ilable at ScienceDirect

Theriogenology 80 (2013) 893–902

Contents lists ava

Theriogenology

journal homepage: www.ther io journal .com

Spatiotemporal expression of Wnt signaling pathway components duringbovine placental development

Wengeng Lu a,b,*, Zhaowei Tu a,c, Shumin Wang a, Jinhua Lu a,c, Qiang Wang a,c,Weixiang Wang a, Bingyan Wang a, Haibin Wang a, Hemin Ni d, Yong Guo d

a State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, PR ChinabCollege of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, Daqing High-tech Industrial Development Zone, Daqing, PR ChinacGraduate School of the Chinese Academy of Sciences, Beijing, PR ChinadAnimal Science and Technology College, Beijing University of Agriculture, Beijing, PR China

a r t i c l e i n f o

Article history:Received 1 June 2012Received in revised form 10 July 2013Accepted 11 July 2013

Keywords:WntTrophoblastsBovine placenta

* Corresponding author. Tel.: þ86 10 64807868; faE-mail address: lwg1712@hotmail.com (W. Lu).

0093-691X/$ – see front matter � 2013 Elsevier Inchttp://dx.doi.org/10.1016/j.theriogenology.2013.07.01

a b s t r a c t

It is well established that trophoblasts play a crucial role in pregnancy establishment andmaintenance through production of various biological substances. In this regard, Wntsignaling is an important regulator of embryo implantation and placentation in variousspecies. However, the role of the Wnt signaling pathway during bovine placental devel-opment has remained largely unknown. Employing multiple approaches, we herein foundthat Wnt2 mRNAwas more abundant in cotyledon tissues compared with caruncle tissues,whereas Wnt5b mRNA was more abundant in caruncle tissues compared with cotyledontissues. Moreover, the Wnt receptor Fzd4 was detected in caruncle epithelial cells andbinucleate trophoblasts, but not in uninucleate trophoblasts. In addition, b-catenin, anintegral cell-cell adhesion adaptor protein as well as transcriptional co-regulator of Wntcanonical pathway, was spatiotemporally expressed in bovine trophoblasts, with highlevels of cellular accumulation and nuclear translocation, particularly in binucleate tro-phoblasts. Lymphoid enhancer factor-1 mRNA was more abundant in caruncle tissuescompared with cotyledon tissues, which was well correlated with the expression profile ofDickkopf-1, a secreted antagonist of the canonical Wnt signaling pathway. These resultsprovided new evidence that precisely regulated canonical Wnt activation may have a veryimportant physiological role during fetal-maternal recognition and pregnancy mainte-nance in cattle.

� 2013 Elsevier Inc. All rights reserved.

1. Introduction

The mammalian blastocyst consists of two distinct cellpopulations, the inner cell mass and trophoblasts; theformer comprises the embryo and its associated mem-branes, whereas the latter form a large portion of theplacenta [1]. There are two major types of trophoblasts inbovine placentas: uninucleate trophoblasts (UTCs) andbinucleate trophoblasts (BNCs). With the initiation of

x: þ86 10 64807099.

. All rights reserved.5

blastocyst implantation and throughout pregnancy, UTCsare differentiated into BNCs via acytokinetic mitosis, whichaccount for approximately 15% to 20% of trophoblasts [2–4].The BNCs migrate and fuse with maternal uterine epithelialcells to form the fetomaternal syncytium during implan-tation. Subsequently, the syncytium is replaced by an intactepithelium on postimplantation day 40. Afterward, themigration and fusion of BNCs is limited to the generation ofshort-lived trinucleated cells in cattle. However, in sheep,the syncytium is extensive and persists throughout gesta-tion [5].

It is well established that bovine trophoblasts are able toproduce several molecules, including placental lactogen,

Table 1Quantitative real-time PCR primer sequences.

Genes Primer sequence 50–30 GenBankaccession no.

Wnt2 Forward CGTTACTGAGTGGACGATGGAG NM_001013001.1Reverse CCTGGTGATGGCAAATACAACTC

Wnt5b Forward CCAACTCTACCAGGAGCACATG NM_001205628.1Reverse GATCTGCAGGACTCTCCCAAAG

Fzd4 Forward GGGAACCAACTCGGATCAGTAC NM_001206269.1Reverse CATCCAGACGTCGGTGAACTC

Dkk-1 Forward GAGTGCAGCACAGACGAGTAC NM_001205544.1Reverse AAGGCATGCATATCCCGTTTTTG

LEF1 Forward CACACAACTGGCATCCCTCATC NM_001192856.1Reverse TGGCTCCTGCTCCTTTCTCTG

ctnnb1 Forward TGCCCATCTATGAGGGGTACG NM_001076141.1Reverse CGCTCCGTGAGGATCTTCATG

GAPDH Forward ACCCCTTCATTGACCTTCACTAC NM_001034034.1Reverse TGGAAGATGGTGATGGCCTTTC

W. Lu et al. / Theriogenology 80 (2013) 893–902894

interferon-tau, and pregnancy-associated glycoproteinduring the peri-implantation period [1,6–8], thereby en-suring establishment and maintenance of pregnancy.Therefore, normal trophoblast differentiation and crosstalkwith the uterus is critical to a successful pregnancy. In2012, Kohan-Ghadr et al. [9] reported that E-cadherin andb-catenin play critical roles in bovine trophectoderm for-mation and function. However, the physiological signifi-cance of Wnt signaling during bovine placentation remainsunclear.

The Wnt proteins can evoke two downstream signalingcascades, known as the canonical and noncanonical path-ways. The canonical Wnt pathway describes a series ofevents that occur whenWnt proteins bind to Frizzled (Fzd)family receptors and low-density lipoprotein receptor–related protein (LRP) 5/6 coreceptors, which causes thereceptors to activate the Dishevelled family proteins,which, in turn, leads to cellular accumulation and nucleartranslocation of b-catenin. However, the noncanonical Wntproteins conduct downstream signaling independent of b-catenin and are exerted through many signal transductioncascades, of which the two most well studied are thecalcium-dependent pathway and the planar cell polaritypathway [10].

Thus far, the Wnt signaling pathway has been indicatedas an important regulator of embryo implantation andplacental development in mice, sheep, and humans [11,12].In mice, for example, Wnt2 is expressed in the allantois at8.0-day post coitum (dpc). The Wnt2 mutant mouse em-bryos have placental defects, such as edema and generaldisruption of the labyrinthine zone [13]. Expression ofWnt7b in the chorion is required for fusion of the chorionand allantois during placental development; however, ho-mozygousWnt7bmutantmicedie atmid-gestational stagesdue to placental abnormalities [14]. Moreover, Fzd5knockoutmice died in utero atw10.75 dpc, owing to defectsin chorion branches [15,16]. In addition, deletions in tran-scription factor-1 and lymphoid enhancer factor-1 (LEF-1),which are both transcription factors implicated in Wntsignaling, result in the absence of chorionic-allantois fusionduringmouse placental formation [17]. Dickkopf-1 (Dkk-1),a secreted glycoprotein, acts as an antagonist of the canon-ical Wnt signaling pathway by binding to LRP5/6 and pre-venting Fzd-LRP5/6 complex formation [18–20]. Dkk-1 ismainly expressed in maternal decidual tissue at dpc 8 inmice; treatment with recombinant mouse Dkk-1 facilitatedtrophoblastic outgrowth of ectoplacental cones [21]. Inaddition, Sonderegger et al. [22] reported that 14 out of 19Wnt ligands and8outof 10 FZD receptorsweredetectable inhuman placental tissues, and that Wnt1, Wnt7b, Wnt10a,and Wnt10b were abundantly expressed in first-trimestercytotrophoblasts, but absent in term trophoblasts. Inanother study,nuclear accumulationofb-catenin reportedlypromoted differentiation of invasive trophoblasts in thehuman placenta, which contributed to trophoblastic hy-perplasia [23]. The above-referenced studies indicated thatsome Wnt pathway components played roles in placentaldevelopment. However, the roles of canonical and nonca-nonicalWnt signaling pathways during bovine placentationremain largely unknown. Hence, we initially applied thequantitative real-time polymerase chain reaction (PCR)

method to compare the expression patterns of 19 Wnt li-gands and 10 Frizzled receptors between cotyledon andcaruncle tissues. Among the various genes differentiallyexpressed, we finally focused on several abundantlyexpressed genes in those tissues, namely, Wnt2, Wnt5b,Fzd4, b-catenin, LEF-1, and Dkk-1. Then, we employedmultiple approaches to analyze expressionpatterns of theseselectedproteins during bovineplacentation to characterizeexpression of some Wnt pathway components.

2. Materials and methods

2.1. Tissue collection

The uteri from pregnant Chinese yellow beef cattle wereobtained from a local abattoir approximately 15 to 25 mi-nutes after death. Gestation ages of Days 31 to 60 (n ¼ 3),Days 61 to 90 (n ¼ 3), and Days 91 to 120 (n ¼ 3) wereestimated by measurement of the crown-rump length [24].Immediately after collection, some placentomes wereexcised and manually separated into cotyledons and car-uncles. After washing in physiological saline three times,the cotyledons, caruncles, and placentomes were frozenand stored in liquid nitrogen until RNA extraction andfrozen sections for real-time PCR and in situ hybridizationanalyses, respectively. In addition, a portion of tissues wasfixed in 4% (wt/vol) paraformaldehyde in 10 mM PBS (pH ¼7.4) for histologic examinations.

2.2. Periodic acid–Schiff staining

Paraffin-embedded, 5-mm-thick, bovine, placental tissuesections were deparaffinized and oxidized in 0.5% to 1%periodic acid. After quickly washing in dH2O, the sectionswere stained in Schiff solution for 1 hour at 37 �C and thenwashed in sulfite solution, followed by washing twice indH2O and hematoxylin staining for 5 minutes for histologicanalysis.

2.3. RNA isolation and quantitative real-time PCR

Total RNA was isolated from cotyledon and caruncletissues at 31 to 60, 61 to 90, and 91 to 120 days of

Table 2In situ hybridization probe sequences and plasmid information.

Genes AS/S Initiation site Primer sequence 50–30 Polymerase Size (bp) GenBank accession no.

Wnt2 Antisense 1667 AGAAAGAGGAAATGTTGAGGG T7 618 NM_001013001.1Sense 1050 CACTGGTTTCACTGTGGCTAA SP6

Wnt5b Antisense 254 GGGTTATTCATACCTAGCGACCAC T7 235 NM_001205628.1Sense 20 TAGTGACGGCTTAGGCTCCAGT SP6

Fzd4 Antisense 1752 GAGCGGTGGTGGATTATTGG SP6 407 NM_001206269.1Sense 1346 CCTGCGTGATTGCCTGTTAT T7

Dkk-1 Antisense 693 TGAGCGAAGACAGGCAGAAC T7 350 NM_001205544.1Sense 344 AGACCATTGACAACCACCAGC SP6

Ctnnb1 Antisense 3262 GCATTGTATCACAGCAGGTTA SP6 646 NM_001034034.1Sense 2617 GGGCTGGTATCTCAGAAAGT T7

W. Lu et al. / Theriogenology 80 (2013) 893–902 895

gestation using TRIzol reagent (Invitrogen, Carlsbad, CA,USA) according to the manufacturer’s instructions. Reversetranscription with oligo deoxy-thymine nucleotide prim-ing was performed to generate cDNAs from 3 mg of totalRNA using Superscript II, following the manufacturer’sinstructions. Real-time PCR was performed using SYBRGreen asymmetrical cyanine dye (TaKaRa Bio, Shiga,Japan) on a 7500 Fast Real-time PCR System (AppliedBiosystems, Foster City, CA, USA). Real-time primer se-quences are listed in Table 1. Real-time PCR conditionswere as follows: 95 �C for 30 seconds and then 40 cycles at95 �C for 3 seconds and 60 �C for 30 seconds, followed bydissociation stage for bovine Wnt2, Wnt5b, Fzd4, b-cat-enin, LEF-1, and Dkk-1. The relative quantification method(2�DDct) was used to determine the mRNA abundance of

Fig. 1. Differential expression of Wnt2, Wnt5b, Fzd4, Dkk-1, b-catenin, and LEF-1Expression levels of Wnt2 (A), Wnt5b (B), Fzd4 (C), Dkk-1 (D), b-catenin (E), and LEF-1to 120 days were analyzed by SYBR Green Real-time PCR. Wnt2, Dkk-1, b-catenin anand caruncle tissues during bovine placentation, respectively. Values are expressedcommon letter differed (P < 0.05).

the genes. All values are presented as mean � SD. Com-parisons of expression levels of Wnt2, Wnt5b, Fzd4, b-catenin, LEF-1, and Dkk-1 mRNA relative to glyceraldehyde3-phosphate dehydrogenase in cotyledon and caruncletissues on 31 to 60, 61 to 90, and 91 to 120 days ofgestation were performed with SAS 9.0 statistical software(SAS Institute Inc., Cary, NC, USA) using one-way ANOVA,followed by the Tukey–Kramer test. A P value <0.05 wasconsidered significant.

2.4. In situ hybridization of Wnt2, Wnt5b, Fzd4, b-catenin,and Dkk-1

For in situ hybridization, sense and antisense 35S-labeledcRNAprobeswere generatedusing appropriate polymerases.

mRNA in the cotyledon and caruncle tissues during bovine placentation.(F) mRNA in the bovine placentome on gestational 31 to 60, 61 to 90, and 91d Wnt5b, Fzd4, LEF-1 mRNA was expressed at higher levels in the cotyledonas mean � SD from at least three independent samples. a–eValues without a

Fig. 2. Periodic acid–Schiff (PAS) staining of the bovine placentome. PASstaining of bovine placentome on gestational 61 to 90 days (b was an ampli-ficationproduct of a). The binucleate andmaternal caruncle stromal cellswerestrongly PAS-positive, but no staining was observed in the caruncle epithelialcells. CE, caruncular epithelium; CS, caruncular stroma; BNC, trophoblastbinucleate cells; MPV, mesenchyme of primary villi; MSV, mesenchyme ofsecondary villi; and T, trophoblast. In all panels, the scale bars ¼ 200 mm.

W. Lu et al. / Theriogenology 80 (2013) 893–902896

For probe generation, we first designed primers to producecDNA specific to Wnt2, Wnt5b, Fzd4, b-catenin, and Dkk-1.After gel extraction, the cDNA was placed into the pGM-Tvector and then amplified. Next, vectors were digested withappropriate restriction enzymes to acquire sufficientamounts of linear cDNA for each molecule. The total volumeof the labeling reactionwas 15 mL, which included 3 mL of 5�RNApolymerasebuffer (Promega, Fitchburg,WI,USA), 3mLof2.5 mMGTP/UTP/ATP (Promega), 1.5 mL of 100 mMDTT, 5 mLof 35S-CTP, 0.55 mL of RNA polymerase, and 0.95 mL of cDNAplusddH2O.The reactionwas initiallycarriedoutat37 �C for2hours, and then treatedwith1mLofDNaseat37 �C for 10 to15minutes. Next, 1 mL of tRNA, 4 mL of ammonium acetate, and65 mL of ethyl alcohol was added and reacted at �80 �C in afreezer for 1 hour. Then, the tubes were centrifuged at 16800� g for 20 to 30 minutes at 4 �C, the supernatant was dis-carded, and the pellet was dried for 10 to 15minutes. Finally,the pellet was dissolved in 22 mL of diethylpyrocarbonate-treated water. In situ hybridization probe sequences and

polymerases used in this study are listed in Table 2. Theprotocol employed in this study was described elsewhere[25]. Briefly, frozen sections (10 mm) were mounted ontopoly-L-lysine–coated slides and then fixed in 4% (wt/vol)paraformaldehyde in PBS for 15 minutes at 4 �C. Followingprehybridization, placental sections were hybridized to 35S-labeled Wnt2, Wnt5b, Fzd4, b-catenin, and Dkk-1 sense orantisense cRNA probes for 4 hours at 45 �C. After hybridiza-tionandwashing, the slideswere incubatedwithRNaseA (20mg/mL) at 37 �C for 15 minutes. RNase A–resistant hybridswere detected after 1 to 3 weeks of autoradiography usingliquid emulsion. The slides were poststained with hematox-ylin and eosin. Sections hybridizedwith the sense probes didnot exhibit any positive signals and served as negativecontrols.

2.5. Immunofluorescent and immunohistochemical analyses

Paraffin-embedded, 5-mm-thick, bovine, placental tis-sue sections were deparaffinized, immersed in retrievalsolution (10 mM sodium citrate), heated in a high-pressure autoclave, blocked with 0.5% BSA-PBS, and thenincubated overnight at room temperature with primaryantibodies against Dkk-1 (rabbit polyclonal antibodydiluted to 1:100; Santa Cruz Biotechnology, Inc., SantaCruz, CA, USA; cat. no.: sc25516, 1:100) and b-catenin(rabbit monoclonal antibody diluted to 1:100; Epitomics,Inc., Burlingame, CA, USA; cat. no.: 1247-1). For immu-nofluorescence, localization of the primary antibody wasperformed by incubation of the sections with Cy3-conjugated donkey anti-rabbit IgG (Jackson ImmunoR-esearch Laboratories, Inc., West Grove, PA, USA; cat. no.:711-165-152; dilution, 1:200). Finally, nuclei were stainedwith Hoechst stain. Immunofluorescence staining signalswere captured via confocal scanning laser microscopy(LSM 710; Carl Zeiss AG, Oberkochen, Germany) asdescribed [26]. For immunohistochemical analysis, locali-zation of the primary antibody was detected by incubationof the sections with goat anti-rabbit antibody (ZB-2301;ZSGB-Bio, Beijing, China) in 3,30-diaminobenzidine tetra-hydrochloride (ZSGB-Bio).

3. Results

3.1. Differential expression of Wnt2, Wnt5b, Fzd4, b-catenin,LEF-1, and Dkk-1 mRNA in the cotyledon and caruncle tissuesduring bovine placentation

Bovine placentomes comprised two individual hetero-geneous tissues, the cotyledon and caruncle tissues. Toexplore the physiological significance of Wnt signaling inbovine placental development, SYBR Green Real-time PCRwas used to quantitatively compare expression profiles of19 Wnt ligands and 10 Frizzled receptors between coty-ledon and caruncle tissues. Among the various genesidentified as differentially expressed, we chose severalabundantly expressed genes in cotyledon and caruncletissues at various ages of gestation, namely, Wnt2, Wnt5b,Fzd4, b-catenin, LEF-1, and Dkk-1. As illustrated in Figure 1,the expression levels of Wnt2, Dkk-1, and b-catenin mRNAwere significantly higher in the cotyledon compared with

Fig. 3. In situ hybridization analyses of Wnt2 (A) and Wnt5b (B) mRNA expression in the bovine placentome. (A, B) Cell-specific expression of Wnt2 and Wnt5bmRNA by in situ hybridization in the bovine placentome, respectively. a, b, and c show the localization of bovineWnt2 andWnt5bmRNA in the bovine placentomeon gestational 31 to 60, 61 to 90, and 91 to 120 days, respectively. a0 , b0 , c0 , and d0 are magnifications of a, b, c, and d, respectively. d and d0 were sections hybridizedwith the sense probes. Wnt2 mRNA was more abundantly expressed in trophoblasts compared with caruncle epithelial cells, whereas Wnt5b mRNA was mostlocalized to caruncle epithelial cells and trophoblasts of the cotyledon in the placentome, but not caruncle stroma cells. CE, caruncular epithelium; CS, caruncularstroma; BNC, trophoblast binucleate cells; MPV, mesenchyme of primary villi; MSV, mesenchyme of secondary villi; and T, trophoblast. In all panels, the scalebars ¼ 200 mm.

W. Lu et al. / Theriogenology 80 (2013) 893–902 897

those in caruncle tissue (Fig. 1A, D, and E). Similarly, themean Wnt2 level in the cotyledon tissues was significantlyhigher at 31 to 60 days of gestation compared with that at61 to 90 and 91 to 120 days of gestation, but no significantdifference was observed in the cotyledon tissues at 61 to90 and 91 to 120 days of gestation (Fig. 1A). In contrast,Wnt5b, Fzd4, and LEF-1 mRNAwas highly expressed in thecaruncle tissues (Fig. 1B, C, and F). Dkk-1 mRNA expressionwas significantly higher in the cotyledon tissue comparedwith that in caruncle tissue. For example, the mean levelof Dkk-1 mRNA was more than fourfold higher in 31 to 60days cotyledon tissues and approximately twofold tothreefold higher at 61 to 90 and 91 to 120 days of gesta-tion than those in the caruncle tissues, respectively(Fig. 1D). Therefore, Wnt2, Dkk-1, and b-catenin expres-sion tended to be primarily derived from trophoblasts inthe cotyledon.

3.2. Cell-specific localization of Wnt2, Wnt5b, and Fzd4 in thebovine placentome

To reveal the cell-specific expression pattern of Wnt2,Wnt5b, Fzd4, b-catenin, and Dkk-1 in the bovine pla-centome, we first conducted periodic acid-Schiff staining todistinguish cell types within these tissues (Fig. 2). Next, weconducted in situ hybridization analysis. As illustrated inFigure 3A, Wnt2 mRNA was distinctly expressed in coty-ledon tissues, consistent with the real-time PCR results.Moreover, according to the magnifying pictures, it seemedthat Wnt2 expressed at low levels in caruncle epithelialcells at 31 to 60, 61 to 90, and 91 to 120 days of gestation,but not in caruncle stroma cells. In addition, as shown inFigure 3B, Wnt5b mRNA was detected in caruncle tissuesand cotyledon tissues at 31 to 60, 61 to 90, and 91 to 120days of gestation, but not likely in caruncle stroma cells.

Fig. 4. Cell-specific expression of bovine Fzd4 mRNA by in situ hybridization in the bovine placentome. a, b, and c show the localization of Fzd4 mRNA in thebovine placentome on gestational 31 to 60, 61 to 90, and 91 to 120 days, respectively. a0 , b0 , c0 , and d0 are magnifications of a, b, c, and d, respectively. d and d0 weresections hybridized with the sense probes. Fzd4 mRNAwas primarily detected in BNCs and the caruncle epithelial cells. CE, caruncular epithelium; CS, caruncularstroma; BNC, trophoblast binucleate cells; and MSV, mesenchyme of secondary villi. In all panels, the scale bars ¼ 200 mm.

W. Lu et al. / Theriogenology 80 (2013) 893–902898

However, more legible pictures were needed to confirm thecellular localization of Wnt2 and Wnt5b. As illustrated inFigure 4, Wnt receptor Fzd4 mRNA was most abundantlyexpressed in BNCs and the caruncle epithelial cells at 31 to60, 61 to 90, and 91 to 120 days of gestation, but not in thecaruncle stromal cells.

3.3. Spatiotemporal expression of the Wnt inhibitorymolecule Dkk-1 during bovine placental development

To reveal whether Wnt signaling was regulated by itssecreted inhibitory proteins, we employed in situ hy-bridization to reveal the spatiotemporal expression of

Fig. 5. In situ hybridization (A) and immunofluorescence analyses (B) of Dkk-1 mRNA expression in the bovine placentome. (A) Cell-specific expression of Dkk-1mRNA in the bovine placentome. a, b, and c show the localization of bovine Dkk-1 mRNA in the bovine placentome on gestational 31 to 60, 61 to 90, and 91 to 120days, respectively. a0 , b0 , c0 , and d0 are magnifications of a, b, c, and d, respectively. d and d0 show sections hybridized with the sense probes. Dkk-1 mRNA waslocalized to trophoblast binucleate cells in the placentome. (B) Dkk-1 localization in the caruncles, fetal cotyledons, and placentomes on gestational 31 to 60 days(a, b, and c), 61 to 90 days (d, e, and f), and 91 to 120 days (g, h, and i). a, d, and g show immunolocalization of Dkk-1 in the caruncles on gestational 31 to 60, 61 to90, and 91 to 120 days, respectively. b, e, and h show the immunolocalization of Dkk-1 in the cotyledons on gestational 31 to 60, 61 to 90, and 91 to 120 daysgestation, respectively. c, f, and i represent the immunolocalization of Dkk-1 in the placentomes on gestational 31 to 60, 61 to 90, and 91 to 120 days, respectively.CE, caruncular epithelium; CS, caruncular stroma; BNC, trophoblast binucleate cells; MPV, mesenchyme of primary villi; MSV, mesenchyme of secondary villi; andFCO, fetal cotyledon. In all panels, the scale bars ¼ 100 mm.

W. Lu et al. / Theriogenology 80 (2013) 893–902 899

Dkk-1 in the placentome tissues. As illustrated inFigure 5A, Dkk-1 mRNA was distinctly expressed in tro-phoblasts of the cotyledon at 31 to 60, 61 to 90, and 91 to120 days of gestation, whereas its expression remainedundetectable in the caruncle tissues. Moreover, to furtherconfirm the cell-specific expression of Dkk-1 in the coty-ledon, caruncle, and placentome tissues, we subsequentlyperformed immunofluorescence staining analysis. Asshowed in Figure 5B, Dkk-1 was prominently expressed inthe cytoplasm of BNCs. However, some positive staining ofDkk-1 was also visualized in caruncle tissues.

3.4. Spatiotemporal expression and cellular localization of b-catenin in the bovine placentome

To explore the canonical Wnt signaling pathway dur-ing placental development, we subsequently analyzed thespatiotemporal expression of b-catenin in the bovineplacentome. As illustrated in Figure 6A, b-catenin wasdistinctly expressed in trophoblasts of the fetal cotyledon.In contrast, b-catenin expression was undetectable incaruncle epithelial cells. Interestingly, b-catenin expres-sion in BNCs was stronger than in UTCs. Moreover, toreveal the cellular localization of b-catenin in the pla-centome tissues, we performed immunohistochemicalstaining analysis. As shown in Figure 6B, intracellularaccumulation and nuclear translocation of b-catenin wasobviously visualized in the BNCs. However, there werealso some BNCs with no or very weak nuclear staining ofb-catenin.

4. Discussion

Many studies have reported that trophoblasts playcrucial roles inplacental formationvia production of variousbiological substances, including cytokines, growth factors,and steroid hormones [27–30]. These signaling moleculesare associated with placental development, fetal growth,and development, as well as maintenance of pregnancy. Forexample, theWnt signalingmolecules have important rolesin human and mouse placental development processes.However, the role of Wnt signaling pathway, a potentiallyimportant developmental regulatorduring bovine placentaldevelopment, has remained largely unknown. Herein, wereported thatWnt2mRNAwasmore abundant in cotyledontissues compared with caruncle tissues, whereas Wnt5bmRNA was more abundant in caruncle tissues comparedwith the cotyledon tissues. However, in the ovine pla-centome, Wnt2 mRNA was detected primarily in the endo-metrial stroma andWnt5bmRNAwas themost abundant inthe stroma underlying the caruncle epithelial cells withlower abundance in endometrial epithelia [12]. Althoughthe expression pattern of noncanonical Wnt5b in placentaltissues has not been reported, Wnt5b mRNA was moreabundant in the ovine endometrial stroma compared withthe luminal epithelium [12], and significantly higher in thehuman uterine leiomyoma cells than in normal myometrialcells [31]. These findings indicated species-specific expres-sion patterns of Wnt2 and Wnt5b in bovine trophoblastsduring placental development.

In this study, Fzd4 mRNA was primarily detected inBNCs and caruncle epithelial cells. Considering the fusion

Fig. 6. In situ hybridization (A) and immunohistochemical (B) analyses of b-catenin mRNA and protein levels in the bovine placentome. (A) Cell-specificexpression of bovine b-catenin mRNA by in situ hybridization in placentomes. a, b, and c show the localization of bovine b-catenin mRNA in placentomes on31 to 60, 61 to 90, and 91 to 120 days of gestation, respectively. a0 , b0 , c0 , and d0 are magnifications of a, b, c, and d, respectively. d and d0 were sections hybridizedwith the sense probes. The b-cateninmRNAwas localized to trophoblasts in the placentome, but not maternal caruncle tissues. (B) Immunohistochemical stainingof the b-catenin protein in the placentome on gestational 31 to 60 days (a and a0), 61 to 90 days (b and b0), and 91 to 120 days (c and c0). a0 , b0 , and c0 aremagnifications of a, b, and c, respectively. The b-catenin protein was prominently localized in the cytoplasm and the nucleus of the binucleate trophoblasts. CE,caruncular epithelium; CS, caruncular stroma; BNC, trophoblast binucleate cells; MSV, mesenchyme of secondary villi; and T, trophoblast. In all panels, the scalebars ¼ 200 mm.

W. Lu et al. / Theriogenology 80 (2013) 893–902900

process of BNCs and caruncle epithelial cells, we reasonedthat Fzd4may have an important role during this process information of trinucleate cells. In addition, because theoveractivation of Fzd4 was shown to disrupt embryonicangiogenesis [32], we speculated that Fzd4 may beinvolved in regulation of bovine placental angiogenesis.However, further studies are needed to verify these sup-positions. Moreover, these results were consistent withthose derived from our quantitative analysis, with higherexpression levels than Wnt5b, LEF-1, and Wnt2, b-cateninin the caruncle and cotyledon tissues, respectively. There-fore, it is conceivable that Fzd4 plays an important role inbovine placental development.

DKK-1 plays an important role in pregnancy and wasdetectable in stromal cells in the secretary phase of themenstrual cycle, but with very low expression levels in theproliferative phase [33]. In addition, treatment with re-combinant DKK-1 suppressed Ishikawa cell invasivenessin vitro [34].We inferred that DKK-1may have an importantrole in the bovine placenta. The detection of DKK-1 incaruncle tissues could bedue to thefirmanchoragebetween

the cotyledon and caruncle tissues, because it was almostimpossible to exclude neighboring tissue in each sample[35]. In fact, previous evidence confirmed the presence ofcotyledon tissue in the caruncular sample before gestationalDay 140 [36]. Therefore, Dkk-1–positive cells in the caruncletissues could indicate remnant trophoblasts after mechan-ical isolation of these tissues. In addition, migration ofmature BNCs may also cause this result, because BNCs andindividual uterine epithelial cells can fuse into transienttrinucleate cells, which die after the BNCs release theirgranules [37]. Our results confirmedDkk-1 expression in thecytoplasm; therefore, we speculated that Dkk-1 might alsobe released into the caruncle tissues upon BNC granulerelease, which led to this outcome.

b-Catenin is an integral cell-cell adhesion adaptor pro-tein as well as a transcriptional coregulator of the Wntpathway. In the absence of the Wnt ligand, b-catenin istargeted for degradation by the adenomatous polyposiscoli/axin/glycogen synthase kinase 3b (GSK-3b) complex,whereas in the presence of Wnt ligand stimulation, thebinding to an Fzd family receptor and an LRP5/6 family

W. Lu et al. / Theriogenology 80 (2013) 893–902 901

coreceptor inhibits activation of the adenomatous polypo-sis coli/axin/GSK3b destruction complex, leading to thestabilization of b-catenin and its translocation to the nu-cleus to interact with transcription factor (TCF)/lymphoidenhancer-binding factor (LEF) family transcription factors.Binding of b-catenin to TCF/LEF proteins provides a tran-scription activation domain through which target geneexpression is activated. The localization of active b-cateninwas consistent with Dkk-1 in the BNCs, which was inaccordance with a previous report that indicated that DKK-1 was a direct target gene of the canonical Wnt pathway toregulate this signaling pathway. In normal human villoustrophoblastic tissue, b-catenin is localized to the cytoplasmand along the lateral and apical surfaces of cytotropho-blasts [23]. Moreover, b-catenin expression is upregulatedin preeclampsia. Thus, altered b-catenin expression mayplay a role in normal and pathologic placental development[38]. In this regard, our present findings of differentiallocalization of b-catenin localization in the UTCs, asopposed to the BNCs, suggested that the Wnt/b-catenincanonical signaling pathwaymay have an important role inregulation of secretory BNC activities and the subsequentformation of fetomaternal syncytium, ensuring normalfetal-maternal recognition and pregnancy maintenance incattle.

Furthermore, in this study, Dkk-1, Fzd4, and b-cateninwere similarly expressed in BNCs, indicating that Dkk-1may bind to the Fzd receptor and prevent Wnt ligandinteraction with the Fzd receptors or it may bind to andinactivate the Wnt-Fzd complex, thereby impeding nucleartranslocation of b-catenin and subsequently inhibiting theWnt/b-catenin canonical signaling pathway. The nucleartranslocation of b-catenin indicated that theWnt/b-catenincanonical signaling pathway was activated and the LEF-1results indicated that LEF-1 was primarily expressed incaruncle tissues. Therefore, we speculated that the Wnt/b-catenin canonical signaling pathway may regulate bovineplacental development. However, this hypothesis willrequire further experimentation to confirm. In addition,there was a report [39] that Dkk-1 expression was down-regulated in bovine placental tissue after somatic cell nu-clear transfer, in which abnormal placental developmentoccurred. These observations suggest that dysregulation ofthe Wnt signaling pathway may have led to the abnormaldevelopment. Further research on the functions andmechanisms of Wnt pathway components during bovineplacental development should provide insights regardingabnormal placental development in bovine somatic cellnuclear transfer.

In conclusion, we used multiple approaches to demon-strate a spatiotemporal expression pattern of specificWnt pathway components in the bovine placentome,which provided new evidence that Wnt2, Wnt5b, Fzd4,b-catenin, LEF-1, and Dkk-1 expression in trophoblasts mayhave important physiological roles during bovine placentaldevelopment.

Acknowledgments

The authors thank the laboratory members for theirassistance with tissue collection and sectioning. This work

was partially supported by the Beijing Natural ScienceFoundation (5091002) and the National Natural ScienceFoundation (grant nos.: 30825015, 81130009). Wengeng Luwas supported by a grant from the China PostdoctoralScience Foundation (grant no.: 20100480463).

Disclosure Statement: The authors declare no conflictsof interest.

References

[1] Shimada A, Nakano H, Takahashi T, Imai K, Hashizume K. Isolationand characterization of a bovine blastocyst-derived trophoblasticcell line, BT-1: development of a culture system in the absence offeeder cell. Placenta 2001;22:652–62.

[2] Nakano H, Shimada A, Imai K, Takezawa T, Takahashi T,Hashizume K. Bovine trophoblastic cell differentiation on collagensubstrata: formation of binucleate cells expressing placental lac-togen. Cell Tissue Res 2002;307:225–35.

[3] Klisch K, Wooding FB, Jones CJ. The glycosylation pattern of secre-tory granules in binucleate trophoblast cells is highly conserved inruminants. Placenta 2010;31:11–7.

[4] Wooding FB. Current topic: the synepitheliochorial placenta of ru-minants: binucleate cell fusions and hormone production. Placenta1992;13:101–13.

[5] Green JA, Xie S, Roberts RM. Pepsin-related molecules secreted bytrophoblast. Rev Reprod 1998;3:62–9.

[6] Ogren L, Talamantes F. The placenta as an endocrine organ:poly-peptides. In: Knobil E, Neill JD, editors. The physiology ofreproduction. Second edition. New York: Ravan Press; 1994. p. 875–945.

[7] Morgan G, Wooding FB, Beckers JF, Friesen HG. An immunologicalcryo-ultrastructural study of a sequential appearance of proteins inplacental binucleate cells in early pregnancy in the cow. J ReprodFertil 1989;86:745–52.

[8] Xie SC, Low BG, Nagel RJ, Kramer KK, Anthony RV, Zoli AP, et al.Identification of the major pregnancy-specific antigens of cattle andsheep as inactive members of the aspartic proteinase family. ProcNatl Acad Sci USA 1991;88:10247–51.

[9] Kohan-Ghadr HR, Smith LC, Arnold DR, Murphy BD, Lefebvre RC.Aberrant expression of E-cadherin and beta-catenin proteins inplacenta of bovine embryos derived from somatic cell nucleartransfer. Reprod Fertil Dev 2012;24:588–98.

[10] Wang HY, Malbon CC. Wnt signaling, Ca2þ, and cyclic GMP: visu-alizing Frizzled functions. Science 2003;300:1529–30.

[11] Sonderegger S, Pollheimer J, Knofler M. Wnt signalling in implan-tation, decidualisation and placental differentiation–review.Placenta 2010;31:839–47.

[12] Hayashi K, Burghardt RC, Bazer FW, Spencer TE. WNTs in the ovineuterus: potential regulation of periimplantation ovine conceptusdevelopment. Endocrinology 2007;148:3496–506.

[13] Monkley SJ, Delaney SJ, Pennisi DJ, Christiansen JH, Wainwright BJ.Targeted disruption of the Wnt2 gene results in placentation de-fects. Development 1996;122:3343–53.

[14] Parr BA, Cornish VA, Cybulsky MI, McMahon AP. Wnt7b regulatesplacental development in mice. Dev Biol 2001;237:324–32.

[15] Lu J, Zhang S, Nakano H, Simmons DG,Wang S, Kong S, et al. A positivefeedback loop involving gcm1 and fzd5 directs chorionic branchingmorphogenesis in the placenta. PLoS Biol 2013;11:e1001536.

[16] Ishikawa T, Tamai Y, Zorn AM, Yoshida H, Seldin MF, Nishikawa S,et al. Mouse Wnt receptor gene Fzd5 is essential for yolk sac andplacental angiogenesis. Development 2001;128:25–33.

[17] Galceran J, Farinas I, Depew MJ, Clevers H, Grosschedl R. Wnt3a-/–like phenotype and limb deficiency in Lef1(-/-)Tcf1(-/-) mice. GenesDev 1999;13:709–17.

[18] Bafico A, Liu G, Yaniv A, Gazit A, Aaronson SA. Novel mechanism ofWnt signalling inhibition mediated by Dickkopf-1 interaction withLRP6/Arrow. Nat Cell Biol 2001;3:683–6.

[19] Mao B, Wu W, Li Y, Hoppe D, Stannek P, Glinka A, et al. LDL-re-ceptor-related protein 6 is a receptor for Dickkopf proteins. Nature2001;411:321–5.

[20] Semenov MV, Tamai K, Brott BK, Kuhl M, Sokol S, He X. Headinducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Curr Biol2001;11:951–61.

[21] Peng S, Li J, Miao C, Jia L, Hu Z, Zhao P, et al. Dickkopf-1 secreted bydecidual cells promotes trophoblast cell invasion during murineplacentation. Reproduction 2008;135:367–75.

W. Lu et al. / Theriogenology 80 (2013) 893–902902

[22] Sonderegger S, Husslein H, Leisser C, Knofler M. Complex expressionpattern of Wnt ligands and frizzled receptors in human placentaand its trophoblast subtypes. Placenta 2007;28(Suppl A):S97–102.

[23] Pollheimer J, Loregger T, Sonderegger S, Saleh L, Bauer S, Bilban M,et al. Activation of the canonical wingless/T-cell factor signalingpathway promotes invasive differentiation of human trophoblast.Am J Pathol 2006;168:1134–47.

[24] Habermehl K-H. Die Altersbestimmung beim Hauswiederkäuer. DieAltersbestimmung bei Haus- und Labortieren. Berlin: Verlag PaulParey; 1975. p. 62–3.

[25] Das SK, Wang XN, Paria BC, Damm D, Abraham JA, Klagsbrun M,et al. Heparin-binding EGF-like growth factor gene is induced in themouse uterus temporally by the blastocyst solely at the site of itsapposition: a possible ligand for interaction with blastocyst EGF-receptor in implantation. Development 1994;120:1071–83.

[26] Wang X, Wang H, Matsumoto H, Roy SK, Das SK, Paria BC. Dualsource and target of heparin-binding EGF-like growth factor duringthe onset of implantation in the hamster. Development 2002;129:4125–34.

[27] Spencer TE, Sandra O, Wolf E. Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionismand thoughts on holistic approaches. Reproduction 2008;135:165–79.

[28] Suzuki Y, Koshi K, Imai K, Takahashi T, Kizaki K, Hashizume K. Bonemorphogenetic protein 4 accelerates the establishment of bovinetrophoblastic cell lines. Reproduction 2011;142:733–43.

[29] Tsampalas M, Gridelet V, Berndt S, Foidart JM, Geenen V, Perrierd’Hauterive S. Human chorionic gonadotropin: a hormone withimmunological and angiogenic properties. J Reprod Immunol 2010;85:93–8.

[30] Marikawa Y, Tamashiro DA, Fujita TC, Alarcon VB. Aggregated P19mouse embryonal carcinoma cells as a simple in vitro model tostudy the molecular regulations of mesoderm formation and axialelongation morphogenesis. Genesis 2009;47:93–106.

[31] Mangioni S, Vigano P, Lattuada D, Abbiati A, Vignali M, Di Blasio AM.Overexpression of the Wnt5b gene in leiomyoma cells: implicationsfor a role of the Wnt signaling pathway in the uterine benign tumor.J Clin Endocrinol Metab 2005;90:5349–55.

[32] Ye X, Wang Y, Cahill H, Yu M, Badea TC, Smallwood PM, et al.Norrin, frizzled-4, and Lrp5 signaling in endothelial cellscontrols a genetic program for retinal vascularization. Cell 2009;139:285–98.

[33] Tulac S, Nayak NR, Kao LC, Van Waes M, Huang J, Lobo S, et al.Identification, characterization, and regulation of the canonical Wntsignaling pathway in human endometrium. J Clin Endocrinol Metab2003;88:3860–6.

[34] Yi N, Liao QP, Li T, Xiong Y. Novel expression profiles andinvasiveness-related biology function of DKK1 in endometrial car-cinoma. Oncol Rep 2009;21:1421–7.

[35] Bridger PS, Haupt S, Klisch K, Leiser R, Tinneberg HR, Pfarrer C.Validation of primary epitheloid cell cultures isolated from bovineplacental caruncles and cotyledons. Theriogenology 2007;68:592–603.

[36] Shemesh M, Hansel W, Strauss 3rd JF. Modulation of bovineplacental prostaglandin synthesis by an endogenous inhibitor.Endocrinology 1984;115:1401–5.

[37] Wooding FB, Beckers JF. Trinucleate cells and the ultrastructurallocalisation of bovine placental lactogen. Cell Tissue Res 1987;247:667–73.

[38] Li HW, Cheung AN, Tsao SW, Cheung AL, O WS. Expression ofe-cadherin and beta-catenin in trophoblastic tissue in normaland pathological pregnancies. Int J Gynecol Pathol 2003;22:63–70.

[39] Ledgard A, Lee RS, Couldrey C, Peterson J. Dickkopf-1 expressionduring early bovine placentation and its down-regulation in somaticcell nuclear transfer (SCNT) pregnancies. J Reprod Dev 2009;55:467–74.