for our expression attempts.

Case D: Recombinant protein cannot be expressed

If the protein cannot be expressed after IBA has tried its general set of parametersfor modulation of expression, charges are limited to cloning costs (including 0.55 3per base) plus a fee of 800.00 3 for our expression attempts. The plasmid DNAwill be shipped at no further charge.

Other conditions

Protein concentrations are determined using the theoretic extinction coefficient at280 nm of the recombinant protein, which is determined by the addition of theextinction coefficients of the tryptophane and tyrosine residues included in therecombinant protein or by a colorimetric assay according to Bradford, with BSAas reference protein.IBA is not obliged to accept orders.Shipping costs are charged separately.



38

Additional Custom Services

N-terminal sequencing

Guidance● 5 residues (degradation steps) to determine a cleavage site in a known protein● 5 -10 residues to confirm the identity of an isolated known protein● 10 -20 residues to design oligonucleotide probes● 15 or more residues to identify an unknown protein

product details cat. no. priceN-terminal sequencing Degradation steps 1-5 2-2401-001 350.00 3(see note 1) (includes sample

application, automatic Edman degradation and amino acid identification/verification)Each subsequent 2-2401-002 50.00 3degradation step (includes automatic Edman degradation and amino acid identification/verification)

Sample preparation for Chemical or enzymatic 2-2401-003 150.00 3N-terminal sequencing cleavage in solution(if required) Proteolytic cleavage in gel or on 2-2401-004 200.00 3

membrane (includes sample pretreatment, proteolytic digestion, extraction of peptide fragments from gel or membrane)Fractionation of peptides by 2-2401-005 250.00 3HPLC (includes sample concentration, separation by reverse phase HPLC and collection of fractionated peptides)

Identification of a protein Complete N-terminal protein 2-2401-006 990.00 3(see note 2) sequencing service: protein

cleavage , peptide fractionation by HPLC, N-terminal sequence analysis of 15 amino acids, database analysis

Basic fee Fee is charged if insufficient 2-2001-003 250.00 3Identification of a protein sample is delivered to enable

N-terminal sequencing

Material provided by the customer● in solution: sample should be delivered preferably in water or in a buffer of low

salt concentration, but not in Tris or other amino-containing buffers; please indicate the components of the buffer and protein concentration.

● immobilized: sample should be blotted onto a PVDF membrane (max. 3 cm2;please DO NOT use nitrocellulose); Coomassie Brilliant Blue staining is allowed, but not silver staining.

All samples should contain at least 10 pmol of a pure protein preparation.

Material delivered by IBAThe results will be presented in the form of a one- or three-lettered amino acidsequence, beginning with the amino-terminal residue.

For large-scale production of recombinant proteins (or nucleic acids) under cGMPor non-cGMP see pages 42-47(IBA Biologics)

▼



1

39

Note 1:The ordered number of degradation steps will still have to be paid if the amino acidscannot be identified, due to either too little protein being delivered, the N-terminusbeing blocked, or the sample being too heterogeneous for unambiguous identification.

Note 2:At least 50 pmol of a pure protein sample are required. An additional service ofprotein separation by SDS-PAGE (see cat. no. 2-2402-003) prior to cleavage ingel and protein identification may be offered on request (this is recommended ifthe sample is not completely homogeneous to prevent problems with protein identification).

Gel electrophoresis, IEF and Western blots

service material delivered by IBA cat. no. price2D gel electrophoresis Stained and dried gel; 2-2402-001 290.00 3

Scan on requestIEF (Isoelectric focussing) Stained and dried IPG-strip; 2-2402-002 110.00 3

native or denaturing conditions(please indicate)

SDS gel electrophoresis Stained and dried gel; 2-2402-003 110.00 3Scan on request

Western blot Stained blot; 2-2402-004 90.00 3Scan on request

Buffer exchange — 2-2402-005 50.00 3

Material provided by the customer

Protein extract (at least 50 µg protein, salt free, in solution, frozen or lyophilized)

Integrity, secrecy and licensing

Our custom service requires the exchange of sensitive data. Therefore, all proprietary information and intellectual property transferred to IBA is kept absolutely confidential and is covered by a secrecy agreement if requested.As a service provider we do not intend to claim any rights on proteins which wemanufacture for our clients as long as the proteins are used for in-house researchpurposes only. A separate license for use of Strep-tag technology is necessary,however, if direct commercialization of ordered proteins is intended. This is alsothe case if clients use Strep-tag technology for the production of recombinant proteins in their own facilities with subsequent commercialization. IBA is authorized and ready to grant licenses for those purposes.



40

Strep-tag® ReferencesA) Articles of general interest

1. Schmidt TGM, Skerra A, 2000: in Alberghina L (Ed.), Protein Engineering in Industrial Biotechnlogy, Harwood Academic Publishers, ISBN: 90-5702-412-8:41-61. Protein Engineering for Affinity Purification: the Strep-tag.

2. Skerra A, Schmidt TGM, 1999: Biomolecular Engineering 16:79-86, Applications of a peptide ligand for streptavidin: the Strep-tag.

3. Müller HN, Schmidt TGM, 2000: in Kastner M (Ed.), Journal of Chromatography Library – volume 61, Protein Liquid Chromatography, Elsevier, ISBN 0 444 50210 6:825-837. Simple and fast one-step purification of recombinant proteins using the unique Strep-tag technology.

4. Schmidt TGM, Koepke J, Frank R, Skerra A, 1996: J Mol Biol 255:753-766. Molecular interaction between the Strep-tag affinity peptide and its cognate target streptavidin.

5. Skerra A, Schmidt TGM, 2000: Meth Enzymol 326 in press. Use of the Strep-tag and streptavidin for recombinant protein purification and detection.

B) Expression

6. Korpela MT, Kurittu JS, Karvinen JT, Karp MT, 1998: Anal Chem 70:4457-4462. A recombinant Escherichia coli sensor strain for the detection of tetracyclines.

7. Müller HN, Skerra A, 1994: Biochemistry 33:14126-14135. Grafting of a high-affinity Zn(II)-binding site onthe ß-barrel of retinol-binding protein results in enhanced folding stability and enables simplified purification.

8. Skerra A, 1994: Gene 151:131-135. Use of the tetracycline promoter for the tightly regulated production of a murine antibody fragment in Escherichia coli.

9. Loferer H, Hammar M, Normark S, 1997: Molecular Microbiology 26:11-23. Availability of the fibre subunit CsgA and the nucleator protein CsgB during assembly of fibronectin-binding curli is limited by the intracellular concentration of the novel lipoprotein CsgG.

10. Skerra A, 1992: Nucleic Acids Research 20:3551-3554. Phosphorothioate Primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity.

11. Smyth N, Odenthal U, Merkl B, Paulsson, M, 2000: Methods Mol Biol139: 49-57. Eukaryotic expression and purification of recombinant extracellular matrix proteins carrying the Strep-tag II.

C) Purification

12. Schmidt TGM, Skerra A, 1993: Prot Engineering 6:109-122. The random peptide library-assisted engineering of a C-terminal affinity peptide, useful for the detection and purification of a functional Ig Fv fragment.

13. Schmidt TGM, Skerra A.: 1994: J Chromatogr A 676:337-345. One-step affinity purification of bacterially produced proteins by means of the "Strep-tag" and immobilized recombinant core streptavidin.

14. Kleymann G, Ostermeier C, Ludwig B, Skerra A, Michel H, 1995: Bio/Technology 13: 155-160. Engineered Fv fragments as a tool for the one-step purification of integral multisubunit membrane protein complexes.

15. Ostermeier C, Essen LO, Michel H, 1995: Proteins 21:74-77. Crystals of an antibody Fv fragment against an integral membrane protein diffracting to 1.28 Å resolution.

16. Müller HN, Skerra A, 1994: Biochemistry 33:14126-14135. Grafting of a high-affinity Zn(II)-binding site onthe ß-barrel of retinol-binding protein results in enhanced folding stability and enables simplified purification.

17. Heller S, Finn TP, Huber J, Nishi R, Geissen M, Püschel AW, Rohrer H, 1995: Development 121:2681-2693. Analysis of function and expression of the chicken GPA receptor (GPARa) suggests multiple roles in neuronal development.

18. Schmidt FS, Skerra A, 1994: Eur J Biochem 219: 855-863. The bilin-binding protein of Pieris brassicae: cDNA sequence and regulation of expression reveal distinct features of this pigment protein.

19. Tsiotis G, Haase W, Engel A, Michel H, 1995: Eur J Biochem 231:823-830. Isolation and structuralcharacterization of trimeric cyanobacterial photosystem I complex with the help of recombinant antibody fragments.

20. Ostermeier C, Iwata S, Ludwig B, Michel H, 1995: Nature Struct Biol 2:842-846. Fv fragment-mediated crystallization of the membrane protein bacterial cytochrome c oxidase.

21. Friedrich T, Weiss H, 1995: Biospektrum 6/1995:24-27. Kristallstruktur der Cytochrom c-Oxidase zweimal gelöst: Arbeitsweise einer redoxgetriebenen Protonenpumpe.

22. Hengsakul M, Cass AEG, 1997: Resonant mirror studies. J Mol Biol 266:621-632. Alkaline phosphatase-Strep-tag fusion protein binding to streptavidin.

23. Murphy JT, Lagarias JC, 1997: Photochem. Photobiol 65:750-758. Purification and characterization of recombinant affinity peptide-tagged oat phytochrome A.

24. Voss S, Skerra A, 1997: Protein Eng 10:975-982. Mutagenesis of a flexible loop in streptavidin leads to higher affinity for the Strep-tag II peptide and improved performance in recombinant protein purification.

25. Loferer H, Hammar M, Normark S, 1997: Molecular Microbiology 26:11-23. Availability of the fibre subunit CsgA and the nucleator protein CsgB during assembly of fibronectin-binding curli is limited by the intracellular concentration of the novel lipoprotein CsgG.

26. Tudyka T, Skerra A, 1997: Protein Sci 6:2180-2187. Glutathione S-transferase can be used as a C-terminal, enzymatically active dimerization module for a recombinant protease inhibitor, and functionally secreted into the periplasm of Escherichia coli.

27. Yeh KC, Wu SH, Murphy JT, Lagarias JC, 1997: Science 277:1505-1508. A cyanobacterial phytochrome two-component light sensory system.

28. Ostermeier C, Harrenga A, Ermler U, Michel H, 1997: Proc Natl Acad Sci USA 94.10547-10553. Structure at 2.7 Å resolution of the Paracoccus denitrificans two-subunit cytochrome c oxidase complexed withan antibody Fv fragment.

29. Gerdes W, Kiem KP, Schmidt TGM, 1998: BIOspektrum 1/98:73-74. Affinitätsreinigung rekombinanter Proteine mittels Strep-tag, Strep-Tactin und HPLC.

30. Maier T, Drapal N, Thanbichler M, Böck A, 1998: Anal Biochem 259:68-73. Strep-tag II affinity purification: an approach to study intermediates of metalloenzyme biosynthesis.

31. Brown JC, Brown BA 2nd, Li Y, Hardin CC, 1998: Biochemistry 37.16338-16348 Construction and characterization of a quadruplex DNA selective single-chain autoantibody from a viable motheaten mouse hybridoma with homology to telomeric DNA binding proteins.

recommended

▼



1

41

32. Koo K, Foegeding PM, Swaisgood HE, 1998: Appl Environ Microbiol 1998 64:2490-2496. Construction and expression of a bifunctional single-chain antibody agains Bacillus cereus spores.

33. Zwicker N, Adelhelm K, Thiericke R, Grabley S, Hanel F, 1999: Biotechniques 27:368-375. Strep-tag II for one-step affinity purification of active bHLHzip domain of human c-Myc.

34. Laber B, Maurer W, Scharf S, Stepusin K, Schmidt FS, 1999: FEBS Lett 449:45-48. Vitamin B6 biosynthesis:formation of pyridoxine 5'-phosphate from 4-(phosphohydroxy)-L-threonine and 1-deoxy-D-xylulose-5-phosphate by PdxA and PdxJ-protein.

35. Beste G, Schmidt FS, Stibora T, Skerra A, 1999: Proc Natl Acad Sci U S A 96:1898-1903. Small antibody-like proteins with prescribed ligand specificities derived from the lipocalin fold.

36. Sardy M, Odenthal U, Karpati S, Paulsson M Smyth N, 1999: Clin Chem 45:2142-2149. Recombinant human tissue transglutaminase ELISA for the diagnosis of gluten sensitive enteropathy. (Expression in mammaliancells and one-step purification of a Strep-tag II fusion protein).

37. Rübenhagen R, Rönsch H, Jung H, Krämer R, Morbach S, 2000: JBC 275:735-741. Osmosensor and osmoregulator properties of the betaine carrier BetP from Corynebacterium glutamicum in proteoliposomes. (Expression and one-step purification of functional membrane transporter protein directly labelled with Strep-tag II).

38. Bungert S, Krafft B, Schlesinger R, Friedrich T, 1999. FEBS Lett 460:207-211. One-step purification of the NADH dehydrogenase fragment of the Echerichia coli complex I by means of Strep-tag affinity chromatography.

39. Müller HN, Skerra A, 1993: J Mol Biol 230:725-732. Functional expression of the uncomplexed serum retinol-binding protein in Escherichia coli.

40. Smyth N, Odenthal U, Merkl B, Paulsson, M, 2000: Methods Mol Biol139: 49-57. Eukaryotic expression and purification of recombinant extracellular matrix proteins carrying the Strep-tag II.

D) Detection

41. Kleymann G, Ostermeier C, Heitmann K, Haase W, Michel H, 1995: The J Histochem and Cytochem 43:607-614. Use of antibody fragments (Fv) in immunochemistry.

42. Kleymann G, Iwata S, Wiesmüller HH, Ludwig B, Michel H, 1995: Eur J Biochem 230:359-363. Immunoelectronic microscopy and epitope mapping with monoclonal antibodies suggests the existence of an additional N-terminal transmembrane helix in the cytochrome b subunit of bacterial ubiquinol:cytochrome-c oxidoreductases.

43. Tsiotis G, Haase W, Engel A, Michel H, 1995: Eur J Biochem 231:823-830. Isolation and structural characterization of trimeric cyanobacterial photosystem I complex with the help of recombinant antibody fragments.

44. Ribrioux S, Kleymann G, Haase W, Heitmann K, Ostermeier C, Michel H, 1996: The J of Histochem and Cytochem 44:207-213. Use of nanogold- and fluorescent-labeled antibody Fv fragments in immunochemistry.

E) Assay

45. Skerra A, Schmidt TGM, 2000: Meth Enzymol in press. Use of the Strep-tag and streptavidin for recombinant protein purification and detection.

46. Panke O, Gumbiowski K, Junge W, Engelbrecht S, 2000: FEBS Letters 472: 34-38. F-ATPase: specific observation of the rotating c subunit oligomer of EF(o)EF(1).

strep-tag the leading affinity tag in recombinant protein...

Documents