sodium benzoate, a common preservative, inhibits growth

Research Paper

Sodium benzoate, a common preservative, inhibits growth, shortens

lifespan, induces premature aging, and accelerates neurodegeneration

Jason Cui

Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and

accelerates neurodegeneration

1

ABSTRACT

Sodium benzoate is one of the most commonly used preservatives in the food industry. Although

the compound is recognized as safe by the FDA, the effects of sodium benzoate on human health

have been of interest to both the public and the scientific community. The nematode

Caenorhabditis elegans (C. elegans) is an ideal model organism to study the health effects of

sodium benzoate because of its simplicity and its well established genetic toolkit. In this study, I

found that sodium benzoate restricts C. elegans growth, shortens its lifespan, induces premature

aging, and accelerates neurodegeneration. Sodium benzoate functions in parallel with the

insulin/IGF-1 pathway to decrease lifespan. Using an Alzheimer’s disease model that expresses

human beta amyloid peptides, sodium benzoate was revealed to also significantly accelerate

neurodegeneration. Sodium benzoate induced age-pigments in young worms through

accumulating age-pigments in lysosome-related organelles (LROs), contributing to premature

aging and neurodegeneration. Using GFP marker strains and quantitative RT-PCR assays, I

uncovered the role of sodium benzoate in suppressing the irg-1 innate immunity gene expression.

The compromised innate immunity response is another underlying mechanism for the

phenotypes described above. Overall, these results reveal the long term detrimental effects of

sodium benzoate on animal health and it may have similar consequences on human health.



2

INTRODUCTION

Sodium benzoate is a commonly used preservative all over the world. It is present in

almost all preserved foods and ingredients such as chips, ramen, etc. and even in carbonated

drinks like Pepsi and Coca-Cola. The FDA maintains that sodium benzoate has no harmful

effects to health and regulates the use of sodium benzoate such that it does not exceed the

concentration 0.1% of the total weight of the substance (CFR FDA et al. 2019). However, at the

time that sodium benzoate was approved by the FDA in 1977, there was no substantial evidence

showing there were no adverse effects of sodium benzoate (McCulloch et al. 2017). After its

approval, there has been no extensive, in-depth research into the overall effect of sodium

benzoate on health. Some studies on sodium benzoate have revealed unreliable results because of

the correlated outcome that play into the health of complex organisms. Khoshnoud et al. (2018)

showed that sodium benzoate severely impaired motor function in mice. In lymphocyte cells,

there were signs of mutations and toxicity after sodium benzoate treatment (Pongsavee et al.

2015). Conversely, Lin et al. (2014) showed that in a 24-week human trial, sodium benzoate

improved cognitive function of patients with early-phase Alzheimer’s disease, but they failed to

see the same positive effects in a 6-week human trial conducted five years later (Lin et al. 2019).

An in-vivo model organism that was both simple and had well-established genetic tools

was ideal to investigate the role and mechanisms of sodium benzoate in animal health. The

small, free living nematode, Caenorhabditis elegans (C. elegans) offers such a model system.

Many of its molecular functions and genes in development and aging are similar to more

complex organism, like humans. Researchers have also established several transgenic C. elegans

models with Aβ/tau toxicity, including CL2355 (Link et al. 2006, Hassan et al. 2015), allowing

the investigation of sodium benzoate on age-related diseases. Finally, growing and maintaining



3

C. elegans is simple, efficient, and inexpensive. It readily consumes the bacteria provided in its

environment, allowing studies on the link between diet and aging in C. elegans to be studied in-

depth (Hunt et al., 2017). Because of our high consumption of sodium benzoate, it is important to

investigate its role in early animal development, as well as the long-term impact on lifespan and

aging. The diet of an organism is often linked to development, aging and lifespan (Fontanta et al.

2015).

In this study, I used C. elegans and discovered that sodium benzoate delayed animal

developmental growth, reduced lifespan, induced premature aging, and accelerated

neurodegeneration.

MATERIALS AND METHODS

Maintaining C. elegans

C. elegans is relatively easy to maintain and do not require constant care. In this research project,

I used the wild type N2 strain, glo-1(zu391), a temperature-sensitive beta-amyloid induced C.

elegans strain (CL2355), and multiple transgenic GFP (green fluorescent protein) strains.

CL2355 worms were maintained at 15°C while the wild type N2 worms (and the transgenic GFP

worms) were kept at 20°C. Using chunking methods, crowded plates were maintained with a

small portion of it moved to fresh NGM plates every three to four days.

Escherichia coli (E. coli) Preparation

In this study, the non-pathogenic E. coli OP50, was used as the food source for C. elegans. The

bacteria were cultured in Lysogeny broth (LB) for at least 16 hours (and no more than 24 hours).

250 uL of E. coli culture were then spotted onto 6-cm petri dishes with NGM agar (Nematode



4

Growth Medium). After being dried at room temperature for 3 days, the plates were moved to a

4°C cold room for storage.

Preparation of sodium benzoate supplemented plates

Sodium benzoate with the chemical formula C7H5NaO2 was obtained from Sigma-Aldrich. The

concentration of the stock solution of sodium benzoate was 300mg/mL, dissolved in water.

10uL, 25uL, 50uL, and 100uL of the stock solution were mixed with ddH20 (double-distilled

water) to make up to a total volume of 150uL and then applied to the fully grown (3-day old)

bacterial lawns grown through the procedure described above. The final concentration of sodium

benzoate on each plate was 2, 5, 10 and 20 mM (the FDA limit is 9mM).

Synchronization of C. elegans

1) Egg laying synchronization method to obtain less than 100 worms per plate: C. elegans

was grown until the gravid adult stage at their relative growing temperature from the first larval

stage (L1) (3 days for 20°C or 5 days for 15°C). Then, gravid adults were picked and placed onto

the supplemented and control plates and allowed to lay eggs for 2 hours. Then, the gravid adults

were removed from the plates. Worms hatched from these eggs at the same time and grew at a

similar rate.

2) Bleaching method to obtain a large number of worms: Gravid adults grown at their

respective temperatures were collected using M9 buffer and centrifuged at 1400 rpm (rotation

per minute). The supernatant was aspirated and the bleach solution (6.75 mL ddH20, 1.25 mL

4N NaOH, 2 mL NaOCl) was added into the solution. 4-5 minutes were required to break down

the gravid adults and release the eggs. The solution was then centrifuged once again, and the

supernatant aspirated. To relieve the acidity, the eggs were washed a minimum of 2 times with



5

M9. The eggs were then left in 5mL of M9 and placed at their relative temperatures for 16-24

hours to fully hatch. All worms’ development was stalled at the L1 stage due to lack of nutrients

in the M9 salt buffer.

Lifespan/Aging Analysis

L4 stage (Larval stage 4) worms were placed onto 2 copies of treatment and control plates and

cultured at either 25°C or 20°C. The worms were fertile for 5-7 days after the L4 stage and to

control progeny presence and to reduce possible starvation factor, the worms were transferred to

new plates with the same concentration of sodium benzoate every day. After their fertility wanes

after 7 days, the worms were then transferred to new plates every three days until no live worms

remained on the plates. The number of live and dead worms were scored every day. Worms were

considered dead if they failed to express a response to external stimuli.

Age-pigment/Lipofuscin assay

Age-pigments, a toxic biomarker of aging, is characterized by auto-fluorescence in the intestinal

region, caused by the accumulation of oxidized macromolecules (Terman et al. 1998). N2 wild

type worms were synchronized and raised from L1 to L4 stage on regular E. coli OP50 plates.

Then, L4 worms were transferred onto petri dishes with various concentrations of sodium

benzoate. They were then incubated for 24 hours at 20°C. 20 worms were then selected

randomly from the treated and untreated groups and mounted onto 3% agarose pads. 1 mM

levamisole was then used to anesthetize the worms. Images were captured using a Nomarski

fluorescence microscope under a DAPI filter (with an excitation of 340–380 nm and emission of

435–485 nm) or a GFP filter (with an excitation of 488 nm and an emission of 510 nm). The

fluorescence intensity was quantified by using Image-J software (NIH).



6

Quantitative RT-PCR assays

N2 wild type worms were synchronized and raised from L1 to L4 stage on regular E. coli OP50

plates. L4 stage worms were then grown on sodium benzoate treatment plates for 24 hours at

20°C. Afterwards, 1000-2000 worms of each condition were collected and washed in M9 buffer.

Then the total RNAs were collected through a Trizol based method (Burdine and Stern 1996).

The mRNAs were reverse-transcribed into first strand cDNA with the SuperScript III First-

Strand Synthesis SuperMix (Invitrogen). The expression of selected genes was measured using

the AriaMX real-time PCR instrument (Agilent). The cycle threshold (Ct) value for each

transcript was normalized to the house-keeping gene, act-1. The list of genes that were tested is

shown in Appendix II.

Green fluorescent protein visualization and quantification

A green fluorescent protein (GFP) visualization and expression analysis was also conducted to

investigate sodium benzoate’s role in stress response. The C. elegans transgenic strains stably

expressing DAF-16::GFP (TJ356), SOD-3:: GFP (CF1553), HSP-60::GFP (SJ4058), HSP-

4::GFP (SJ4005), and IRG-1::GFP (AU133) as reporter genes were used to investigate various

stress responses. L4 stage worms were placed on NGM plates supplemented with or without

sodium benzoate and incubated for 24 h at 20 °C. The worms were then mounted on a 3%

agarose pad, with a 1 mM levamisole to anesthetize the worms, and sealed with a coverslip. The

worms were imaged under a GFP filter (with an excitation of 488 nm and an emission of

510 nm) using a fluorescence nomarski microscope. The levels of expression were then

quantified using ImageJ software (NIH).



7

Chemotaxis assay

To study the effect of sodium benzoate on neurodegeneration (an age-related disease), a

chemotaxis assay of an Alzheimer’s disease C. elegans model (Luo et al. 2009) was employed.

Synchronized transgenic C. elegans CL2355 were first grown to L3 (Larval 3) stage on E. coli

OP50 plates at 16°C for 36 hours. Then, they were transferred onto plates treated with or without

sodium benzoate and shifted to 23°C for another 36 hours. The worms were then collected and

assayed on 100 mm plates containing NGM agar. The plates were divided into four quadrants (2

for the attractant and 2 for the control). 1 μl of 1 M sodium azide along with 1 μl of odorant

(0.1% benzaldehyde in 100% ethanol) were added to the attractant quadrant. 1 μl of 100%

ethanol and 1 μl drop of sodium azide were added to the control quadrant. Immediately after, 2

μl of the worms (about 60-100 worms) were pipetted to the center of the plate. The assay plates

were then incubated at 23°C for 90 minutes. Afterwards, the number of worms in each quadrant

was scored. The chemotaxis index (CI), using the equation: CI = (number of worms in both

attractant quadrants – number of worms in both control quadrants)/total number of scored

worms, was then calculated (Margie et al. 2013).

Statistical Analysis

Quantitative data are expressed as the mean ± Standard Error of the Mean (SEM). Data were

analyzed by an unpaired two-tailed student’s t-test using Excel 2016. Survival comparisons and

statistical analysis were performed using the Mantel-Cox log-rank test within an online tool (Han

et al. 2016) (https://sbi.postech.ac.kr/oasis2/). Biological replicates reflect different sources of

material and/or experiments performed on different days. Statistical details for experiments are

indicated in the figure legends.



8

RESULTS

Sodium benzoate restricts the developmental process of C. elegans

To investigate whether sodium benzoate treatment affects the growth of C. elegans, wild type N2

animals were grown at 20°C under various doses of sodium benzoate starting from L1 stage.

After 48 hrs, the body lengths were assayed using the WormLab video tracking system. In this

assay, I found that the average worm body length decreased in a dose-dependent manner when

compared to the control (2mM of sodium benzoate: 11% decrease (p-value 0.0017), 5mM: 9%

decrease (p-value 0.0036), 10mM: 18% decrease (p-value 5.22474E-08), 20mM: 38% decrease

(p-value 1.11727E-21)) (Figure 1). The two lower concentrations (2mM and 5mM) used in this

study are well below the FDA limit and yet still negatively affected C. elegans’ development.

Sodium benzoate shortens C. elegans lifespan

To investigate the impact of sodium benzoate in animal aging, I conducted a lifespan assay. Wild

type C. elegans were cultured on different doses of sodium benzoate starting from the L4 stage

to circumvent the developmental effect of sodium benzoate. N2 worms grown at 20°C had a

mean lifespan of 20 days on the control medium with solvent only (H2O). The mean lifespan

was shortened to 86.7%, 79.7%, 63.7%, and 53.9% of the untreated control at the doses of 2, 5,

Figure 1. Sodium

benzoate treatment

resulted in growth

reduction. Data were

expressed as means ±

standard errors (SEM).

The differences

between control (H2O

only) and different

doses of sodium

benzoate were

analyzed using the

student’s t-test. **P-

value < 0.01.



9

10 and 20 mM of sodium benzoate, respectively (Figure 2A) (p value < 0.05 by log-rank test).

N2 worms grown at 25°C had a shorter mean lifespan of 11.56 days compared to worms grown

at 20°C. The mean lifespan was shortened to 93.6%, 84.5%, 79.8%, and 78.5% of the untreated

control at the doses of 2, 5, 10 and 20 mM of sodium benzoate, respectively (Figure 2B) (p value

< 0.05 by log-rank test). The detailed statistical analyses of the lifespan assays are included in

Appendix I. In summary, these lifespan assay results indicate that sodium benzoate accelerates

the aging process and shortens lifespan.

Sodium benzoate decreases lifespan parallel to the insulin/IGF-1 signaling pathway

To investigate the mechanism behind the lifespan shortening caused by sodium benzoate, the

insulin/IGF-1 signaling pathway was studied. This pathway is one of the main lifespan regulators

in C. elegans and includes critical components, AGE-1/PI3K and DAF-16/FOXO (Murphy et al.

2018). Insulin/IGF-1 signaling inhibits the transcriptional activity of DAF-16/FOXO (Salih and

Figure 2. Sodium benzoate reduces the lifespan of C. elegans wild type N2, daf-16(-) and age-1(-) mutants.

Survival curve of N2 worms incubated at 20°C (A) and at 25°C (B). Survival curve of daf-16 worms (C) and age-1

worms (D) at 25°C. All tests had a minimum of 60 animals and the differences are statistically significant with a

*P-value < 0.05 obtained by the log rank test. (E) A model depicting the relationship between the insulin IGF-1

pathway and sodium benzoate in regulating longevity.



10

Brunet, 2008). When insulin/IGF-1 signaling is reduced, lifespan is doubled (such as the age-

1/PI3K mutant), and this life span extension requires daf-16. Conversely, when daf-16 is deleted

in otherwise normal animals, the rate of tissue aging is accelerated and life span is shortened by

∼20% (Lin et al., 2001). Lifespan analysis were performed at 25°C using the wild type N2, daf-

16(-), and age-1(-) mutants. The three possible outcomes of this genetic epistasis analysis were

the following: 1) if sodium benzoate shortened the lifespan of both daf-16 and age-1 mutants, it

worked in parallel with the insulin/IGF-1 signaling pathway, 2) if sodium benzoate shortens only

the lifespan of age-1(-), sodium benzoate works upstream of DAF-16/FOXO and downstream of

AGE-1/PI3K, or 3) sodium benzoate works upstream of both DAF-16/FOXO and AGE-1/PI3K

by not affecting any of the mutant’s lifespan. The lifespan assay data showed that sodium

benzoate reduced the lifespan of the age-1 mutant by 9.7%, 13.5%, 37.4%, and 48.9% at the

doses of 2, 5, 10 and 20 mM of sodium benzoate, respectively, compared to the untreated control

(p value < 0.05 by log-rank test) (Figure 2D). The lifespan assay at 25°C also showed that

sodium benzoate significantly reduced lifespan in the daf-16 mutants by 9.6%, 17.6%, 26.3%,

and 25.3% at the doses of 2, 5, 10 and 20 mM of sodium benzoate, respectively, compared to the

untreated control (p value < 0.05 by log-rank test) (Figure 2C). The detailed statistical analyses

of the lifespan assays are included in Appendix I. The lifespan of both age-1(-) and daf-16(-)

decreased when exposed to sodium benzoate and therefore, it acts in parallel with the

insulin/IGF-1 signaling pathway to regulate C. elegans lifespan.

Sodium benzoate does not induce cytoplasmic, ER, or mitochondrial stress

To study the underlying mechanism in the shortening of lifespan caused by sodium benzoate, I

assayed stress response changes using several strains carrying stress response genes fused with

GFP. A group of stress response genes including heat-shock-proteins (HSP) encoding genes are



11

upregulated when animals are facing environmental assaults. The C. elegans hsp-16.2 encodes a

16-kD HSP that plays pivotal roles in cytoplasmic stress resistance (Park et al., 2009). The C.

elegans hsp-4 encodes an ER chaperone protein that plays important roles in endoplasmic

reticulum (ER) stress response (Shen et al., 2001). The C. elegans hsp-60 encodes a

mitochondria-specific chaperon (Kim et al., 2010). The stress-response genes sod-3, which codes

for a mitochondrial MnSOD involving oxidative stress response. The worms carrying these

HSP::GFP (hsp-4::GFP, hsp-60::GFP, hsp-16.2::GFP, sod-3:GFP) were fed with different

doses of sodium benzoate and assayed. I found that there was no GFP increase detected in

animals treated with sodium benzoate versus control (H2O) (50 worms were scored for each

condition in two sets of independent experiments). Quantitative RT-PCR results also confirmed

there were no changes at the mRNA level (Figure 4A). Therefore, these data suggest that sodium

benzoate at the current dosage do not cause cytoplasmic, ER, mitochondria, or oxidative stress.

Figure 4. Sodium benzoate downregulates the irg-1 gene expression in C. elegans wild type N2 worms. (A)

Real-time quantitative PCR result of target gene expression. The house keeping gene, act-1, serves as an

internal control. (B) Representation of irg-1::GFP expression (scale bar, 0.2 mm). (C) Sodium benzoate

suppresses irg-1::GFP expression. Atleast 50 worms were scored for each condition in two sets of independent

experiments. *P < 0.05 and **P < 0.01 compared with the untreated control obtained by student’s t-test.



12

Sodium benzoate suppresses the expression of the irg-1 gene, encoding a pathogen infection

response factor

In the above assay, I did find that sodium benzoate caused significant gene expression changes in

the innate immunity stress response. The innate immunity gene irg-1 expression was assayed

through both irg-1::GFP marker strain analysis and quantitative RT-PCR. Under control

conditions, irg-1::GFP is expressed in the intestine (Figure 4B). However, I found that the

percentage of animals with irg-1::GFP expression was decreased upon sodium benzoate

treatment in a dose dependent manner (Figure 4C). Moreover, at 20mM of sodium benzoate, 0%

of the 50 worms assayed showed irg-1::GFP expression (Figure 4C). Consistently, a quantitative

RT-PCR assay showed a decreased expression of the irg-1 gene at the mRNA level (Figure 4A).

Higher doses of sodium benzoate were correlated with a lower expression level of the irg-1 gene

(Figure 4A). irg-1 has deaminase activity and is known for its critical innate immune defense

role (Dunbar et al. 2012). It also plays an important role in pathogen response and prevention of

accelerated aging (Dunbar et al. 2012). These results suggest that sodium benzoate compromised

innate immunity response, affecting lifespan and aging.

Sodium benzoate increases aging pigments

When studying the stress-response genes’ GFP expression, I discovered that age-pigments (also

known as (auto-fluorescence or lipofuscin) were increased in intestinal cells when L4 worms

were treated with sodium benzoate for 24 hours. The intestinal cells of aging C. elegans

accumulate an auto-fluorescent aging pigment similar to the auto-fluorescence present in post

mitotic mammalian cells (Soukas et al., 2013). The amount of age-pigments gradually increases

throughout C. elegans adulthood and auto-fluorescent granules can be detected in older adult

nematodes by fluorescence microscopy (Clokey et al. 1986). Therefore, auto-fluorescent



13

pigments have been used as a biomarker of aging. As shown in Figure 3A, auto-fluorescence was

significantly increased in the day 1 adult worms treated with 20mM of sodium benzoate

compared to the worms on the control, which shows only very low-level of background

fluorescence. Quantification of fluorescent intensity showed that sodium benzoate increased the

auto-fluorescent aging pigment over 40% relative to untreated control (67.9%, 42.4%, 58.1%,

and 122.9% increase for 2, 5, 10, 20 mM of sodium benzoate, respectively) (Figure 3B). These

results strongly suggest that sodium benzoate accelerates the aging process by increasing the

accumulation of toxic oxidized macromolecules in young adult worms.

Sodium benzoate increases aging pigments in the lysosome-related organelles (LROs)

Lysosome-related organelles (LROs) are the sites of the decomposition of toxic substances such

as oxidized lipids and proteins, the components of age-pigments. The glo-1 mutant is defective in

developing LROs and have mislocalized age-pigments from the gut granule to the intestinal

lumen (Herman et al. 2005). Therefore, to investigate whether sodium benzoate increases age-

pigments through LROs, I utilized the glo-1(-). Both wild type N2 and glo-1(-) worms were

Figure 3. Sodium benzoate increases intestinal lipofuscin, a biomarker of aging. (A) Representative intestinal

fluorescence accumulation in Day 1 Adult N2 worms under control and 20mM sodium benzoate treatment.

Intestinal auto-fluorescence was recorded using a GFP filter with an exposure time of 4,000 ms (scale bar, 0.2

mm). (B) Quantification of the intestinal auto-fluorescence intensity in wild-type N2 animals treated for 24 hours

under different doses of sodium benzoate using a GFP filter and ImageJ software. **P < 0.01 obtained by t-test.



14

exposed to sodium benzoate for 16 hours and then the percentage of worms showing auto-

fluorescence were scored. Wild type N2 worms showed an age-pigment increase as reported in

the result shown above in Figure 3B. However, none of the glo-1(-) worms at any concentration

of sodium benzoate showed an increase of age-pigments under the same treatments (Figure 4A).

Under a GFP filter, the glo-1(-) showed only background auto-fluorescence while the N2 showed

significantly increased auto-fluorescence (Figure 4B). Under the DAPI filter, which is an

alternate way to detect auto-fluorescence, similar results were found (Figure 4C). These data

confirm that the sodium benzoate causes accumulation of age pigments (auto-fluorescence) in

LROs.

Sodium benzoate reduces chemotactic abilities and accelerates neurodegeneration

To measure the effect of sodium benzoate on neuronal degeneration, a transgenic Alzheimer’s C.

elegans model was analyzed. CL2355 transgenic worms have a pan-neuronal expression of

human beta-amyloid (Aβ) peptide (the main cause of Alzheimer’s) and when suffering increased

Figure 4. Sodium benzoate increases auto-fluorescence in lysosomal related organelles (LRO) (A) Percentage of

worms showing auto-fluorescence between N2 and glo-1 day 1 adult worms. Comparison of auto-fluorescence

between N2 and glo-1 worms under GFP filter (4,000ms exp.) (B) and DAPI filter (1,000ms exp.) (C). 30 worms

were scored for each condition. Scale bar, 0.2 mm.



15

neuron degeneration, their chemotaxis towards an attractant is negatively affected (Luo et al.

2009). L3 worms placed onto plates treated with sodium benzoate for 36 hours showed a

significant decrease in chemotactic abilities. The chemotaxis index (CI) was calculated through

the equation shown in Figure 5A. The lower the CI value is, the higher the indication of

neurodegeneration. The results shown in Figure 5B depict the clear reduction of chemotactic

abilities correlating with the higher concentration of sodium benzoate. The difference between

the control and the 20mM of sodium benzoate treatment is the largest with a statistically

significant 0.4955 unit decrease in chemotaxis index units (p-value of 0.004797) (Figure 5B).

These results strongly suggest that sodium benzoate plays a role in accelerating Aβ induced

neurodegeneration.

Figure 5. Sodium benzoate increases

neurodegeneration in neuronal A𝛃-

expressing transgenic C. elegans strain

CL2355. (A) Schematic diagram of the

chemotaxis assay and how to calculate

the Chemotaxis Index (CI) (Dostal et al.

2015). (B) The CI of CL2355 fed with

the control (H2O) and different doses of

sodium benzoate. Error bars indicate

SEM. **P < 0.01 by the student’s t-test.



16

DISCUSSION

This is the first known study conducted to date that identifies the harmful role sodium

benzoate plays in an animal's lifespan and aging. The new results obtained in this study reveal

that sodium benzoate is a harmful substance to animal health in general. Indeed, in C. elegans,

sodium benzoate clearly reduces lifespan, increases neurodegeneration, accelerates aging,

suppresses innate immunity response, and restricts development.

Through a genetic epistasis analysis to reveal the mechanisms behind the lifespan

phenotype, I found that sodium benzoate works in parallel with the insulin/IGF-1 pathway, a

main lifespan regulator. The two mutants of the insulin/IGF-1 pathway, age-1 and daf-16, both

showed a reduction in lifespan after being treated with sodium benzoate. This rules out the

possibility that sodium benzoate works within the insulin/IGF-1 pathway to regulate lifespan.

The lifespan of C. elegans is regulated by multiple conserved genetic pathways in addition to the

insulin/IGF-1 pathway, such as the mTOR pathway, sirtuin, and the AMPK pathway (Pan and

Finkel, 2017). Further study of the interaction of sodium benzoate with these additional

pathways is anticipated to understand how exactly it regulates animal lifespan.

This study also made an effort to investigate sodium benzoate’s role in regulating stress

response and whether it causes critical stress related gene expression changes. Through

analyzing several critical genes in stress response pathways by both GFP marker strains and

qPCR assays, I found that sodium benzoate significantly suppressed the irg-1 gene expression. It

has been previously shown that the irg-1 gene functions in a pmk-1 independent pathway to

regulate innate immunity response (Estes et al. 2010). There are a number of studies that show

the innate immunity pathway’s role in regulating the aging process (Xia et al. 2019). Further

experimentation on how sodium benzoate regulates innate immunity response should be done by



17

investigating whether sodium benzoate reduces the pathogen response ability of C. elegans. In

addition, this study has not exhausted all critical stress response pathways in C. elegans and

sodium benzoate may be playing a mechanistic role in other stress response pathways.

When first examining the expression of mitochondrial stress response genes (hsp-60) in

GFP marker strains, I found that the worms treated with sodium benzoate had abnormally high

expression of fluorescence. Under a 100X Nomarski microscope, I discovered that the

fluorescence was actually auto-fluorescence (otherwise known as lipofuscin or age-pigments)

emitted from the intestine and not GFP. To investigate this phenomenon further, a lipofuscin

assay was conducted. This assay revealed that sodium benzoate significantly increased the

presence of auto-fluorescence. Further experimentation with the glo-1(-), which lacks lysosome-

related organelles (LROs), I revealed that sodium benzoate causes an accumulation of age-

pigments in LROs (the site of the decomposition of oxidized macromolecules). These

phenomena have never been reported in any previous sodium benzoate related studies in

literature. This intriguing phenotype further links sodium benzoate with longevity and aging. It

has been found that the accumulation of lipofuscin is age-related (Soukas et al. 2013). In C.

elegans, age-pigments are composed of oxidized and cross-linked lipids and proteins (Gerstbrein

et al. 2005), which is known to be toxic to animals. For example, the accumulation of lipid

peroxide 4-hydroxynonenal is related to premature aging in C. elegans (Ayyadevara et al. 2005).

This study also demonstrated that sodium benzoate accelerated neurodegeneration in a

transgenic beta-amyloid Alzheimer’s disease C. elegans model. Alzheimer’s disease (and other

neurodegenerative diseases) are often related to aging and therefore, this discovery is consistent

with the negative impact of sodium benzoate in the aging process. The accelerating

neurodegeneration by sodium benzoate may be caused by the premature aging of neuronal cells



18

or by the upregulation of beta amyloid peptide production (Link et al. 2006). This calls for

further experimentations to reveal the mechanisms of sodium benzoate in neurodegeneration.

In the modern-day health and medicine field, there is strong focus on curing rather than

prevention. However, it is more practicable and impactful to focus on prevention. In this research

study, I revealed the harmful impact of sodium benzoate, one of the most used preservatives, on

animal health. Sodium benzoate is a factor in delaying growth, accelerating aging, decreasing

lifespan, and increasing the risk of developing fatal diseases such as Alzheimer’s. All these

adverse health effects are long term, making sodium benzoate’s role in human health even more

secretive and potent. Its dangers on animal health may prove to be just as consequential to

human health. Reduced consumption of sodium benzoate would contribute to preventing the

health problems. This study has set the base for critical further inquiries into sodium benzoate’s

effect on human health. In the meantime, the FDA should urgently reassess whether sodium

benzoate should be allowed in our diet.

FUTURE DIRECTION

Future research must focus on uncovering the mechanism(s) by which sodium benzoate harms

animal health. As I move forward with this work, I am planning a series of three critical

analyses. First, other age regulating pathways (the mechanistic target of rapamycin (mTOR),

sirtuins, etc) will be investigated. Second, the whole-genome gene expression changes upon

treatment of sodium benzoate will be measured through both transcriptome and proteome

analyses to identify additional mechanisms in regulating development and aging. And third, the

relationship between sodium benzoate and Alzheimer’s disease will be further studied. Finally, I

would also like to use mammalian cell lines and higher organisms like mice or primates to study

sodium benzoate further.



19

REFERENCES

Ayyadevara, S., Engle, M. R., Singh, S. P., Dandapat, A., Lichti, C. F., Beneš, H., ... & Zimniak,

P. (2005). Lifespan and stress resistance of Caenorhabditis elegans are increased by

expression of glutathione transferases capable of metabolizing the lipid peroxidation product

4‐hydroxynonenal. Aging cell, 4(5), 257-271.

Burdine, R. D., & Stern, M. J. (1996). Easy RNA isolation from C. elegans: a TRIZOL based

method. Worm Breed. Gaz, 14(10).

Clokey, G. V., & Jacobson, L. A. (1986). The autofluorescent “lipofuscin granules” in the

intestinal cells of Caenorhabditis elegans are secondary lysosomes. Mechanisms of ageing

and development, 35(1), 79-94.

Dunbar, T. L., Yan, Z., Balla, K. M., Smelkinson, M. G., & Troemel, E. R. (2012). C. elegans

detects pathogen-induced translational inhibition to activate immune signaling. Cell host &

microbe, 11(4), 375-386.

Estes, K. A., Dunbar, T. L., Powell, J. R., Ausubel, F. M., & Troemel, E. R. (2010). bZIP

transcription factor zip-2 mediates an early response to Pseudomonas aeruginosa infection

in Caenorhabditis elegans. Proceedings of the National Academy of Sciences, 107(5), 2153-

2158.

Gerstbrein, B., Stamatas, G., Kollias, N., & Driscoll, M. (2005). In vivo spectrofluorimetry

reveals endogenous biomarkers that report healthspan and dietary restriction in

Caenorhabditis elegans. Aging cell, 4(3), 127-137.

Hall, M. N. (2008, December). mTOR—what does it do?. In Transplantation proceedings (Vol.

40, No. 10, pp. S5-S8). Elsevier.

Hassan, W. M., Dostal, V., Huemann, B. N., Yerg, J. E., & Link, C. D. (2015). Identifying Aβ-

specific pathogenic mechanisms using a nematode model of Alzheimer's

disease. Neurobiology of aging, 36(2), 857-866.

Han, S. K., Lee, D., Lee, H., Kim, D., Son, H. G., Yang, J. S., ... & Kim, S. (2016). OASIS 2:

online application for survival analysis 2 with features for the analysis of maximal lifespan

and healthspan in aging research. Oncotarget, 7(35), 56147.

Hermann, G. J., Schroeder, L. K., Hieb, C. A., Kershner, A. M., Rabbitts, B. M., Fonarev, P., ...

& Priess, J. R. (2005). Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.

Molecular biology of the cell, 16(7), 3273-3288.

Hunt, P. R. (2017). The C. elegans model in toxicity testing. Journal of Applied Toxicology,

37(1), 50-59.

Khoshnoud, M. J., Siavashpour, A., Bakhshizadeh, M., & Rashedinia, M. (2018). Effects of

sodium benzoate, a commonly used food preservative, kon learning, memory, and oxidative

stress in brain of mice. Journal of biochemical and molecular toxicology, 32(2), e22022.

Lin, C. H., Chen, P. K., Chang, Y. C., Chuo, L. J., Chen, Y. S., Tsai, G. E., & Lane, H. Y.

(2014). Benzoate, a D-amino acid oxidase inhibitor, for the treatment of early-phase

Alzheimer disease: a randomized, double-blind, placebo-controlled trial. Biological

psychiatry, 75(9), 678-685.



20

Lin, C. H., Chen, P. K., Wang, S. H., & Lane, H. Y. (2019). Sodium benzoate for the treatment

of behavioral and psychological symptoms of dementia (BPSD): A randomized, double-

blind, placebo-controlled, 6-week trial. Journal of Psychopharmacology, 33(8), 1030-1033.

Lin, K., Hsin, H., Libina, N., & Kenyon, C. (2001). Regulation of the Caenorhabditis elegans

longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nature genetics, 28(2),

139-145.

Link CD. (2006). C. elegans models of age-associated neurodegenerative diseases: lessons from

transgenic worm models of Alzheimer's disease. Exp Gerontol., 41(10), 1007-13.

Luo, Y., Wu, Y., Brown, M., & Link, C. D. (2009). Caenorhabditis elegans model for initial

screening and mechanistic evaluation of potential new drugs for aging and Alzheimer’s

disease. In Methods of Behavior Analysis in Neuroscience. 2nd edition. CRC Press/Taylor

& Francis.

Marsha McCulloch, MS, RD. (n.d.). Sodium Benzoate: Uses, Dangers, and Safety. Retrieved

from https://www.healthline.com/nutrition/sodium-benzoate

Margie, O., Palmer, C., & Chin-Sang, I. (2013). C. elegans chemotaxis assay. JoVE (Journal of

Visualized Experiments), (74), e50069.

Murphy, C. T., & Hu, P. J. (2018). Insulin/insulin-like growth factor signaling in C. elegans. In

WormBook: The Online Review of C. elegans Biology [Internet]. WormBook.

Pan, H., & Finkel, T. (2017). Key proteins and pathways that regulate lifespan. Journal of

Biological Chemistry, 292(16), 6452-6460.

Park, S. K., Tedesco, P. M., & Johnson, T. E. (2009). Oxidative stress and longevity in

Caenorhabditis elegans as mediated by SKN‐1. Aging cell, 8(3), 258-269.

Pelka, K., & De Nardo, D. (2018). Emerging concepts in innate immunity. In Innate Immune

Activation (pp. 1-18). Humana Press, New York, NY.

Pongsavee, M. (2015). Effect of sodium benzoate preservative on micronucleus induction,

chromosome break, and Ala40Thr superoxide dismutase gene mutation in lymphocytes.

BioMed research international, 2015.

Salih, D. A., & Brunet, A. (2008). FoxO transcription factors in the maintenance of cellular

homeostasis during aging. Current opinion in cell biology, 20(2), 126-136.

Shen, X., Ellis, R. E., Lee, K., Liu, C. Y., Yang, K., Solomon, A., ... & Kaufman, R. J. (2001).

Complementary signaling pathways regulate the unfolded protein response and are required

for C. elegans development. Cell, 107(7), 893-903.

Soukas, A. A., Carr, C. E., & Ruvkun, G. (2013). Genetic regulation of Caenorhabditis elegans

lysosome related organelle function. PLoS genetics, 9(10).

Terman, A., & Brunk, U. T. (1998). Lipofuscin: mechanisms of formation and increase with age.

Apmis, 106, 265-276.

Xia, J., Gravato-Nobre, M., & Ligoxygakis, P. (2019). Convergence of longevity and immunity:

lessons from animal models. Biogerontology, 1-8.



21

Appendix I:

Table 1. Lifespan results

age-1

(-)

No.

subjects

Mean lifespan

(days)

Standard

error

95% confidence

interval

Chi# P value# Corrected

p value#

Control

59 23.01 0.93 21.18 ~ 24.84

2mM 62 20.78 0.8 19.21 ~ 22.35 5 0.0253 0.1013

5mM 30 19.9 1.27 17.41 ~ 22.38 7.78 0.0053 0.0211

10mM 59 14.4 0.64 13.13 ~ 15.66 48.42 0 0

20mM 56 11.76 0.46 10.86 ~ 12.65 69.8 0 0

daf-16

(-)

No.

subjects

Mean lifespan

(days)

Standard

error

95% confidence

interval


p value#

Control

54 9.91 0.31 9.29 ~ 10.52

2mM 53 8.96 0.48 8.01 ~ 9.90 0.06 0.803 1

5mM 48 8.17 0.47 7.26 ~ 9.09 4.88 0.0272 0.1087

10mM 54 7.3 0.36 6.60 ~ 8.01 30.64 3.10E-08 1.20E-07

20mM 44 7.4 0.34 6.73 ~ 8.07 30.42 3.50E-08 1.40E-07

N2

(25˚C)

No.

subjects

Mean lifespan

(days)

Standard

error

95% confidence

interval


p value#

Control

57 11.56 0.44 10.70 ~ 12.41

2mM 55 10.82 0.4 10.03 ~ 11.62 3.19 0.0739 0.2957

5mM 57 9.77 0.48 8.83 ~ 10.71 6.14 0.0132 0.0529

10mM 53 9.22 0.41 8.42 ~ 10.01 18.09 0.000021 0.0001

20mM 53 9.08 0.33 8.44 ~ 9.72 24.18 8.80E-07 3.5E-06

N2

(20˚C)

No.

subjects

Mean lifespan

(days)

Standard

error

95% confidence

interval


p value#

Control

28 20 0.65 18.72 ~ 21.28

2mM 40 17.33 0.64 16.07 ~ 18.59 10.72 0.0011 0.0042

5mM 38 15.94 0.55 14.86 ~ 17.01 21.26 0.000004 0.000016

10mM 34 12.74 0.46 11.85 ~ 13.64 43.82 0 0

20mM 21 10.78 0.62 9.56 ~ 12.00 45.03 0 0

#: Statistical analysis by comparing control.



22

Appendix II:

Table 2. Primers used for quantitative RT-PCR

Gene Forward Reverse Group

hsp-60 GGAAGCCCAAAGATCACAAA CAGCCTCCTCATTAGCCTTG Mitochondrial stress

irg-1 AGCCACCGAGCGATTGATTGC GTGGCATTTTGGGCATCTTCTTG Innate immunity

act-1 CTACGAACTTCCTGACGGACAAG CCGGCGGACTCCATACC Housekeeping

hsp-4 TGACTCGTGCCAAGTTTGAG GCTCCTTGCCGTTGAAGTAG ER stress

hsp-16.2 TGCAGAATCTCTCCATCTGAGT TGGTTTAAACTGTGAGACGTTGA Cytoplasmic stress

sod-3 CCAACCAGCGCTGAAATTCAATGG GGAACCGAAGTCGCGCTTAATAGT Oxidative stress

hsf-1 TTGACGACGACAAGCTTCCAGT AAAGCTTGCACCAGAATCATCCC Cytoplasmic stress

sodium benzoate, a common preservative, inhibits growth

Documents