Enzyme and Microbial Technology 39 (2006) 399–406

Solubility dependency of co-expression effects of stress-inducedprotein Dps on foreign protein expression in Escherichia coli

Young Soo Kim, Hyung Joon Cha ∗Department of Chemical Engineering, Divisieon of Molecular and Life Sciences, Pohang University of Science and Technology,

Pohang 790-784, Republic of Korea

Received 22 September 2005; received in revised form 25 October 2005; accepted 10 November 2005

Abstract

The over-expression of foreign proteins imposes metabolic burden on host strains that may lead to reduced cell growth and even yield of targetprotein. We investigated dependency of co-expression effects of stress-induced non-specific DNA-binding protein, Dps, on cell growth and foreignprotein expression according to solubility in Escherichia coli. Dps co-expression showed clear distinct effects according to solubility of targetproteins. Under co-expression of recombinant Dps, cell growth for the strain expressing baculoviral polyhedrin (Polh)-green fluorescent protein(GFP) fusion protein or human interleukin-2 (hIL-2) that were expressed as insoluble inclusion body had tendency to decline slightly comparedtsyegp©

K

1

mtams(Dawg

tg

0d

o each Dps non-expressing strain. However, cell growth for the strain expressing soluble GFP or mussel adhesive protein type 5 (Mgfp-5) wasomewhat increased. While Dps co-expression had somewhat negative effects on expression of soluble protein, it showed huge impacts on productield of insoluble proteins (1.6–1.8-fold for Polh-GFP and 4–5-fold for hIL-2). Therefore, it was obvious that co-expression of Dps has differentffects on foreign protein production according to solubility. Proteomic analyses revealed that Dps co-expression induced significantly differentlobal patterns through interaction with target foreign protein according to target solubility. These global pattern alterations might be favorable forroduction of insoluble foreign proteins indirectly.

2006 Elsevier Inc. All rights reserved.

eywords: Escherichia coli; Non-specific DNA binding protein; Dps; Cellular stress; Solubility; 2D gel electrophoresis

. Introduction

Non-specific DNA-binding protein, Dps, which is one of theany stress proteins has ferritin-like structure and plays a protec-

ion role on DNA damage by substitute oxidation of Fe2+ to Fe3+

gainst oxygen radical or acetic stress produced from generaletabolism [1]. Dps is highly produced not only from oxidative

tress, but also under a stationary phase that imposes nutrientamino acid or carbon source) starvation stress [2,3]. Actually,ps is a major protein component of the nucleoid in the station-

ry phase [4]. Dps forms extremely stable complexes with DNA,ithout apparent sequence specificity and causes compaction ofenomic DNA and silencing of the genomic function [3,4].

Cells undergo many changes including alterations in the pat-erns of gene expression as well as protein stability during theirrowth when exposed to chemical or physical stresses such as

∗ Corresponding author. Tel.: +82 54 279 2280; fax: +82 54 279 2699.E-mail address: hjcha@postech.ac.kr (H.J. Cha).

heat shock [5,6], oxygen radical [7,8], various toxic chemicals[9,10], viral infection [11], the presence of abnormal proteins[12,13], the over-expression of heterologous proteins [14–16],and nutrient limitation (carbon source, amino acid source, etc.)[17,18]. By changing the transcriptional pattern of genes andproducing several stress proteins, cells can resist environmentalstresses. Among these stresses, overproduction of heterologousprotein imposes usually metabolic burden stress. Subsequently,cell growth decreases and the final yield of target protein isalso reduced by this stress [19–22]. Therefore, it is important toreduce metabolic burden by foreign protein over-expression inorder to obtain enhanced production yield.

It was reported that expression of Dps was down-regulatedunder the overproducing condition of insoluble recombinantprotein in Escherichia coli [14]. In our previous work, weshowed co-expression of Dps was able to highly enhance pro-duction of insoluble recombinant fusion protein that is composedof baculoviral polyhedrin (Polh) and green fluorescent protein(GFP) in E. coli [23]. In the present work, we investigated depen-dency of Dps co-expression effects on cell growth and foreign

141-0229/$ – see front matter © 2006 Elsevier Inc. All rights reserved.oi:10.1016/j.enzmictec.2005.11.040

400 Y.S. Kim, H.J. Cha / Enzyme and Microbial Technology 39 (2006) 399–406

protein expression according to solubility of foreign protein inE. coli cells. As insoluble model foreign proteins, Polh-GFPfusion protein [24] and human interleukin-2 (hIL-2) [25,26]were employed. Also, GFP [26,27] and mussel adhesive pro-tein Mgfp-5 [28] were used as soluble targets.

2. Materials and methods

2.1. Bacterial strains

E. coli TOP10 [F− mcrA�(mrr-hsdRMS-mcrBC)�801acZ�M15 �lacX74deoR recA1 araD139 �(ara-leu)7697 galU galK rpsL (Strr) endA1 nupG] (Invit-rogen, Carlsbad, CA, USA) was used for plasmid construction. E. coli BL21 [F−ompT hsdSB (rB

− mB−) gal dcm] was used as a host strain for expression offour model foreign proteins.

2.2. Construction of recombinant plasmids

Polymerase chain reaction (PCR) was performed using a Thermocycler(MJ Research, Watertown, MA, USA). Plasmid DNA was extracted from E.coli Top10 using alkaline lysis method with silica [29,30]. DNA manipula-tion such as restriction digestion, ligation, transformation, and purification wereperformed by using the standard protocol [30,31] or the manufacturer’s specifi-cation. All recombinant plasmid constructions were based on pTrcHisC vector(Invitrogen) that contains a haxahistidine (His6) tag at the N-terminus for simpledetection by Western blot, and a trc promoter that is inducible by isopropyl-�-d-thiogalactopyranoside (IPTG). pYS01 [23] that contains dps gene was used asa target free plasmid and a template for PCR to obtain dps gene with ribosomebinding site (RBS) and His tag at the N-terminus. pMPL102 [24] that con-twp5

Finally, pYS04, pYS06, and pYS08 were constructed by inserting dps genescontaining RBS into pYS03, pMDG05, and pYS07 using the same method aspYS02 (Fig. 1). Primer sequences for PCR in this work are shown in Table 1.

2.3. Media and culture conditions

For strain construction, cells were grown in Luria-Bertani (LB) medium.The constructed transformant harboring plasmid was stored at −80 ◦C. All cul-tures used for measuring physiological characteristics were performed in M9media (6 g l−1 Na2HPO4, 3 g l−1 KH2PO4, 1 g l−1 NH4Cl, 0.5 g l−1 NaCl, 2 mMMgSO4, 0.1 mM CaCl2) with 0.5% (w/v) glucose as a sole carbon source inErlenmeyer flasks at 37 ◦C in an air shaking incubator with a gyration rate of250 rpm. One milliliter of freezer stock was grown overnight (12 h) at 37 ◦C in10 ml M9 medium in a 50 ml conical tube. The volume of seed culture whichcould adjust the initial optical density (at 600 nm, OD600) of final culture media to0.2 was transferred to 50 ml M9 media in a 250 ml flask. Ampicillin (50 �g ml−1)(Sigma, St. Louis, MO, USA) was added as a selection pressure for plasmid-harboring strains. When the cultures were grown to OD600 of about 1.0, 1 mM(as final concentration) IPTG (Sigma) was added to culture broth for inductionof recombinant protein expression.

2.4. Cell density and GFP fluorescence intensity

Cell growth was monitored by optical density at 600 nm on a UV–visiblespectrophotometer (UV-1601PC, Shimadzu, Kyoto, Japan). Whole cell GFPassay was directly performed by measuring fluorescence intensity of the culturebroth sample using a fluorescence spectrophotometer (RF-5301PC; Shimadzu)at an excitation wavelength of 395 nm and emission at 509 nm.

2.5. SDS-PAGE and Western blot analysis

fp

FaL

6

ains fusion genes of polh and gfp was used as Dps free control plasmid. pYS02as constructed inserting amplified dps containing RBS into pMPL102. pYS03,MDG05 [28], and pYS07 were constructed by inserting amplified gfp, mgfp-, and hil-2 into pTrcHisC using the same method as pMPL102 construction.

ig. 1. Gene maps of recombinant plasmids. Abbreviations: dps, Dps gene; polh, badhesive protein type 5 gene; hil-2, human interleukin-2 gene; His6, hexahistidine tac repressor; ColE1, replication origin.

One milliliter of the culture was harvested by centrifugation at 12,000 rpmor 5 min at 4 ◦C. The supernatant was discarded and then pellet was resus-ended with 100 �l of protein sample buffer (0.5 M Tris–HCl, pH 6.8, 10%

culoviral polyhedrin gene; gfp, green fluorescent protein gene; mgfp-5, musselag; Ptrc, trc promoter; AmpR, ampicillin resistance gene; lacIq, overexpressed

Y.S. Kim, H.J. Cha / Enzyme and Microbial Technology 39 (2006) 399–406 401

Table 1Primers for the construction of plasmids

Target gene Sequences (5′ → 3′)

dps GGGGCTAGCATGAGTACCGCTAAATTAGGGAATTCTTATTCGATGTTAGACTC

gfp GGGCTAGCATGAGTAAAGGAGAAGAACTTTTCACTGGCTGCAGTTATTTGTAGAGCTCATCCATGCC

hil-2 CGCGCTAGCATGGCAGGTACTTCAAGTTCAGGATCCTTATCAAGTTAGTGTTG

RBS+dps for pYS02 & pYS04 TACTGCAGGTGGGCACTCGACCGGAATTATCGGGGAATTCTTATTCGATGTTAGACTC

RBS+dps for pYS06 GAATTCGTGGGCACTCGACCGGAATTATCGGGAAGCTTTTATTCGATGTTAGACTC

RBS+dps for pYS08 GCGGATCCGTGGGCACTCGACCGGAATTATCGGGAAGCTTTTATTCGATGTTAGACTC

glycerol, 5% sodium dodecyl sulfate (SDS), 5% �-mercaptoethanol, and 0.25%bromophenol blue) and heated to 95 ◦C for 5 min. The samples were loadedonto a 15% SDS-polyacrylamide gel for electrophoresis (SDS-PAGE). Then,the gels were stained by Coomassie blue (Bio-Rad, Hercules, CA, USA). ForWestern blot analysis, the gels were transferred to HybonTM-PVDF membranes(Amersham, Buckinghamshire, England). After transferring, membranes wereincubated in antibody solution that contains anti-(His)6 antibody (1:1000 v/v)(Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 2 h at room tempera-ture and probed with anti-rabbit immunoglobutin G conjugated with alkalinephosphatase (1:1000 v/v) (Sigma). After washing, developing solution (0.1 MTris–HCl (Sigma), 0.5 mM MgCl2 (Samchun chemical, Seoul, Korea), 0.015%5-bromo-4-chloro-iodolyl phosphate (Bio Basic, Toronto, Canada), 0.03% nitro-blue tetrazolium chloride (Bio Basic), pH 9.5) was added to detect target proteinbands, and the reaction was quenched with distilled water.

2.6. 2-Dimensional gel electrophoresis

Cells in late exponential or early stationary phase were harvested bycentrifugation (14,000 rpm, 10 min, room temperature) and washed twice inice-cold PBS. Harvested cells were disrupted and solubilized in lysis buffer(7 M urea, 2 M thiourea, 4% (w/v) 3-(3-cholamidopropyl) dimethylammonio-1-propanesulfonate (CHAPS), 1% (w/v) dithilthreitol (Sigma), 2% (v/v) pharma-lyte (pH 3.5–10) (Amercham), 1 mM benzamidine (Sigma)). After centrifuga-tion at 15,000 rpm for 1 h at 15 ◦C, insoluble material was discarded and solublefraction was used for 2D gel electrophoresis. IPG dry strips were rehydraedfor 12–16 h with 7 M urea, 2 M thiourea containing 2% CHAPS, 1% DTT, 1%pharmalyte and respectively loaded with 200 �g of sample. Isoelectric focusing(IEF) was performed at 20 ◦C using a Multiphor II electrophoresis unit and EPS3500 XL power supply (Amersham). Prior to the second dimension, strips wereincubated for 10 min in equilibration buffer (50 mM Tris-Cl, pH 6.8 containing6i2aT

3

3

bat(Pf

protein’. Previously, we showed that baculoviral Polh couldinduce inclusion body formation of fusion partner and thus,Polh-GFP fusion protein was expressed as inclusion body in E.coli cells [24]. hIL-2 is well known its hydrophobic property andthus, its recombinant version was expressed as insoluble inclu-sion body in E. coli [25,26]. In the case of GFP and Mgfp-5,both protein bands were mainly detected in the soluble fraction(Fig. 2) and thus, these proteins can be regarded as ‘soluble pro-tein’. GFP has been regarded as soluble proteins [26,32]. Recom-binant mussel adhesive protein Mgfp-5 was recently cloned andexpressed as mostly soluble form in E. coli system [28].

3.2. Solubility dependency of Dps effects on cell growth

Firstly, we investigated effects of Dps co-expression on hostcell growth according to solubility of target foreign proteins.All recombinant E. coli strains were cultured in M9 minimalmedia to give more stressful environment because natural Dpsis expressed under the stress conditions including glucose deple-tion. In the case of insoluble group (Polh-GFP and hIL-2), thecell growths of both Dps co-expressing (Dps+) strains werelower than those of Dps non-expressing (Dps−) strains (Fig. 3A

Fmifp

M urea, 2% SDS, and 30% glycerol), first with 1% DTT and second with 2.5%odoacetamide (Sigma). Then, SDS-PAGE was performed using Hoefer DALTD system (Amersham) and the gels were silver stained. The stained gels werenalyzed by PhoretixTM software (Nonlinear Dynamics, Durham, NC, USA).wo independent 2D gel electrophoreses were performed for each sample.

. Results and discussion

.1. Solubility of target recombinant proteins

Solubility of each target protein was confirmed by Westernlot analysis for soluble supernatant and insoluble cell lysatefter disrupting the cells by sonication. The result exhibited thatarget recombinant proteins could be classified into two groupssoluble and insoluble) according to their solubility (Fig. 2).olh-GFP and hIL-2 bands were existed only in the insolubleraction and thus these proteins can be regarded as ‘insoluble

ig. 2. Western blot analysis for solubility of target proteins. Lanes: M, proteinolecular weight marker; S, soluble supernatant fraction after cell lysis; IS,

nsoluble cell debris fraction. Recombinant cells were cultured in M9 mediumor 4 h after induction at 37 ◦C with shaking at 250 rpm. Fifteen percent gels andolyclonal anti-His6 antibody were used for analysis.

402 Y.S. Kim, H.J. Cha / Enzyme and Microbial Technology 39 (2006) 399–406

Fig. 3. Cell growth profiles of recombinant E. coli BL21 under Dps− (©) and Dps+ (�) conditions for (A) insoluble Polh-GFP, (B) insoluble hIL-2, (C) solubleGFP, (D) soluble Mgfp-5, and (E) no target protein. Recombinant cells were cultured in M9 medium at 37 ◦C with shaking at 250 rpm. Each value and error barrepresents the mean of three independent experiments and its standard deviation.

and B). However, the soluble target cases, GFP and Mgfp-5,showed the opposite results; Dps+ strains had higher cell densitythan Dps− strains (Fig. 3C and D). These were same phenomenawith the targetless case (without any foreign protein expression)(Fig. 3E). Therefore, we found that Dps effects on cell growthwere clearly dependent on solubility of target proteins.

3.3. Solubility dependency of Dps effects on foreign proteinexpression

Next, we investigated changes of production level of eachforeign target protein under Dps co-expression environment.Western blot analyses of 4 and 8 h post-induction samples wereperformed using anti-His6 antibody because all target proteinsand Dps were constructed to have His6 tag at each N-terminus(Fig. 1). As we previously investigated [23], expression levelof insoluble Polh-GFP fusion protein was enhanced by co-expression of Dps (Fig. 4A). For quantitative comparison, spe-cific target protein amounts were normalized based on amount ofeach 4 h post-induction sample. The normalized specific Polh-GFP amount of Dps+ strain was much higher (1.6–1.8-fold)during the entire post-induction time. Another insoluble tar-

get, hIL-2, also showed highly enhancement (about 4–5-fold)of expression level under Dps co-expression (Fig. 4B). Whilethe expression levels of Dps+ strains for Polh-GFP and hIL-2were much higher than those of Dps− strains, there were almostno changes or sight decreases of protein expression levels forsoluble targets, GFP and Mgfp-5, under co-expression of Dps(Fig. 4C and D). The normalized specific target protein amountof Dps+ strain indicated that there were decreases of ∼1.05-fold for both GFP and Mgfp-5. Especially in the case of GFP,fluorescence intensity was also measured and it showed similartendency to Western blot analysis (data not shown). Interest-ingly, similar to cell growth results, Dps effects on target proteinexpression were also clearly dependent on solubility of targetproteins.

Two possible explanations might be surmised for the mech-anism of Dps on enhancement of insoluble foreign proteinproduction in E. coli system. First, Dps might directly givea resistant ability to host strain against the metabolic burdenstress from over-expression of foreign protein. Especially, insol-uble inclusion body formation can cause high cellular stress[14,21,22,33]. It was known that Dps is induced under oxida-tive stress [1,7,8,33], nutrient depletion [2–4], acetic stress [34],

Y.S. Kim, H.J. Cha / Enzyme and Microbial Technology 39 (2006) 399–406 403

Fig. 4. Western blot analysis and normalized specific amount for (A) insoluble Polh-GFP, (B) insoluble hIL-2, (C) soluble GFP, and (D) soluble Mgfp-5. Lanes: MW,protein molecular weight marker; 1, 4 h post-induction Dps− sample; 2, 4 h post-induction Dps+ sample; 3, 8 h post-induction Dps− sample; 4, 8 h post-inductionDps+ sample. Recombinant cells were cultured in M9 medium at 37 ◦C with shaking at 250 rpm. Fifteen percent gels and polyclonal anti-His6 antibody were usedfor Western blot. Normalization was based on specific protein amount for Dps− sample at 4 h post-induction. Each value and error bar represents the mean of threeindependent experiments and its standard deviation.

and/or osmotic stress [35]. Therefore, even though it is not clearyet, it can be thought that Dps might have a general resistantfunction on several stresses including over-expression of insolu-ble foreign proteins. Second, it was reported that over-expressionof a stress protein resulted in alterations in global protein synthe-sis [3,36]. Therefore, we can surmise that alterations in globalprotein synthesis by Dps co-expression caused positive effectson production of insoluble foreign protein, but not soluble for-eign protein.

3.4. Proteomic analysis for solubility dependency of Dpseffects

2D gel electrophoresis analyses were performed to investi-gate changes of global protein synthesis patterns between insol-

uble and soluble protein expression under Dps co-expression.Polh-GFP and GFP were selected as an each representative forinsoluble and soluble target protein. Proteomic analyses wereperformed for Dps+ and Dps− strains with or without targetproteins. Because these systems are involved in co-expressionof several proteins, two targets and Dps, proteomic analysesare not just simple. Thus, proteomic analyses were designed tohave three parts; universal Dps effects (Fig. 5A), each sole tar-get protein effects (Fig. 5B), and interacted Dps effects withtarget protein (Fig. 5C). For the analyses, four-fold stringencywas applied as a criterion.

Firstly, to eliminate target protein effects from overall Dpseffects (to find universal Dps effects), we compared Dps+ andDps− samples for each target protein (Fig. 5A). If we can findoverlapped spots from these comparisons and these can be fur-

404 Y.S. Kim, H.J. Cha / Enzyme and Microbial Technology 39 (2006) 399–406

Fig. 5. 2D gel electrophoresis analyses for (A) universal Dps effects, (B) sole target protein effects, and (C) interacted Dps effects with target protein. Four-foldstringency was applied as a criterion for the analyses. Symbols: , up-regulated spot; , down-regulated spot. Boxed spots in (C) are overlapped with those in (B).Two independent 2D gel electrophoreses were performed for each sample.

Y.S. Kim, H.J. Cha / Enzyme and Microbial Technology 39 (2006) 399–406 405

ther compared with the targetless case (comparison of Dps+ andDps− strains without target protein expression), we can regardoverlapped spots are regulated by universal Dps effects. As aresult, we could select lots of spots that have more than four-fold increase or decrease under Dps co-expression for each targetprotein (data not shown). However, interestingly, there were nooverlapped spots between each target protein samples (Fig. 5A).Therefore, we can surmise that there was no or very minimaluniversal Dps effects on changes of global protein expressionpatterns under four-fold high stringency criterion and Dps mightneed association of foreign protein to have certain effect.

Second analysis was performed to investigate each sole targetprotein (Polh-GFP and GFP) effects on changes of global proteinexpression patterns (Fig. 5B). For each target protein, we com-pared Dps+ samples with and without target protein expressionand also compared Dps− samples with and without target proteinexpression. We found that several protein spots were regulated(up or down) by each target protein expression, but there wereno overlapped spots between both systems under four-fold highstringency criterion (Fig. 5B). Therefore, we might concludethat different target protein effects were induced according totarget protein solubility.

Finally, 2D gel analyses were performed to investigate theinteracted Dps effects with target protein (Fig. 5C). Even thoughuniversal Dps effects might be minimal, Dps can make interactedeffects with environmental changes by target protein expression.WDsbapppdpitttstpwatDtv

eiuouDc

protein, especially expressed as insoluble inclusion body in E.coli.

4. Conclusion

In this work, Dps co-expression showed clear distinct effectson cell growth and target protein expression according to sol-ubility of foreign protein. Under co-expression of recombinantDps, cell growth for the strain expressing insoluble Polh-GFP orhIL-2 had tendency to decline slightly compared to each Dps−strain as a negative control while that for the strain expressingsoluble GFP or Mgfp-5 was somewhat increased. Even thoughDps co-expression had somewhat negative effects on expressionof soluble protein (GFP and Mgfp-5), it showed huge impactson product yield of insoluble proteins (1.6–1.8-fold for Polh-GFP and 4–5-fold for hIL-2). Therefore, it was obvious thatco-expression of recombinant Dps has a different influence onforeign protein production according to solubility of target pro-tein. The proteomic analyses revealed that Dps co-expressioninduced significantly different global protein synthesis patternsin E. coli cells through interaction with target foreign proteinaccording to solubility of target protein. Therefore, these dif-ferent global patterns of protein synthesis might be profitableon production of insoluble foreign proteins indirectly. This Dpsco-expression strategy can be successfully applied to enhancept

A

baE

R

e performed parallel comparisons; comparison of Dps+ andps− samples with each target protein and comparison of Dps+

amples with and without target protein. Overlapped spots cane regarded from interacted Dps effects with each target proteinnd finally, we can compare the overlapped spots for each targetrotein case to investigate dependency of Dps effects from targetrotein solubility. Various spots were overlapped from two com-arisons for each insoluble and soluble target protein and theseemonstrated that Dps had some interaction with each targetrotein, and these interactions had influenced on the proteomen E. coli indirectly by modulating its overall expression pat-erns such as Dps in stationary phase [3]. However, interestingly,here were no overlapped spots between insoluble and solublearget protein sample analyses (Fig. 5C). Therefore, it might beuggested that interactions between Dps and target protein areotally dependent on target protein solubility and these led com-letely different global protein regulation patterns. In addition,e eliminated each sole target protein effect from each inter-

cted Dps effect through removal of the spots regulated by solearget protein from those selected by interacted effect betweenps and target protein. Only one spot could be excluded among

he spots for each target protein case and this could confirmalidity (or reliability) of this analytic strategy.

In summary, Dps co-expression induced significantly differ-nt global protein synthesis patterns in E. coli cells throughnteraction with target foreign protein according to target sol-bility. We can surmise that these quite different global patternsf protein synthesis might be favorable for production of insol-ble foreign proteins indirectly. Even though the mechanism ofps effects remains unclear yet, this Dps co-expression strategy

an be successfully applied to enhance product yield of foreign

roduct yield of insoluble inclusion body-formed foreign pro-ein in E. coli.

cknowledgments

The authors would like to acknowledge support of this worky the Korea Research Foundation (KRF-2001-041-E00355)nd the Brain Korea 21 program issued from the Ministry ofducation, Korea.

eferences

[1] Zhao G, Ceci P, Ilari A, Giangiacomo L, Laue TM, Chiancone E,et al. Iron and hydrogen peroxide detoxification properties of DNA-binding protein from starved cells A ferritin-like DNA-binding proteinof Escherichia coli. J Biol Chem 2002;277:27689–96.

[2] Almiron A, Link AJ, Furlong D, Kolter R. A novel DNA-binding proteinwith regulatory and protective roles in starved Escherichia coli. GenesDev 1992;6:2646–54.

[3] Ishihama A. Modulation of the nucleoid, the transcription apparatus,and the translation machinery in bacteria for stationary phase survival.Genes Cells 1999;4:135–43.

[4] Ali Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A. Growthphase-dependent variation in protein composition of the Escherichia colinucleoid. J Biotechnol 1999;181:6361–70.

[5] Grossman AD, Taylor WE, Burton ZF, Burgess RR, Gross CA. Stringentresponse in Escherichia coli induces expression of heat shock proteins.J Mol Biol 1985;186:357–65.

[6] Yura T, Nagai H, Mori H. Regulation of the heat shock response inbacteria. Annu Rev Microbiol 1993;47:321–50.

[7] McDougald D, Gong L, Srinivasan S, Hild E, Thompson L, TakayamaK, et al. Defences against oxidative stress during starvation in bacteria.Antonie Van Leeuwenhoek 2002;81:3–13.

[8] Martinez A, Kolter R. Protection of DNA during oxidative stress by thenonspecific DNA-binding protein Dps. J Bacteriol 1997;179:5188–94.

406 Y.S. Kim, H.J. Cha / Enzyme and Microbial Technology 39 (2006) 399–406

[9] Van Dyk TK, Reed TR, Vollmer AC, Larossa RA. Synergistic inductionof the heat-shock response in Escherichia coli by simultaneous treatmentwith chemical inducers. J Bacteriol 1995;177:6001–4.

[10] Jenkins DE, Auger EA, Matin A. Role of RpoH, a heat shock reg-ulator protein, in Escherichia coli: effect of alternations of the outermembrane permeability on sensitivity of environmental toxicants. ToxicAssess 1991;5:253–64.

[11] Sedger L, Ruby J. Heat-shock response to vaccinia virus infection. JVirol 1994;68:4685–9.

[12] Goff SA, Goldberg AL. Production of abnormal proteins in E. colistimulates transcription of lon and other heat shock genes. Cell1985;41:587–95.

[13] Kanemori M, Mori H, Yura T. Induction of heat shock proteins byabnormal proteins results from stabilization and not increased synthesisof 32 in Escherichia coli. J Bacteriol 1994;176:5648–53.

[14] Jurgen B, Lin HY, Riemschneider S, Scharf C, Neubauer P, SchmidR, et al. Monitoring of genes that respond to overproduction of aninsoluble recombinant protein in Escherichia coli glucose-limited fed-batch fermentations. Biotechnol Bioeng 2000;70:217–24.

[15] Dong H, Nilsson L, Kurland CG. Gratuitous overexpression of genes inEscherichia coli leads to growth inhibition and ribosome destruction. JBacteriol 1995;177:1497–504.

[16] Gottesman S, Maurizi MR. Regulation by proteolysis: energy-dependentproteases and their targets. Microbiol Rev 1992;56:592–621.

[17] Matin A. The molecular basis of carbon-starvation-induced general resis-tance in Escherichia coli. Mol Microbiol 1991;5:3–10.

[18] St.John AC, Goldberg AL. Effects of starvation for potassium and otherinorganic ions on protein degradation and ribonucleic acid synthesis inEscherichia coli. J Bacteriol 1980;143:1223–33.

[19] Archer DB, MacKenzie DA, Jeenes DJ, Roberts IN. Proteolytic degrada-tion of heterologous proteins expressed in Aspergillus niger. Biotechnol

[

[

[

[23] Kim YS, Seo JH, Cha HJ. Enhancement of foreign protein expression inEscherichia coli by co-expression of nonspecific DNA-binding proteinDps. Enzyme Microb Technol 2003;33:460–5.

[24] Seo JH, Li L, Yeo JS, Cha HJ. Baculoviral polyhedrin as a fusion partnerfor formation of inclusion body in Escherichia coli. Biotechnol Bioeng2003;84:467–73.

[25] Tsuji E, Nakagawa R, Sugimoto N, Fukuhara K. Characterization ofdisulfide binds in recombinant proteins: reduced human interleukin-2 in inclusion bodies and its oxidative refolding. Biochemistry1987;26:3129–34.

[26] Cha HJ, Wu CF, Valdes JJ, Rao G, Bentley WE. Observations ofgreen fluorescent protein as a fusion partner in genetically engineeredEscherichia coli: monitoring protein expression and solubility. Biotech-nol Bioeng 2000;67:565–74.

[27] Johnvesly B, Kang DG, Choi SS, Kim JH, Cha HJ. Comparative pro-duction of green fluorescent protein under co-expression of bacterialhemoglobin in Escherichia coli W3110 using different culture scales.Biotechnol Biopro Eng 2004;9:274–7.

[28] Hwang DS, Yoo HJ, Jeon JH, Moon WK, Cha HJ. Expression of func-tional recombinant mussel adhesive protein Mgfp-5 in Escherichia coli.Appl Environ Microbiol 2004;70:3352–9.

[29] Harwood AJ, Adrian J. Basic DNA and RNA protocols. Totowa, NJ:Humana press; 1996.

[30] Sambrook J, Russel DW. Molecular cloning: a laboratory manual. 3rd edCold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001.

[31] Gold L. Posttranscriptional regulatory mechanisms in Escherichia coli.Annu Rev Biochem 1998;57:199–233.

[32] Crameri A, Whitehorn EA, Tate E, Stemmer WPC. Improved greenfluorescent protein by molecular evolution using DNA shuffling. NatBiotechnol 1996;14:315–9.

[33] Sørensen HP, Mortensen KK. Soluble expression of recombinant proteins

[

[

[

Lett 1992;14:357–62.20] Jubete Y, Maurizi MR, Gottesman S. Role of the heat shock protein

DnaJ in the Lon-dependent degradation of naturally unstable proteins. JBiol Chem 1996;217:30798–803.

21] Harcum SW, Bentley WE. Response dynamics of 26, 34 39 54 and80 kDa proteases in induced cultures of recombinant Escherichia coli.Biotechnol Bioeng 1993;42:675–85.

22] Ramirez DM, Bentley WE. Fed-batch feeding and induction policiesthat improve foreign protein synthesis and stability by avoiding stressresponse. Biotechnol Bioeng 1995;47:596–608.

in the cytoplasm of Escherichia coli. Microb Cell Fact 2005;4:1.34] Choi SH, Baumler DJ, Kaspar CW. Contribution of dps to acid stress

tolerance and oxidative stress tolerance in Escherichia coli O157:H7.Appl Environ Microbiol 2000;66:3911–6.

35] Weber A, Jung K. Profiling early osmostress-dependent gene expres-sion in Escherichia coli using DNA macroarrays. J Bacteriol2002;184:5502–7.

36] Nystrom T, Neidhardt FC. Effects of overproducing the universal stressprotein, UspA, in Escherichia coli K-12. J Bacteriol 1996;178:927–30.