stat3/hotair signaling axis regulates hnscc growth in an ...cancer therapy: preclinical stat3/hotair...

Cancer Therapy: Preclinical

STAT3/HOTAIR Signaling Axis Regulates HNSCCGrowth in an EZH2-dependent MannerShanshan Sun1,2, Yansheng Wu1,Wenyu Guo1, Feng Yu3, Lingping Kong4, Yu Ren5,Yu Wang1, Xiaofeng Yao1, Chao Jing1, Chao Zhang6, Mingyang Liu2, Yuqing Zhang2,Minghui Zhao1, Zhaoqing Li1, Chuanqiang Wu1, Yu Qiao1, Jingxuan Yang2,Xudong Wang1, Lun Zhang1, Min Li1,2, and Xuan Zhou1

Abstract

Purpose: PI3K and STAT3 are frequently activated in cancerprogression. However, little is known about the underlyingmechanisms by which PI3K and STAT3 regulate head and necksquamous cell cancer (HNSCC) growth. The lncRNA HOX tran-script antisense RNA (HOTAIR) was found to modulate theprogression of HNSCC. In this study, we attempted to establishthe correlation of PI3K/STAT3/HOTAIR signaling with the pro-gression ofHNSCC and its sensitivity toward platinum-based andtargeted anti-EGFR combination therapy.

ExperimentalDesign:Wefirst analyzed the STAT3/HOTAIRandPI3K/AKT level in human HNSCC samples. We then activated orsuppressed STAT3/HOTAIR and determined the effects onHNSCCcell proliferation in vitroand thegrowthofUM1xenograft tumor, anorthotopic model of HNSCC. The sensitivity of HNSCC cellstoward cisplatin and cetuximab was determined by in vitro assays.

Results: HNSCC samples showed significantly robustexpression/activation of STAT3, HOTAIR, PI3K, and AKT,compared with normal squamous epithelium. STAT3 inhibi-tion with WP1066 decreased HOTAIR level and sensitizedHNSCC to cisplatin or cetuximab. STAT3 promoted HOTAIRtranscription and its interaction with pEZH2-S21, resulting inenhanced growth of HNSCC cells. In addition, overexpressionof HOTAIR promoted the growth of UM1 xenograft tumorsin vivo.

Conclusions: Our results suggest that STAT3 signaling pro-motes HNSCC progression via regulating HOTAIR and pEZH2-S21 in HNSCC with PI3K overexpression/activation. Thesefindings provide a rationale to target the STAT3/HOTAIR/pEZH2-S21 regulatory axis for treating patients with HNSCC.Clin Cancer Res; 24(11); 2665–77. �2018 AACR.

IntroductionHuman head and neck squamous cell carcinoma (HNSCC) is

one of the most prevalent tumors, with approximately 550,000

new cases diagnosed yearly worldwide (1). This disease is char-acterized by high proliferation, regional lymph node metastasis,and poor prognosis (2). The standard treatment for HNSCC is aplatinum-based (platinum, 5-FU, and cetuximab) regimen (3).

The PI3K/AKT/mTOR pathway, downstream of EGFR signal-ing, is the most commonly activated pathway in HNSCC (4)implicated in HNSCC development, progression, and thera-peutic resistance (5–7). A more recent report revealed that thispathway contributes to resistance to anti-EGFR therapy andchemotherapy (8).

Aberrant activation of STAT3 has been well characterized incancer cell proliferation, dedifferentiation, invasion, angiogene-sis, and immune responses in various human cancers (9). Phos-phorylated STAT3 dissociates from the activated tyrosine kinasereceptors and forms a transcriptionally active STAT3-STAT3dimer, which translocates into nuclei and regulates the transcrip-tion of downstream target genes by binding to specific DNAsequences in the promoter of target genes (10). Our previousstudies have demonstrated the involvement of STAT3 in HNSCCcarcinogenesis and the significance of STAT3 as a therapeutictarget for patients with HNSCC (11–13).

There is considerable recent interest in the role of noncodingRNA (ncRNA), especially the long noncoding RNA (lncRNA),during cancer development. With more than 200 nucleotides,lncRNAs have been primarily implicated in transcriptional regu-lation by serving as scaffolds for assembling transcriptional reg-ulators to modulate the activity of transcription factors (9).LncRNA HOX transcript antisense RNA (HOTAIR) is coded bythe homebox C gene (HOXC) locus and exerts diverse functions

1Department ofMaxillofacial andOtorhinolaryngologyOncology, TianjinMedicalUniversity Cancer Institute and Hospital, Key Laboratory of Cancer Preventionand Therapy, Tianjin Cancer Institute, National Clinical Research Center ofCancer, Tianjin, China. 2Department of Medicine, Department of Surgery, TheUniversity of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma.3Tianjin Medical University Cancer Institute and Hospital, Key Laboratory ofCancer Prevention and Therapy, Tianjin Cancer Institute, National ClinicalResearch Center of Cancer, Tianjin, China. 4Department of Medical Oncology,Tianjin Medical University General Hospital, Tianjin, China. 5Research Center ofBasicMedical Sciences, TianjinMedical University, Tianjin, China. 6Department ofGenitourinary Oncology, Tianjin Medical University Cancer Institute & Hospital,Tianjin, China.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

S. Sun, Y. Wu, W. Guo, and F. Yu contributed equally to this article.

Corresponding Authors: Min Li, The University of Oklahoma Health SciencesCenter, 975 NE 10th Street, BRC 1262A, Oklahoma City, OK 73104. Phone: 405-271-1796; Fax: 405-271-1476; E-mail: [email protected]; XuanZhou, Departmentof Maxillofacial and Otorhinolaryngology Oncology, Tianjin Medical UniversityCancer Institute and Hospital, Key Laboratory of Cancer Prevention and Ther-apy, Tianjin Cancer Institute, National Clinical Research Center of Cancer, Tianjin300060, China. Phone: 8622-2334-0123, ext. 3137; E-mail:[email protected]; and Lun Zhang, [email protected]

doi: 10.1158/1078-0432.CCR-16-2248

�2018 American Association for Cancer Research.

ClinicalCancerResearch

www.aacrjournals.org 2665

on August 7, 2020. © 2018 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 14, 2018; DOI: 10.1158/1078-0432.CCR-16-2248

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-16-2248&domain=pdf&date_stamp=2018-5-11

http://clincancerres.aacrjournals.org/

in various malignancies (14, 15). In multiple human cancers,HOTAIR is aberrantly expressed, and it is a potential biomarker forassessing prognosis (16, 17). HOTAIR functions as an oncogeneby recruiting EZH2 to catalyze H3K27 triple-methylation tosuppress downstream tumor suppressor genes. In glioblastoma,HOTAIR regulates cell-cycle progression and invasion by activat-ing the catenin signaling pathway (18). Moreover, HOTAIRpromotes cancer cell invasion by repressing E-cadherin transcrip-tion and inducing epithelial–mesenchymal transition (EMT) inoral squamous cell carcinoma (19). Targeting HOTAIR and EZH2caused mitochondria-related apoptosis and inhibited growth ofHNSCC (20, 21). Importantly, HOTAIR expression level wasassociated with the sensitivity of lung adenocarcinoma cells tocisplatin (22).

Activation of STAT3 reportedly depends on the phosphoryla-tion of EZH2 at Ser21, suggesting a potential interaction of EZH2and STAT3 in cancers. We hypothesized that STAT3 regulatesEZH2 andHOTAIR to impact the growth of HNSCC. The purposeof this study was to demonstrate the connection betweenSTAT3 regulation of EZH2 andHOTAIR in HNSCC. An estimated30% to 40% of HNSCC cases have mutations in the PI3Kpathway, including mutations in PIK3CA, the catalytic subunitof PI3K, which is related to decreased survival and late-stagedisease (4, 23). Our results suggest that HOTAIR and EZH2 aredownstream effectors of STAT3 signaling in HNSCC with PI3Kactivation. These findings provide a rationale for targeting STAT3/EZH2/HOTAIR signaling to treat patients with HNSCC.

Materials and MethodsHNSCC samples and pathologic characterization

A total of 28 HNSCC tumor samples were collected at theDepartment of Maxillofacial and Otorhinolaryngology Onco-logy, Tianjin Medical University Cancer Institute & Hospital(Tianjin, China) from January to December, 2015. IHC stainingwas used to examine STAT3, pSTAT3-705, PI3K, pPI3K, and pAkt-473 levels in all tissue samples. For each HNSCC specimen, IHC-positive cells with respect to subcellular localization, intensity,and distribution were quantified using a visual grading systembased on the extent of staining (percentage of positive cancercells graded on a scale from 0 to 3: 0, �10%; 1, 11%–30%;

2, 31%–60%; or 3, >60%) and the intensity of staining (graded ona scale of 0–3: 0, none; 1,weak staining; 2,moderate staining; or 3,strong staining). The combination of extent (E) and intensity (I)of staining was obtained by the product of E� I, called EI, varyingfrom 0 to 9 for each spot. HOTAIR expression was determined byFISH assay. All slides were blindly and independently evaluatedby two pathologists. In cases of discrepancy, the pathologistsreviewed the slides together to achieve a consensus. All sampleswere collected with informed consent according to the HumanTissue Sample Usage Guidelines of the TianjinMedical UniversityMedical Ethics Committee.

Analysis of TCGA database of HNSCC RNA-seq datasetsWe investigated the pairwise coexpression between STAT3,

PIK3R1, AKT1 and its downstream targets NFKB1, MTOR, BAD,andMDM2 based on the RNA sequencing (RNA-seq) datasets forHNSCC from The Cancer Genome Atlas (TCGA) database. Tran-scriptome read counts of total 508 samples were available for thisanalysis.We transformed read counts of each gene toRPKMvaluesand calculated Pearson correlation coefficients to demonstrategene coexpression. Data manipulation, statistical analysis, andvisualization were accomplished using R 3.0.2.

Cell culture and reagentsHuman HNSCC cell lines SCC25, Cal27, and UM-SCC1 (UM1)

were gifts from Prof. Jinsong Hou (Guanghua School of Stomatol-ogy, Hospital of Stomatology, Sun Yat-sen University, China). TheSCC15 cell linewas purchased fromATCC. The Tscca, Tca8113, andHep-2 cell lines were purchased from the Institute of Basic MedicalSciences, Chinese Academy of Medical Sciences (Beijing, P.R. Chi-na). The Tb3.1 cell line was a gift from the Ninth People's Hospital,Shanghai Jiaotong University (Shanghai, China). All experimentalcell lines were maintained in DMEM/F12 1:1, DMEM, minimumessential medium, or RPMI1640 (Hyclone) media, supplementedwith 10% FBS (Gibco) and 5% CO2 at 37�C in an incubator.

WP1066 (Selleck Chemicals) and DDP (Sigma) were dissolvedin DMSO (Solarbio) for use and storage. IL6 (Sigma) was dis-solved in 0.1% BSA-DMEM for use and storage. Cetuximab(Merck Drugs & Biotechnology) solution was prepared accordingto the manufacturer's protocol. Final working concentrations ofWP1066, cetuximab, andDDPwere 6 mmol/L, 10–20 mg/mL, and0.5 mg/mL, respectively.

RNA extraction and qRT-PCR assaysTotalRNAwasextractedusingTRIzol reagents (Life Technologies)

following the manufacturer's protocol, and was reverse transcribedinto cDNA with the GoScript Reverse Transcription System kit(Promega). qRT-PCR was performed with a GoTaq qPCR MasterMix Kit (Promega) according to the manufacturer's instructions.The primer of HOTAIR was "GGTAGAAAAAGCAACCACGAAGC"(forward) and "ACATAAACCTCTGTCTGTGAGTGCC" (reverse).The primer of GAPDH was "CCGGGAAACTGTGGCGTGATGG"(forward) and "AGGTGGAGGAGTGGGTGTCGCTGTT" (reverse).The qRT-PCR procedure was performed under the following con-ditions: 15 minutes at 95�C, followed by 40 cycles of 5 seconds at95�Cand35secondsat60�C.GADPHwasusedasa loading control.

Protein extraction and Western blot analysisCancer cells in culture were washed twice with ice-cold PBS and

treatedwithRIPA lysis buffer (Solarbio) to extract total cell lysates.Extracted proteins were transferred to polyvinylidene difluoride

Translational Relevance

Activation of PI3K is a characteristic molecular event duringthe progression of head and neck squamous cell carcinoma(HNSCC). The standard treatment for HNSCC is a platinum-based (platinum, 5-FU, and cetuximab) regimen. It is urgent toidentify therapeutic targets that increase the antitumor effect ofstandard treatment in HNSCC. In this study, we exploredwhether STAT3, a downstream target of PI3K, regulateslncRNA HOTAIR and EZH2 to impact the growth of HNSCCcells and xenograft tumors, and the sensitivity of HNSCC cellstoward cisplatin and cetuximab. Our results support that theSTAT3/HOTAIR/EZH2 axis may serve as a novel therapeutictarget for combination therapy of cisplatin and cetuximab totreat HNSCC patients with PI3K activation. Our findings thushave high clinical relevance for future translation to developtargeted therapies for patients with HNSCC.

Sun et al.

Clin Cancer Res; 24(11) June 1, 2018 Clinical Cancer Research2666




membranes (Millipore) and probed with the primary antibodiesagainst STAT3, pSTAT3-T705/S727, pEZH2-S21, pEZH2-T487(Abcam), panAKT, pAKT-473, p16, p21, cleaved caspase-3,P-gp100, cyclin-D1 (Cell Signaling Technology), EZH2, Bcl-2,Bax, and GAPDH (Zhongshan Biotechnology). GAPDHwas usedas a loading control in total cell extracts.

Knockdown of HOTAIR with siRNA and overexpression ofHOTAIR and STAT3 via plasmid transient transfection

The siRNAs for HOTAIR knockdown were purchased fromGenePharma Company and were transfected into cells withLipofectamine 3000 (Life Technologies), following the recom-mended protocol. Two siRNA molecules (siHOTAIR1: 50- CAG-CCCAAUUUAAGAAUUATT-30; siHOTAIR2: 50- GGAGUACAGA-GAGAAUAAUTT-30) were used. For STAT3 or HOTAIR overex-pression, we transiently transfected 2.5 mg of each plasmid intoHNSCC cells. The STAT3-expressing plasmidwas kindly providedby the Key Laboratory of Cancer Prevention and Therapy ofTianjin, Tianjin Cancer Institite (Tianjin, China). The LZRS-HOTAIR plasmid was purchased from the Addgene website(plasmid #26110).

IL6 and WP1066 treatmentRecombinant IL6 cytokine was purchased from Sigma-Aldrich.

For IL6 stimulation,HNSCCcells were starved overnight andwerethen treatedwith IL6 (20 ng/mL) for 48hours (24, 25). The STAT3small-molecule inhibitor, WP1066, was purchased from SelleckChemicals. WP1066 was first introduced in 2007 as a JAK inhib-itor in acute myelogenous leukemia and glioma; it is currentlyregarded as a STAT3 phosphorylation (Tyr705 residue) blocker(26, 27). WP1066 has shown robust anticancer effects by inhibit-ing tumor cell proliferation,migration, and invasion (28, 29). Thetreatment dosage and time have been described in our previousresearch (11, 12). Cetuximab (10 mg/mL) was used to treat cellsfor 24 hours, as described previously (30).

RNA FISH assayFISH assay was carried out according to our previous study

(31). RNA in situ hybridization was performed using a Linc-pintprobe designed by Servicebio Company. Slides were incubatedwith FITC-labeled target probes in dark overnight, and counter-stainedwith 40,6-diamidino-2-phenylindole (DAPI; Life Technol-ogies). All images were obtained with a DP-71 fluorescencemicroscope (Olympus).

Immunoprecipitation assayCal27 cells were lysed in co-immunoprecipitation (co-IP)

buffer. Total lysate of each sample was precleared by incubationwith 20 mL of protein G-Sepharose for 1 hour at 4�C. Theprecleared supernatants were subjected to overnight IP usingSTAT3 antibody (Abcam) or control IgG antibody at 4�C, fol-lowed by the addition of 40 mL of protein G-Sepharose for 1 hourat 4�C. The immunoprecipitates were washed three times with co-IP lysis buffer, and were denatured with SDS loading buffer.Western blot analysis was used to determine the pEZH2-S21 level.

Colony formation assayFive-hundred or 1,000 Cal27 or UM1 cells were seeded into

6-well plates andwere treatedwithWP1066, cisplatin, cetuximab,or a combination at designated concentrations. After 14days, cells

were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich) andstained with crystal violet (Zhongshan Biotechnology). The col-onies were further visualized under an inverted microscope andwere photographed. The relative survival rate (%) was calculatedusing the following formula: relative survival rate (%)¼ (numberof clones counted in experimental plate per 100 mm2/numberof colonies counted in control plate per 100 mm2) � 100%.Experiments were repeated in triplicate.

Bromodeoxyuridine assayWP1066-treated cells were incubatedwith bromodeoxyuridine

(BrdUrd) solution (Solarbio) for 1 hour at 37�C. The cells werethen fixed in 4% PFA and permeabilized with 0.3% Triton X-100(Solarbio) for 10minutes. After blockingwith 10%BSA in PBS for1 hour, cells were incubated with primary antibody againstBrdUrd (Santa Cruz Biotechnology) overnight at 4�C. Cells werethen incubated with the FITC-labeled secondary antibody(Zhongshan Biotechnology) for 1 hour at room temperature.Nuclei were stained with DAPI (Life Technologies), and imageswere captured with a DP-71 fluorescence microscope (Olympus).

Flow cytometry assayTreated cells were digested and prepared as a single-cell sus-

pension, and then fixed in 70% ethanol. Following the Cell CycleKit (Keygen Biotech) instructions provided by the manufacturer,the cell-cycle distribution was measured using a flow cytometer(Thermo Fisher Scientific).

Cell viability and proliferation assaysCells were seeded into 96-well plates at a density of 4,000

cells per well. After drug treatment, a total volume of 20 mL of 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide(MTT, Solarbio; 5 mg/mL) was added for 4 hours at 37�C in adark room. After removal of themedium andMTT, 200 mLDMSOwas added into each well, and the optical density (OD) wasmeasuredwith a spectrophotometer at 490 nm. The blank controlgroupwas only treatedwithmedium.ODvalue of cellswas drawnwith time as the x-axis and absorbance as the y-axis. The inhibitionrate was defined as the absorbance of OD value as the followingformula: proliferation inhibition rate ¼ (1 � OD of experimentgroup/OD of control group) � 100% (32).

Immunofluorescence stainingWP1066-treated UM1 cells were incubated with STAT3,

pEZH2-S21, and pEZH2-T487 primary antibodies overnight at4�C, followed by incubation with FITC or TRTIC-labeled second-ary antibody (Zhongshan Biotechnology) for 1 hour at roomtemperature. Nuclei were counterstained with DAPI reagent (LifeTechnologies). All images were captured with a DP-71 fluores-cence microscope (Olympus).

Luciferase reporter assayThe upstream 1,000-bp promoter region of HOTAIR was

PCR-amplified and cloned into a luciferase reporter vector(pEZX-PG04 vector, GeneCopoeia). Mutated binding sites ofSTAT3 on this region's (A¼T, G�C) sequences were also clonedinto the same luciferase reporter vector. Cal27 cells were cotrans-fected with STAT3 plasmid and pEZX-PG04 (WT/MT) plasmid.After 24 hours of transient transfection, cells were treated with IL6orWP1066 for 48 hours. After treatment, cells were collected, andthe luciferase reporter assay was performed according to the

STAT3/HOTAIR/EZH2 Regulates HNSCC Growth

www.aacrjournals.org Clin Cancer Res; 24(11) June 1, 2018 2667




manufacturer's protocol with a Secrete-Pair Dual LuminescenceAssay Kit (GeneCopoeia).

UM1 cell orthotopic tumor modelAll animal experimental protocols were approved by Tianjin

Medical University Animal Care and Use Committee. Four-week-old BALB/c nude mice were purchased from the Vital RiverLaboratories. UM1 cells were infected with luciferase lentivirus(LV5-LUC vector, Promega) and stably expressed luciferase afterpuromycin (Sigma-Aldrich) selection. Then, the luciferase-expres-sing UM1-stable cells were infected with NC (vector)/HOTAIRoverexpression lentivirus (GV341, Ubi-MCS-3FLAG-SV40, Gen-echem). After infection, 5� 106 cells for each group were injectedinto oral floor regions ofmice in situ. At 7 and 28 days, fluorescentimages were taken to observe the tumor formation and alterationusing an IVIS Lumina Imaging System (Caliper Life Sciences;ref. 33). All experimental mice were sacrificed at 4 weeks aftertumor xenografting, and the orthotopic tumors were collected forfurther pathologic examination.

IHC stainingThe paraffin-embedded tumor tissue sections were deparaffi-

nized, rehydrated, and incubated with primary antibodiesagainst STAT3, pSTAT3-705, P-gp100, EZH2, cyclin-D1, cleavedcaspase-3 (Cell Signaling Technology), PI3K (ProteinTech),phospho-PI3K, pAKT-473, pEZH2-S21, pEZH2-T487, p16,p21 (Abcam), Bax, and Bcl-2 (Zhongshan Biotechnology) over-night at 4�C. Then, the sections were incubated with the corre-sponding anti-rabbit/mouse secondary antibodies (ZhongshanBiotechnology) for 2 hours at 37�C. Sections were incubatedwith ABC-peroxidase and diaminobenzidine (DAB; ZhongshanBiotechnology), counterstained with hematoxylin, and visual-ized using light microscopy.

Statistical analysisThe results were expressed as means � standard error (SE).

Statistical analysis was performed using ANOVA, x2 test, orStudent t test with SPSS 12.0. Statistical significance was deter-mined as P < 0.05 (�).

ResultsSTAT3, HOTAIR, and EZH2 are activated and correlated withthe drug sensitivity of HNSCC

We first analyzed the expression of STAT3 and PI3K andHOTAIR level in six representative HNSCC cell lines and 28HNSCC specimens. All of the HNSCC cell lines, exceptTca8113, showed similar expression of PI3K and STAT3 (Fig.1A). In all analyzed HNSCC tumor samples, total STAT3expression level was positively correlated with PI3K (Fig. 1B;P < 0.05, r ¼ 0.62). We also examined the phosphorylation ofSTAT3, PI3K, and Akt. The signals of pSTAT3-705, pPI3K, andpAKT-473 were much higher in HNSCC tissues than in normalsquamous epithelium tissues (Supplementary Fig. S1A).HOTAIR expression was significantly lower in T1 stage HNSCCtumors (tumor diameter less than 2 cm) than in T2 and abovestage HNSCC tumors (tumor diameter greater than 2 cm; Fig.1C and D, P < 0.05). All HNSCC cell lines, except Tb3.1,showed similar phosphorylation levels of Akt (Ser473) andSTAT3 (Tyr705; Supplementary Fig. S1C). We found signifi-cantly higher expression of total STAT3 and PI3K in human

HNSCC samples than in relatively normal squamous epitheli-um (Fig. 1E). Moreover, in TCGA's HNSCC RNA-seq datasets,we observed strong, positive correlations between STAT3 andPIK3R1 (r ¼ 0.49), and the PI3K–AKT pathway downstreamtargets (NF-KB1, r ¼ 0.60; MTOR, r ¼ 0.54; and MDM2, r ¼0.49). Furthermore, we found a negative correlation betweenSTAT3 and BAD (r ¼ �0.35), a proapoptotic gene negativelyregulated by AKT (Supplementary Fig. S2).

In this study, we chose Cal27 and UM1 cell lines for furtherexploration. In SCC15 DDP–resistant (cisplatin-R) cells, wefound that pSTAT3-705 and pEZH2-S21 were triggered by IL6(20 ng/mL) induction, while these proteins were downregulatedby WP1066 (6 mmol/L) treatment (Supplementary Fig. S1B).However, Thr-487, a phosphorylation site that was necessary forEZH2degradation (34),was inhibited by IL6 andwas activated byWP1066 treatment (Supplementary Fig. S1B).

The IL6/STAT3 axis is closely correlated with lncRNA HOTAIRin HNSCC

EZH2 protein expression has been shown to be induced by IL6in growth factor–dependent cell lines (35). To investigate therelationship between IL6 and EZH2, we treatedHNSCC cells withIL6 (0, 5, 10, 20, 50 ng/mL) at different time points (0, 30minutes, 3, 6, and 12 hours). Western blot analysis revealed thatpSTAT3 and EZH2 were activated in time- and dose-dependentmanners (Fig. 2A). Twenty-four hours after IL6 (20 ng/mL)treatment, HOTAIR expression level increased by about twofoldin Cal27 and UM1 cells (Fig. 2B). In SCC15-cisplatin-R cells, IL6treatment or transfection of STAT3 expression vector triggeredHOTAIR expression, while WP1066 (6 mmol/L) treatment signif-icantly suppressed HOTAIR expression (Fig. 2C).

Targeting STAT3/EZH2 signaling significantly impacts cell-cycle progression and proliferation of HNSCC cells

We previously showed that reduction of STAT3 by WP1066could induce cell-cycle blockade (11). We sought to examine theeffects of STAT3/HOTAIR signaling on cell cycle and proliferationof HNSCC cells, by employing FCM, colony formation, andBrdUrd assays. FCM analysis showed that the number of UM1and Cal27 cells in S-phase was increased by STAT3 or HOTAIRoverexpression, accompanied by a reduction in cells in G1 and G2

phases (Fig. 3A; P < 0.05). Colony formation was remarkablyinhibited byWP1066 treatment inCal27 andUM1cells (Fig. 3B;P< 0.05). BrdUrd assay (Fig. 3C) revealed that WP1066 treatmentsignificantly suppressed S phase in both Tca8113 and UM1 cells(P < 0.05).

STAT3 enhances HOTAIR transcription by interacting withpEZH2-Serine21, but not pEZH2-T487

To further understand how HOTAIR transcription wasenhanced by STAT3, we employed IF assay to determine thein situ expression of STAT3 and pEZH2 in UM1 cells. As shownin Fig. 4A, WP1066-treated UM1 cells showed decreased nuclearSTAT3 and pEZH2-S21 signals, while nuclear pEZH2-T487expression was increased. The predicted STAT3-binding site onHOTAIR promoter region is shown in Supplementary Fig. S3.

IL6 treatment increased the fluorescence ratio in Cal27 cellstransfected with the wild-type HOTAIR promoter, but not themutant HOTAIR promoter. WP1066 treatment also decreased thefluorescence ratio in Cal27 cells with the wild-type HOTAIR pro-moter, but not the activity of mutant HOTAIR promoter (Fig. 4B).

Sun et al.





To further investigate the interaction between STAT3 andpEZH2, a FLAG-tagged STAT3 plasmid was transiently trans-fected into Cal27 cells. FLAG antibody was used for IP assay,which showed a direct binding of STAT3 with pEZH2-S21, butnot with pEZH2-T487 (Fig. 4C). Consistently, activation orinhibition of STAT3/HOTAIR signaling with IL6 or WP1066

modulated EZH2 phosphorylation sites and the level ofpAKT-473 and P-gp100 in Cal27 and UM1 cells (Fig. 4D).Overexpression of STAT3 or HOTAIR in SCC25 cells led toupregulated pAkt-473 and P-gp100 expression (Fig. 4E), whichwere closely correlated with cell proliferation and multidrugresistance (36).

Figure 1.

Correlation of STAT3/HOTAIR and PI3K expression in HNSCC tissues and cells. A, STAT3 and PI3K expression in six HNSCC cell lines, as examined by Westernblot analysis. B, Pearson correlation analysis between STAT3 and PI3K in HNSCC tissue samples (n ¼ 28; P < 0.05, r ¼ 0.62). C, HOTAIR expression in T > 2 cmgroup of HNSCC is higher than in T � 2 cm group (P < 0.05). D, HOTAIR expression in HNSCC with different T stages (P < 0.05), as assayed with FISH.E, Representative IHC images of STAT3 and PI3K in human specimens (scale bar ¼ 100 mm).






Blocking the STAT3/HOTAIR axis potentiates the efficacy ofcisplatin and cetuximab and their antiproliferative effect inHNSCC cells

To evaluate the effect of STAT3/HOTAIR signaling inactivationcombined with chemotherapy or anti-EGFR therapy, we treatedHNSCC cells with WP1066 or HOTAIR siRNA in combinationwith cisplatin or cetuximab. In cetuximab-treated UM1 cells,protein level of P-gp100, EGFR, STAT3, pAKT-473, cyclin-D1,and Bcl-2 were significantly downregulated (Fig. 5A). In UM1 orCal27 cells treatedwith a combination of cetuximab andWP1066or HOTAIR siRNA, the protein levels of P-gp100, pAKT-473,cleaved caspase-3, Bcl-2, and cyclin-D1 were inhibited, while theexpression of Bax, p16, and p21 were increased (Fig. 5B). Cellviability assays demonstrated that WP1066 sensitized UM1 andSCC25 cells to cetuximab and DDP (Fig. 6A), together with adecreased colony formation (Fig. 6B). Furthermore, Fig. 6C andDsuggested that cetuximab in combination with WP1066 or

HOTAIR knockdown showed better inhibition than cetuximabalone in UM1 cells (P < 0.05). Similarly, WP1066 and HOTAIRknockdown sensitized UM1 cells to DDP treatment, as shown incolony formation assays (Fig. 6E and F; P < 0.05).

HOTAIR overexpression promotes HNSCC tumor growthin vivo

To further illustrate thebiological effect ofHOTAIR interferencein HNSCC in vivo, we established an orthotopic tumor model byinjecting the HOTAIR-overexpressing UM1 cells into the oralcavity floor. HOTAIR overexpression resulted in a significantincrease of bioluminescence from the oral tumors, tumor weight,and volume compared with the Lenti-NC groups (Fig. 7A–D,P < 0.05). We next performed IHC staining to evaluate the path-ologic changes in these UM1 orthotopic tumors. In HOTAIR-over-expressing UM1 cells, the expression of EZH2, pEZH2-S21, STAT3,P-gp100, Bcl-2, and cyclin-D1 were decreased, compared with the

Figure 2.

Regulation of STAT3/EZH2 signaling impacts the proliferation of HNSCC cells in vitro. A, Effect of IL6 treatment on activation of STAT3 and EZH2. B, HOTAIRexpression in HNSCC cell lines (Cal27, Hep-2, Tca8113, and UM1 cells), in the presence of IL6 (20 ng/mL) treatment. C, HOTAIR expression affected by IL6 induction,WP1066 treatment, and STAT3 overexpression in SCC15 cisplatin-R cells.

Sun et al.





control animals. Levels of pEZH2-T487, cleaved caspase-3, andp21in HOTAIR-overexpressing UM1-derived tumors were lower thanlevels in control animals (Fig. 7E).

DiscussionCombination strategies, such as targeted therapy (cetuximab-

based treatment) and chemotherapy, have provided new optionsfor patients with HNSCC. However, an essential topic in HNSCCtreatment is how to increase the response to chemotherapy ortargeted therapy (37). Abnormal activation of STAT3 signaling

pathway is widely recognized as onemajormolecular event that isassociated with cancer cell proliferation and chemoresistance,including HNSCC cells (38). In this study, we demonstrated thatinhibition of STAT3 globally suppressed HNSCC proliferationand enhanced the sensitivity of HNSCC cells toward chemother-apy and targeted anti-EGFR therapy via modulating HOTAIR andEZH2.

WP1066, a potent STAT3 inhibitor, was derived from anon-ATP–competitive JAK2 inhibitor, AG490 (39). Comparedwith AG490, WP1066 has a favorable, lower IC50 in blockingSTAT3 activation (26). In recent studies, WP1066 has been

Figure 3.

STAT3/HOTAIR signaling significantly influences the cell cycle and proliferation of Cal27 and UM1 cells. A, FCM was performed to examine the cell cycleeffects induced by STAT3 or HOTAIR overexpression in UM1 and Cal27 cells (P < 0.05). B, Colony formation in WP1066-treated UM1 and Cal27 cells (P < 0.05).C, BrdUrd assay for the proliferation of WP1066- treated UM1 and Tca8113 cells (P < 0.05).






demonstrated to affect multiple cancer types in vivo and in vitro(26, 40, 41). It suppresses the JAKs/STAT3 signaling pathway byinhibiting STAT3 activation and downregulating the expres-sions of JAKs downstream target genes starting from STAT3(42). Importantly, WP1066 inhibits STAT3 phosphorylationvia inhibiting the phosphorylation of JAK2 and inducing rapidand specific JAK2 degradation (43). Its remarkable anticancereffect in regulating proliferation, apoptosis, motility, and otherbiological functions in cancers results from blocking STAT3phosphorylation, a finding that has been validated in theliterature (44).

Although the explicit mechanisms explaining cooverexpressionof STAT3, PI3K, andHOTAIR inHNSCC remain unclear, emergingevidence indicates that STAT3 and HOTAIR contribute to theproliferation and cell-cycle progression in many cancers (45, 46).Perhaps the interaction of STAT3 with HOTAIR promoter regionincreasesHOTAIR level, asblockingSTAT3 reducesHOTAIRexpres-sion (47). We blocked STAT3 activation with small-moleculeSTAT3 inhibitor WP1066, which effectively abrogated IL6-inducedSTAT3 expression and activation at the Tyr705 andSer727 residues,the primary phosphorylation sites for STAT3 (48, 49). WP1066treatment inhibits the growth of the cisplatin-resistant HNSCC cell

Figure 4.

The mechanism by which STAT3 promotes HOTAIR transcription of phosphor-EZH2-S21 in vitro. A, Expression of STAT3, pEZH2-Ser21, and pEZH2-T487 inUM1 cells treated with WP1066 (6 mmol/L), assayed by in situ IF. B, STAT3 binding with the wild-type HOTAIR promoter, but not mutant HOTAIR promoter, in Cal27cells (WT: wild-type, MT: mutant type of HOTAIR promoter region binding by STAT3) by dual-luciferase assay. C, STAT3 interaction with pEZH2-S21 directlyin Cal27 cells, as assayed by IP-Western blot analysis. D,Western blot analysis of p-STAT3-705, p-STAT3-727, EZH2, pEZH2-T487, pEZH2-S21, AKT, and pAKT-473protein levels in Cal27 and UM1 cells treated with IL6 or WP1066, with GAPDH as a loading control. E, Western blot analysis of STAT3, P-gp100, EZH2, AKT,and pAKT protein in SCC25 cells transfected with STAT3 or HOTAIR overexpression plasmid, with GAPDH as a loading control.

Sun et al.





line SCC15, as well as UM1 and Cal27 cells. Importantly, STAT3acts as a transcription factor to trigger HOTAIR in HNSCC cells.

In this study, activated STAT3 induces HOTAIR transcriptionvia EZH2 phosphorylation. We elucidated that the regulatorymechanism of transcription factor STAT3 on lncRNA HOTAIRis by targeting the phosphorylation of EZH2 at Ser-21 but ratherthanTyr487, as demonstrated by IP assay inCal27 cells. Luciferasereporter analysis revealed that activated STAT3 signaling by IL6 orblocked STAT3 signaling with WP1066 could influence the inter-action between STAT3 and HOTAIR promoter, as the mutantpromoter did not respond. These findings suggest that HOTAIR/EZH2 functions as important downstream STAT3 effectors tomediate the biological function of the STAT3 signaling cascade.

Furthermore, our findings support that EZH2 is involved inSTAT3-mediated cancer progression. First, different phosphory-lation sites of EZH2 function differently in tumor cells (50). Forinstance, S21 phosphorylation of EZH2 was reported to beactivated by JNK/STAT3/Akt signaling, leading to oncogenesis(51, 52). In contrast to pEZH2-S21, phosphorylation of Thr-345 and Thr-487 promotes EZH2 ubiquitination and subsequentdegradation by the proteasome (34, 53). Thus, pEZH2-T487disrupts EZH2 binding with other PRC2 components, such asSUZ12 and EED, and thereby inhibits EZH2-dependent epige-netic silencing, impairing the invasion ability of tumor cells (54).

We found that WP1066 treatment inhibits pEZH-S21 expres-sion and triggers pEZH-T487 in both UM1 and Cal27 cells. Ourresults add STAT3 to a growing list of upstreampathways of EZH2and the PI3K/AKT cascade. EZH2 is known to bind andmethylateSTAT3 and to enhance STAT3 activity in glioblastoma and GSCs.STAT3 signaling could be impaired by melatonin through directpEZH2–S21–STAT3 interaction in GSCs (55). Importantly, EZH2is demonstrated to be induced by STAT3 through binding of theSTAT3 motif at the EZH2 promoter (56). In this study, we foundthat IL6 treatment activates STAT3, HOTAIR, EZH2 (pEZH2-S21),and pAKT-T473, accompanied by attenuated pEZH2 (T487), inUM1 and Cal27 cells.

Blockage of the AKT–EZH2 axis decreases the activity of STAT3in a KRAS mutation–related manner (57). Similarly, phosphor-ylated Akt–induced prostate cancer progression was demonstrat-ed to be involvedwith newly developed AR degradation enhancerASC-J9–modulated EZH2–STAT3 signaling, whichmay then leadto suppression of prostate cancer stem/progenitor cells (58).PI3K/AKT signaling plays an essential role in tumor cell prolifer-ation and chemo-sensitivity (38, 59). Melatonin treatment couldinhibit EZH2 phosphorylation at S21 and disrupt EZH2–STAT3interaction, while AKT overexpression could reverse this effect inglioblastoma stem-like cells (55).

In addition, As3þ treatment triggers reactive oxygen species(ROS) and induces EZH2 S21 phosphorylation through JNK andSTAT3-dependent Akt activation in human bronchial epithelialcells (52). Inhibiting the PI3K/AKT signaling pathway attenuatedEZH2 expression in a panel of lung adenocarcinoma, colorectal,and pancreatic cancer KRAS-mutant cell lines (57). Our findingsillustrate the antitumor effect of targeting the STAT3/HOTAIR/EZH2 axis onHNSCCcell proliferation, cell-cycle progression, andsensitivity to cisplatin and cetuximab. We therefore hypothesizethat PI3K/AKT signaling may participate upstream of the referredSTAT3-EZH2 axis and affect the overall growth regulation ofHNSCC. In future studies, we will test how PI3K/AKT signalingis involved in the STAT3/HOTAIR/EZH2 axis in human HNSCCandexplore thepotential valueof this axis as a therapeuticwindow.

In summary, we revealed that lncRNA HOTAIR transcriptionwas upregulated by STAT3 signaling through pEZH2-S21, but notpEZH2-T487, in HNSCC cells (Supplementary Fig. S1D). Block-ade of this pathway is associated with PI3K/AKT signaling inhi-bition, leading to reduced resistance to cisplatin and cetuximaband proliferation of HNSCC cells. Combined treatment withWP1066 and cetuximab or cisplatin induced synergistic antipro-liferative and proapoptotic effects on the cetuximab/cisplatinsensitivity of HNSCC cells. Knockdown of HOTAIR with siRNAcombined with cisplatin or cetuximab enhanced the suppressiveeffects. Therefore, our study highlighted new insights about how

Figure 5.

Cisplatin and cetuximab cytotoxicity was enhanced in HNSCC cells after IL6/STAT3/HOTAIR axis repression. A, Western blot analysis of the expression ofP-gp100, STAT3, AKT, pAKT, EGFR, Cyclin-D1, and Bcl-2 in UM1 cells treated with cetuximab (20 mg/mL), with GAPDH as a loading control. B,Western blot analysisof the expression of P-gp100, AKT, pAKT, cleaved caspase-3, Bcl-2, Bax, Cyclin-D1, p16, and p21 in UM1 and Cal27 cells treated with WP1066 and/or HOTAIRsiRNA, with GAPDH as a loading control.






the crosstalk of the STAT3/HOTAIR/EZH2 and PI3K/AKT path-waysmight impact cisplatin and cetuximab sensitivity inHNSCC.

ConclusionWedemonstrate that activatedSTAT3binds to thepromoterof the

HOTAIR encoding gene to increase HOTAIR transcription, therebyenhancing EZH2-mediated epigenetic silencing in HNSCC.We also

illustrate that EZH2-dependent crosstalk with STAT3 signaling hasimportant clinical implications for PI3K-activated HNSCC treat-ment. These data suggest that inhibition of STAT3 signaling caninhibit HNSCC cell proliferation and sensitize these cells to che-motherapy or targeted therapy by regulating multiple downstreamfactors. EZH2-dependent regulatory mechanism of STAT3 signalingmight be a promising therapeutic target for HNSCC treatment.

Figure 6.

Targeting of STAT3/HOTAIR signaling inhibits HNSCC proliferation in vitro. A, MTT assay to examine the combination of WP1066 with cetuximab or cisplatinin repressing cell viability in UM1 and SCC25 cells (P < 0.05). B, Colony formation assay for determining the proliferative ability of UM1 cells (1,000 cell per well)treated with cetuximab and DDP (P < 0.05). C, Colony formation assay for determining the proliferative ability of UM1 cells (1,000 cell per well) treatedwith a combination of cetuximab andWP1066 (P < 0.05). D, Colony formation assay for determining the proliferative ability of UM1 cells (500 cell per well) treatedwith a combination of cetuximab and HOTAIR siRNA (P < 0.05). E, Colony formation assay for determining the proliferative ability of UM1 cells (1000 cell perwell) treated with a combination of WP1066 and DDP (P < 0.05). F, Colony formation assay for determining the proliferative ability of UM1 cells (500 cellper well) treated with a combination of HOTAIR siRNA and DDP (P < 0.05).

Sun et al.





Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: Y. Zhang, M. Li, X. ZhouDevelopment of methodology: C. Zhang, C. Wu, J. Yang

Acquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): S. Sun, Y. Wu, W. Guo, Y. Wang, X. Yao, C. Jing,Z. Li, C. Wu, X. Wang, L. ZhangAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): S. Sun, Y. Wu, F. Yu, L. Kong, Y. Wang, C. Zhang,Y. Zhang, M. Zhao, Z. Li, X. Wang, L. Zhang, M. Li

Figure 7.

HOTAIR overexpression promotes HNSCC growth and inhibits apoptosis in an orthotopic model in vivo. A, Tumor volume of NC or HOTAIR-overexpressedUM1-derived orthotopic tumors as determined by a bioluminescence imaging system.B–D, Tumor volume andweight of NC or HOTAIR-overexpressed UM1-derivedorthotopic tumors. E, Representative images of IHC staining of EZH2, pEZH2-S21, pEZH2-T487, P-gp100, Bax, Bcl-2, cleaved caspase-3, and p21 in tissuefrom mice with NC or HOTAIR-overexpressed UM1-derived orthotopic tumors (scale bar ¼ 100 mm).






Writing, review, and/or revision of themanuscript: S. Sun, Y.Wu, F. Yu,M. Liu,Y. Zhang, J. Yang, M. LiAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): Y. Wu, Y. Ren, X. Yao, M. LiStudy supervision: M. Zhao, Y. Qiao

AcknowledgmentsThis work was supported by grants from the National Science Foundation of

China (NSFC81572492 and 81702529), the National Clinical Research Center

for Cancer (NCRCC), andSpecial Programof TalentsDevelopment for ExcellentYouth Scholars in Tianjin.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received September 16, 2016; revised January 27, 2017; accepted March 6,2018; published first March 14, 2018.

References1. Siegel R, NaishadhamD, Jemal A. Cancer statistics, 2012. CA Cancer J Clin

2012;62:10–29.2. Posner M, Vermorken JB. Induction therapy in the modern era of com-

bined-modality therapy for locally advanced head and neck cancer. SeminOncol 2008;35:221–8.

3. Vermorken JB, Mesia R, Rivera F, Remenar E, Kawecki A, Rottey S, et al.Platinum-based chemotherapy plus cetuximab in head and neck cancer.N Engl J Med 2008;359:1116–27.

4. The Cancer Genome Atlas Network. Comprehensive genomic characteri-zation of head and neck squamous cell carcinomas. Nature 2015;517:576–82.

5. Vanhaesebroeck B, Guillermet-Guibert J, Graupera M, Bilanges B. Theemerging mechanisms of isoform-specific PI3K signalling. Nat Rev MolCell Biol 2010;11:329–41.

6. Simpson DR, Mell LK, Cohen EE. Targeting the PI3K/AKT/mTOR pathwayin squamous cell carcinoma of the head and neck. Oral Oncol 2015;51:291–8.

7. Fresno Vara JA, Casado E, de Castro J, Cejas P, Belda-Iniesta C, Gonzalez-Baron M. PI3K/Akt signalling pathway and cancer. Cancer Treat Rev2004;30:193–204.

8. Troiani T, Napolitano S, Vitagliano D, Morgillo F, Capasso A, Sforza V,et al. Primary and acquired resistance of colorectal cancer cells to anti-EGFR antibodies converge on MEK/ERK pathway activation and can beovercome by combined MEK/EGFR inhibition. Clin Cancer Res 2014;20:3775–86.

9. Xiong A, Yang Z, Shen Y, Zhou J, Shen Q. Transcription factor STAT3 as anovel molecular target for cancer prevention. Cancers 2014;6:926–57.

10. MasciocchiD,Gelain A, Villa S,Meneghetti F, BarloccoD. Signal transducerand activator of transcription 3 (STAT3): a promising target for anticancertherapy. Future Med Chem 2011;3:567–97.

11. Zhou X, Ren Y, Liu A, Han L, Zhang K, Li S, et al. STAT3 inhibitor WP1066attenuates miRNA-21 to suppress human oral squamous cell carcinomagrowth in vitro and in vivo. Oncol Rep 2014;31:2173–80.

12. Zhou X, Ren Y, Liu A, Jin R, Jiang Q, Huang Y, et al. WP1066 sensitizes oralsquamous cell carcinoma cells to cisplatin by targeting STAT3/miR-21 axis.Sci Rep 2014;4:7461.

13. Sun SS, Zhou X, Huang YY, Kong LP, Mei M, Guo WY, et al. TargetingSTAT3/miR-21 axis inhibits epithelial-mesenchymal transition via regu-lating CDK5 in head and neck squamous cell carcinoma. Mol Cancer2015;14:213.

14. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, et al. Longnon-coding RNA HOTAIR reprograms chromatin state to promote cancermetastasis. Nature 2010;464:1071–6.

15. Kogo R, Shimamura T, Mimori K, Kawahara K, Imoto S, Sudo T, et al. Longnoncoding RNAHOTAIR regulates polycomb-dependent chromatinmod-ification and is associatedwith poor prognosis in colorectal cancers. CancerRes 2011;71:6320–6.

16. Li D, Feng J, Wu T, Wang Y, Sun Y, Ren J, et al. Long intergenic noncodingRNA HOTAIR is overexpressed and regulates PTEN methylation in laryn-geal squamous cell carcinoma. Am J Pathol 2013;182:64–70.

17. Zhang S, Chen S, Yang G, Gu F, Li M, Zhong B, et al. Long noncoding RNAHOTAIR as an independent prognostic marker in cancer: a meta-analysis.PLoS One 2014;9:e105538.

18. Zhou X, Ren Y, Zhang J, Zhang C, Zhang K, Han L, et al. HOTAIR is atherapeutic target in glioblastoma. Oncotarget 2015;6:8353–65.

19. Wu Y, Zhang L, Wang Y, Li H, Ren X, Wei F, et al. Long noncoding RNAHOTAIR involvement in cancer. Tumour Biol 2014;35:9531–8.

20. ZhouX, RenY,Kong L,CaiG, Sun S, SongW, et al. Targeting EZH2 regulatestumor growth and apoptosis through modulating mitochondria depen-dent cell-death pathway in HNSCC. Oncotarget 2015;6:33720–32.

21. Kong L, Zhou X, Wu Y, Wang Y, Chen L, Li P, et al. Targeting HOTAIRinducesmitochondria related apoptosis and inhibits tumor growth inheadand neck squamous cell carcinoma in vitro and in vivo. Curr Mol Med2015;15:952–60.

22. Liu Z, Sun M, Lu K, Liu J, Zhang M, Wu W, et al. The long noncoding RNAHOTAIR contributes to cisplatin resistance of human lung adenocarcino-ma cells via downregualtion of p21(WAF1/CIP1) expression. PLoS One2013;8:e77293.

23. Kozaki K, Imoto I, Pimkhaokham A, Hasegawa S, Tsuda H, Omura K, et al.PIK3CA mutation is an oncogenic aberration at advanced stages of oralsquamous cell carcinoma. Cancer Sci 2006;97:1351–8.

24. Lin YM, Wang CM, Jeng JC, Leprince D, Shih HM. HIC1 interacts with andmodulates the activity of STAT3. Cell Cycle 2013;12:2266–76.

25. Xiang M, Birkbak NJ, Vafaizadeh V, Walker SR, Yeh JE, Liu S, et al. STAT3induction of miR-146b forms a feedback loop to inhibit the NF-kappaB toIL-6 signaling axis and STAT3-driven cancer phenotypes. Sci Signal 2014;7:ra11.

26. Iwamaru A, Szymanski S, Iwado E, Aoki H, Yokoyama T, Fokt I, et al. Anovel inhibitor of the STAT3 pathway induces apoptosis in malignantglioma cells both in vitro and in vivo. Oncogene 2007;26:2435–44.

27. Bhattacharya S, Ray RM, Johnson LR. STAT3-mediated transcription of Bcl-2, Mcl-1 and c-IAP2 prevents apoptosis in polyamine-depleted cells.Biochem J 2005;392:335–44.

28. Geng L, Li X, Zhou X, Fang X, YuanD,Wang X.WP1066 exhibits antitumorefficacy in nasaltype natural killer/T-cell lymphoma cells through down-regulation of the STAT3 signaling pathway. Oncol Rep 2016;36:2868–74.

29. Tang YJ, Sun ZL, Wu WG, Xing J, He YF, Xin DM, et al. Inhibitor of signaltransducer and activator of transcription 3 (STAT3) suppresses ovariancancer growth, migration and invasion and enhances the effect of cisplatinin vitro. Genet Mol Res 2015;14:2450–60.

30. WangWM, Zhao ZL, Ma SR, Yu GT, Liu B, Zhang L, et al. Epidermal growthfactor receptor inhibition reduces angiogenesis via hypoxia-induciblefactor-1alpha and Notch1 in head neck squamous cell carcinoma. PLoSOne 2015;10:e0119723.

31. Zhou X, Ren Y,Moore L,MeiM, You Y, Xu P, et al. Downregulation ofmiR-21 inhibits EGFR pathway and suppresses the growth of human glioblas-toma cells independent of PTEN status. Lab Invest 2010;90:144–55.

32. WangZM, YangDS, Liu J, LiuHB, YeM,ZhangYF. ROCK inhibitor Y-27632inhibits the growth, migration, and invasion of Tca8113 and CAL-27 cellsin tongue squamous cell carcinoma. Tumour Biol 2016;37:3757–64.

33. Bozec A, Ebran N, Radosevic-Robin N, Sudaka A, Monteverde M, ToussanN, et al. Combination of mTOR and EGFR targeting in an orthotopicxenograft model of head and neck cancer. Laryngoscope 2016;126:E156–63.

34. Li Z, Hou P, Fan D, Dong M, Ma M, Li H, et al. The degradation of EZH2mediated by lncRNA ANCR attenuated the invasion and metastasis ofbreast cancer. Cell Death Differ 2017;24:59–71.

35. Croonquist PA, VanNess B. The polycomb group protein enhancer of zestehomolog 2 (EZH 2) is an oncogene that influences myeloma cell growthand the mutant ras phenotype. Oncogene 2005;24:6269–80.

36. Dong J, Zhai B, Sun W, Hu F, Cheng H, Xu J. Activation of phosphatidy-linositol 3-kinase/AKT/snail signaling pathway contributes to epithelial-mesenchymal transition-induced multi-drug resistance to sorafenib inhepatocellular carcinoma cells. PLoS One 2017;12:e0185088.

Sun et al.





37. Boeckx C, Baay M, Wouters A, Specenier P, Vermorken JB, Peeters M, et al.Anti-epidermal growth factor receptor therapy in head and neck squamouscell carcinoma: focus on potential molecular mechanisms of drug resis-tance. Oncologist 2013;18:850–64.

38. Rebucci M, Peixoto P, Dewitte A, Wattez N, De Nuncques MA, Rezvoy N,et al. Mechanisms underlying resistance to cetuximab in the HNSCC cellline: role of AKT inhibition in bypassing this resistance. Int J Oncol2011;38:189–200.

39. Rashid S, Bibi N, Parveen Z, Shafique S. Inhibition of Janus kinases bytyrosine phosphorylation inhibitor, Tyrphostin AG-490. J Biomol StructDyn 2015;33:2368–79.

40. Hussain SF, Kong LY, Jordan J, Conrad C, Madden T, Fokt I, et al. A novelsmall molecule inhibitor of signal transducers and activators of transcrip-tion 3 reverses immune tolerance inmalignant glioma patients. Cancer Res2007;67:9630–6.

41. Horiguchi A, Asano T, Kuroda K, Sato A, Asakuma J, Ito K, et al. STAT3inhibitorWP1066 as a novel therapeutic agent for renal cell carcinoma. Br JCancer 2010;102:1592–9.

42. Lu K, Chen N, Zhou XX, Ge XL, Feng LL, Li PP, et al. The STAT3 inhibitorWP1066 synergizes with vorinostat to induce apoptosis of mantle celllymphoma cells. Biochem Biophys Res Commun 2015;464:292–8.

43. Verstovsek S,Manshouri T,Quintas-CardamaA,Harris D, Cortes J, Giles FJ,et al.WP1066, a novel JAK2 inhibitor, suppresses proliferation and inducesapoptosis in erythroid human cells carrying the JAK2V617Fmutation. ClinCancer Res 2008;14:788–96.

44. Ferrajoli A, Faderl S, Van Q, Koch P, Harris D, Liu Z, et al. WP1066 disruptsJanus kinase-2 and induces caspase-dependent apoptosis in acute mye-logenous leukemia cells. Cancer Res 2007;67:11291–9.

45. Dong L,Hui L.HOTAIRpromotes proliferation,migration, and invasion ofovarian cancer SKOV3 cells through regulating PIK3R3. Med Sci Monit2016;22:325–31.

46. RenW, Shen S, Sun Z, Shu P, Shen X, Bu C, et al. Jak-STAT3 pathway triggersDICER1 for proteasomal degradation by ubiquitin ligase complex of CUL4Ato promote colon cancer development. Cancer Lett 2016;375:209–20.

47. Liu Y, Luo F, Xu Y, Wang B, Zhao Y, Xu W, et al. Epithelial-mesenchymaltransition and cancer stem cells, mediated by a long non-coding RNA,HOTAIR, are involved in cell malignant transformation induced by ciga-rette smoke extract. Toxicol Appl Pharmacol 2015;282:9–19.

48. Akira S, Nishio Y, Inoue M, Wang XJ, Wei S, Matsusaka T, et al. Molecularcloning of APRF, a novel IFN-stimulated gene factor 3 p91-related tran-scription factor involved in the gp130-mediated signaling pathway. Cell1994;77:63–71.

49. Wen Z, Zhong Z, Darnell JE Jr. Maximal activation of transcription by Stat1and Stat3 requires both tyrosine and serine phosphorylation. Cell1995;82:241–50.

50. Sun S, Yu F, Zhang L, Zhou X. EZH2, an on-off valve in signal network oftumor cells. Cell Signal 2016;28:481–7.

51. Cha TL, Zhou BP, Xia W, Wu Y, Yang CC, Chen CT, et al. Akt-mediatedphosphorylation of EZH2 suppresses methylation of lysine 27 in histoneH3. Science 2005;310:306–10.

52. Chen B, Liu J, ChangQ, Beezhold K, Lu Y, Chen F. JNK and STAT3 signalingpathways converge on Akt-mediated phosphorylation of EZH2 in bron-chial epithelial cells induced by arsenic. Cell Cycle 2013;12:112–21.

53. Wu SC, Zhang Y. Cyclin-dependent kinase 1 (CDK1)-mediated phosphor-ylation of enhancer of zeste 2 (Ezh2) regulates its stability. J Biol Chem2011;286:28511–9.

54. Wei Y, Chen YH, Li LY, Lang J, Yeh SP, Shi B, et al. CDK1-dependentphosphorylation of EZH2 suppressesmethylation ofH3K27 andpromotesosteogenic differentiation of humanmesenchymal stem cells. Nat Cell Biol2011;13:87–94.

55. Chen X, Hao A, Li X, Du Z, Li H, Wang H, et al. Melatonin inhibitstumorigenicity of glioblastoma stem-like cells via the AKT-EZH2-STAT3signaling axis. J Pineal Res 2016;61:208–17.

56. Pan YM, Wang CG, Zhu M, Xing R, Cui JT, Li WM, et al. STAT3 signalingdrives EZH2 transcriptional activation and mediates poor prognosis ingastric cancer. Mol Cancer 2016;15:79.

57. Riquelme E, Behrens C, Lin HY, Simon G, Papadimitrakopoulou V, Izzo J,et al. Modulation of EZH2 expression by MEK-ERK or PI3K-AKT signalingin lung cancer is dictated by different KRAS oncogene mutations. CancerRes 2016;76:675–85.

58. Wen S, Tian J, Niu Y, Li L, Yeh S, Chang C. ASC-J9((R)), and not Casodex orEnzalutamide, suppresses prostate cancer stem/progenitor cell invasion viaaltering the EZH2-STAT3 signals. Cancer Lett 2016;376:377–86.

59. Yang Z, Fang S, Di Y, YingW, Tan Y, GuW.Modulation ofNF-kappaB/miR-21/PTEN pathway sensitizes non-small cell lung cancer to cisplatin. PLoSOne 2015;10:e0121547.






2018;24:2665-2677. Published OnlineFirst March 14, 2018.Clin Cancer Res Shanshan Sun, Yansheng Wu, Wenyu Guo, et al. EZH2-dependent MannerSTAT3/HOTAIR Signaling Axis Regulates HNSCC Growth in an

Updated version

10.1158/1078-0432.CCR-16-2248doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2018/03/14/1078-0432.CCR-16-2248.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/24/11/2665.full#ref-list-1

This article cites 59 articles, 11 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/24/11/2665.full#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/24/11/2665To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-16-2248

http://clincancerres.aacrjournals.org/content/suppl/2018/03/14/1078-0432.CCR-16-2248.DC1

http://clincancerres.aacrjournals.org/content/24/11/2665.full#ref-list-1

http://clincancerres.aacrjournals.org/content/24/11/2665.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/24/11/2665


stat3/hotair signaling axis regulates hnscc growth in an ...cancer therapy: preclinical stat3/hotair...

Documents