Sd

JUa

a

ARR2A

KDM

1

hics2hd

tspK2edgaot

bS

vT

0d

Microbiological Research 167 (2012) 564– 570

Contents lists available at SciVerse ScienceDirect

Microbiological Research

j our na l ho mepage: www.elsev ier .de /micres

imple and rapid multiplex PCR for identification of the main humaniarrheagenic Escherichia coli

oshua Tobias ∗, Sreekanth-Reddy Vutukuruniversity of Gothenburg Vaccine Research Institute (GUVAX), and WHO Collaborating Center for Research on enterotoxigenic Escherichia coli (ETEC), Department of Microbiologynd Immunology, The Sahlgrenska Academy of University of Gothenburg, S-40530 Gothenburg, Sweden

r t i c l e i n f o

rticle history:eceived 21 July 2011

a b s t r a c t

Establishment of a simple and rapid multiplex PCR system for identification of the main diarrheagenicE. coli categories, including enteroaggregative E. coli, enterotoxigenic E. coli, enteropathogenic E. coli, and

eceived in revised form4 November 2011ccepted 26 November 2011

eywords:iarrheagenic E. coli

enterohemorrhagic E. coli, is described. This two-step multiplex PCR system allows the identificationby targeting CVD432, LT, STh, STp, Eae, Bfp, Stx1, and Stx2. By applying the developed multiplex PCRsystem, categorization of E. coli isolates isolated from stool samples of infants with diarrhea into themain diarrheagenic E. coli categories is also shown.

© 2011 Elsevier GmbH. All rights reserved.

ultiplex PCR

. Introduction

Escherichia coli bacteria are among the normal bacterial flora ofuman gut, however these bacteria can be pathogenic and cause

nfection (Nataro and Kaper 1998). Among children in developingountries E. coli is the main etiologic cause of diarrhea and repre-ent a major public health problem in these areas (Parashar et al.003; Nataro and Kaper 1998). One group of E. coli organisms whichas an important role as cause of enteric and diarrheal disease isiarrheagenic E. coli (DEC) (Nataro and Kaper 1998).

On the basis of distinct epidemiological and clinical fea-ures, specific virulence determinants, and association with certainerotypes (Nataro and Kaper 1998; Okeke 2009), as well as theirrevalence in several different geographical areas (Nataro andaper 1998; Porat et al. 1998; Nguyen et al. 2005; Aranda et al.007; Khairun et al. 2007; Hien et al. 2008; Okeke 2009; Hardegent al. 2010; Rajendrana et al. 2010; Reyes et al. 2010), DEC can beivided into four main prevalent categories (Table 1): Enteroag-regative E. coli (EAEC) which are characterized by an aggregative

dherence pattern on cultured epithelial cells, and by productionf fimbrial colonization factors called aggregative adherence fac-ors (AAFs); enterotoxigenic E. coli (ETEC) which are defined based

Abbreviations: DEC, diarrheagenic E. coli; Eae, E. coli attaching and effacing; Bfp,undle-forming pilus; LT, heat-labile enterotoxin; ST, heat-stable enterotoxin; Stx1,tx2, Shiga toxins 1, 2; PCR, polymerase chain reaction.∗ Corresponding author at: Department of Microbiology and Immunology, Uni-

ersity of Gothenburg, P.O. Box 435, S-40530 Gothenburg, Sweden.el.: +46 31 7866206; fax: +46 31 7866205.

E-mail address: Joshua.Tobias@microbio.gu.se (J. Tobias).

944-5013/$ – see front matter © 2011 Elsevier GmbH. All rights reserved.oi:10.1016/j.micres.2011.11.006

on production of heat labile (LT) and/or heat-stable (in form ofSTp or STh) enterotoxins; enteropathogenic E. coli (EPEC) bacteriaharboring the locus of enterocyte effacement’ (LEE) pathogenic-ity island, which encodes factors responsible for the attaching andeffacing (A/E) phenotype on host enterocytes (Jerse et al. 1990).Some EPEC strains can also harbor the EPEC adherence plasmid(EAF) comprising the cluster of genes encoding the bundle-formingpilus (bfp). EPEC strains with the EAF plasmid are classified as ‘typi-cal EPEC’, whereas EPEC strains that do not possess the EAF plasmidare classified as ‘atypical EPEC’ (Kaper 1996; Trabulsi et al. 2002);enterohemorrhagic E. coli (EHEC), which belong to Shiga toxin-producing E. coli and cause large outbreaks, can invade the colonicepithelium and produce Shiga toxins 1 and 2 (stx1 and stx2). Anadditional group of DEC, but with significantly lower prevalence, isenteroinvasive E. coli (EIEC) (or Shiga toxin-producing E. coli, STEC)which are biochemically, genetically, and pathogenetically closelyrelated to Shigella spp. (Nataro and Kaper 1998; Okeke 2009).

Different molecular methods, such as DNA hybridization andPCR, have been developed during the recent years for identifica-tion of different categories of DEC, and these methods are basedon genes related to the pathogenicity of each category (Nataro andKaper 1998). One of the methods which has been widely used as adiagnostic method is multiplex PCR (Nataro and Kaper 1998; Tomaet al. 2003; Vidal et al. 2004; Aranda et al. 2007; Vilchez et al. 2009).The overall target genes for detection of the main four categoriesof DEC in multiplex systems are varied between different studies,however the main targeted genes are listed in Table 2. The use of

one primer which could detect two genes has also been appliedin different studies, e.g. primers VT-com for detection of both Stx1and Stx2, or primers which can recognize both STh and STp (Tomaet al. 2003; Aranda et al. 2007).

J. Tobias, S.-R. Vutukuru / Microbiological Research 167 (2012) 564– 570 565

Table 1The key characteristics of main prevalent categories of DEC.

Populations in risk Disease Transmission route Main virulence factors andcharacteristics

Reference

EAEC Children and adultsworldwide

Persistent watery, mucoid,bloody or non-bloody diarrhea,with low-grade fever and littleor no vomiting

Fecal–oral 1. Aggregative adherencefimbriae (AAF)2. Master regulator of EAECplasmid virulence factors(AggR), including CVD432

Nataro and Kaper (1998),Cennimo et al. (2007),Huang et al. (2006)

EHEC Children and adultsworldwide

Watery diarrhea followed bygrossly bloody diarrhea, withlittle or no fever. Dysentery,haemorrhagic colitis (HC) andhaemolytic-uraemic syndrome(HUS)

Fecal–oral 1. Shiga toxins (Stx1 and Stx2).2. Intimin

Nataro and Kaper (1998)

EPEC Mainly infants and childrenin developing countries

Profuse watery diarrhea,commonly with vomiting andlow-grade fever

Fecal–oral 1. Intimin; in both typical andatypical EPEC isolates2. Bundle-forming pili (BFP);only in atypical EPEC isolates

Nataro and Kaper (1998)

cal–o

rppAfs

2

2

psCff

2

tb

TM

ETEC Children in developingcountries, and travelers tothese areas

Watery diarrhea, usuallywithout blood, with fever andvomiting in minority of cases

Fe

The present study was undertaken to establish a simple andapid multiplex PCR system for identification of the main fourrevalent categories of DEC, i.e. EAEC, EHEC, EPEC, and ETEC usingrimers detecting CDV432, LT, STh, STp, Eae, Bfp, Stx1, and Stx2.s shown, the established system was also successfully applied

or identification and categorization of E. coli isolates isolated fromtools of infants with diarrhea into four DEC categories.

. Materials and methods

.1. Control and clinical E. coli strains

Control E. coli strains which were used to establish the multi-lex PCR are listed in Table 3. Clinical E. coli isolates, isolated fromtools of infants with diarrhea, were kindly provided by Prof. Daniohen (Tel-Aviv University, Israel). All strains were cultured in LB

or overnight at 37 ◦C, and used for preparation of DNA templatesor PCRs.

.2. Preparation of reference DNA templates from control strains

Portion of the over-night cultures from each strain was cen-rifuged and re-suspended by vortex in sterile deionized water. Theacterial suspension was then boiled in 100 ◦C for 5 min, followed

able 2ain target genes used for detection of EAEC, EHEC, EPEC, and ETEC by multiplex PCR in

DEC group Target gene Gene’s product References

EAEC aat2 (CVD432)aggR

Dispersin transporterMaster regulator gene

Toma et al. (2003), ArToma et al. (2003), Br

EHEC eaestx1stx2stx1and stx2

IntiminStx1Stx2Stx1 + Stx2

Toma et al. (2003), VidRajendrana et al. (201Vidal et al. (2004), AraVilchez et al. (2009), RVidal et al. (2004), AraVilchez et al. (2009), RToma et al. (2003), Kh

EPEC eaebfpA

IntiminBfp

Toma et al. (2003), VidFujioka et al. (2009), B(2010)Vidal et al. (2004), Ara

ETEC eltestA1estA2-4estA1 andestA2-4

LTSTpSThSTp + STh

Toma et al. (2003), VidBrandal et al. (2007), FFujioka et al. (2009)Fujioka et al. (2009), VToma et al. (2003), Vid(2010)

ral 1. Colonization factors.2. The enterotoxins, LT and ST(in forms of STp or STh)

Nataro and Kaper (1998),Qadri et al. (2005)

by centrifugation at 16,000 × g for 2 min. Aliquots of the sup wereprepared, froze at −20 ◦C, and used as reference template for singleand multiplex PCR. Due to lack of facility for culturing EHEC bac-teria, genomic DNA of an EHEC strain (Table 3) was purchased andused directly as control template.

2.3. Primers

The sequences and the sizes of PCR products of each set ofprimers used in this study are listed in Table 4. The primers wereselected based on their specificity and sensitivity shown in multi-plex PCR systems from different studies, and also based on the sizesof PCR products which can be clearly distinguishable by agarose gelelectrophoresis. Due to the epidemiological importance in identi-fication of ETEC isolates positive for either or both STp and STh,and also typical or atypical EPEC isolates, individual primers fordetection of STh, STp, and Bfp were included in the multiplex PCR.

2.4. Single and multiplex PCR

In single PCR reactions one pair of primers, and in multiplexPCR reactions two or more pairs of primers were used. All the PCRreactions were performed in 20 �l final volume containing 0.5 �lof the template DNA, 10 �l of ReddyMix (containing KAPA2G Fast

different studies.

anda et al. (2007), Khairun et al. (2007), Hien et al. (2008), Vilchez et al. (2009)andal et al. (2007), Khairun et al. (2007), Fujioka et al. (2009)

al et al. (2004), Khairun et al. (2007), Fujioka et al. (2009), Vilchez et al. (2009),0)nda et al. (2007), Brandal et al. (2007), Hien et al. (2008), Fujioka et al. (2009),ajendrana et al. (2010)nda et al. (2007), Brandal et al. (2007), Hien et al. (2008), Fujioka et al. (2009),ajendrana et al. (2010)airun et al. (2007)al et al. (2004), Aranda et al. (2007), Khairun et al. (2007), Hien et al. (2008),randal et al. (2007), Vidal et al. (2004), Vilchez et al. (2009), Rajendrana et al.

nda et al. (2007), Hien et al. (2008), Vilchez et al. (2009), Rajendrana et al. (2010)al et al. (2004), Aranda et al. (2007), Khairun et al. (2007), Hien et al. (2008),ujioka et al. (2009), Vilchez et al. (2009), Rajendrana et al. (2010)

ilchez et al. (2009), Hien et al. (2008)al et al. (2004), Aranda et al. (2007), Khairun et al. (2007), Rajendrana et al.

566 J. Tobias, S.-R. Vutukuru / Microbiological Research 167 (2012) 564– 570

Table 3List of control strains or DNA used in single and multiplex PCRs.

DAE category Strain/DNA Source Specific target

EAEC 38077 CCUGa CVD4322669-1 Bolivia CVD432

EHEC DNA (from strain 35008) CCUG Stx1, Stx2EPEC

Typical 38068 CCUG Eae, BfpAtypical 23a-1 Bolivia Eae

HMAtwff7Tg

2

clptsisa

3

3

peEtp

TL

ETEC E-1744

E-371

a Culture Collection University of Gothenburg.

otStart DNA Polymerase, buffer, 0.2 mM of each dNTP, 1.5 mM ofgCl2, at the final concentration of 1.5 mM) (Techtum, Sweden).

dditional MgCl2 to the final concentration of 2 mM, and each ofhe primers (MWG, Germany) to the final concentration of 10 �Mere added for the final PCR reaction. The thermocycling conditions

or all the PCRs were as follows: 95 ◦C for 2 min, 95 ◦C for 15 s, 52 ◦Cor 8 s, and 10 s at 72 ◦C for 30 cycles, with a final 2 min extension at2 ◦C, and all the PCRs were performed in the MJ Research PTC-200hermal Cycler. Amplified samples were evaluated by 1.5% agaroseel electrophoresis in Tris–borate–EDTA buffer and EtBr staining.

.5. Preparation of DNA from E. coli clinical isolates

The developed multiplex PCR was applied on 50 samples of E. colilinical isolates. Each sample was consisted of up to three E. coli iso-ates which had been isolated from an infant with diarrhea. Equalortions from the over-night culture of each isolate belonging tohe same infant were collected and merged into one sample. Eachample was then centrifuged and re-suspended by vortex in ster-le deionized water. The preparation of DNA from each of the 50amples and the multiplex PCR on these samples were performeds above.

. Result

.1. Specificity of the selected primers in single PCR

Single PCR was first conducted to examine the specificity of eachairs of primers to amplify the corresponding target genes. Refer-

nce DNA templates from two control strains of EAEC, EPEC, andTEC were examined to indicate the specificity of the primers. Dueo the lack of facility for culturing EHEC, DNA of an EHEC strain wasurchased and used as reference DNA template. As seen in Fig. 1,

able 4ist of primers, their sequences and the size of the amplified products, used in this study.

Target gene Primers Primer de

bfp GGAAGTCAAATTCATGGGGGTAT BfpGGAATCAGACGCAGACTGGTAGT

eae TCAATGCAGTTCCGTTATCAGTT EaeGTAAAGTCCGTTACCCCAACCTG

elt ACGGCGTTACTATCCTCTC LTTGGTCTCGGTCAGATATGTG

CVD432 CTGGCGAAAGACTGTATCAT pCVD432AAATGTATAGAAATCCGCTGTT

estA1 TCTTTCCCCTCTTTTAGTCAG STp

ACAGGCAGGATTACAACAAAGestA2-4 TTCACCTTTCCCTCAGGATG STh

CTATTCATGCTTTCAGGACCAstx1 CAGTTAATGTGGTGGCGAAGG Stx1

CACCAGACAATGTAACCGCTGstx2 ATCCTATTCCCGGGAGTTTACG Stx2

GCGTCATCGTATACACAGGAGCstx1 + stx2 GAGCGAAATAATTTATATGTG VTcom

TGATGATGGCAATTCAGTAT

GU ETEC strain collection LTGU ETEC strain collection LT, STh, STp

PCR products with the expected sizes for the corresponding refer-ence DNA templates were detected: pCVD432 (630 bp) for EAEC;Eae (482 bp) for EHEC, typical and atypical EPEC; Stx1 (348 bp),Stx2 (584 bp), and VTcom (518 bp) for EHEC; Bfp (320 bp) for typicalEPEC; LT (273 bp), STp (166 bp), and STh (120 bp) for ETEC referenceDNA templates.

3.2. The setup for multiplex PCR

Based on the specificity of the tested primers seen in the singlePCRs, a two-step multiplex PCR flowchart was then set up (Fig. 2).According to this flowchart, the initial multiplex PCR (i.e. PCR-I)is applied to detect the presence of the targets genes CVD432, elt,estA1, estA2-4, and eae. As shown in Fig. 3, multiplex PCR using ref-erence DNA templates of either EAEC, ETEC, EPEC, or EHEC togetherwith the above primers resulted in specific amplification of thetarget genes in the corresponding reference DNA templates (lanes1–4). Amplification of the band for eae by PCR-I may identify E. coliisolate which could be EHEC, typical EPEC, or atypical EPEC. There-fore, VTcom primers which recognize both variants of stx, i.e. stx1and stx2 (Toma et al. 2003; Aranda et al. 2007), and also Bfp primersare used in the second round of multiplex PCR, i.e. PCR-II. As shownin Fig. 3 (lanes 5 and 6), multiplex PCR using reference DNA tem-plates of either EHEC or typical EPEC together with VTcom and Bfpprimers resulted in specific amplification of the corresponding tar-get genes (lanes 5 and 6). In case of presence of an E. coli isolatewhich is defined as an atypical EPEC, no fragments by Bfp nor byVTcom are amplified. In case of the presence of an E. coli isolatewhich is EHEC, VTcom is amplified, and an optional step of multi-

plex PCR utilizing primers for both stx1 and stx2 can also be appliedto identify the specific type of stx in the EHEC isolate (Fig. 3, lane5). As shown in Fig. 3 the multiplex PCR reactions resulted in clearand specific PCR-product bands, with no visible non-specific bands,

signation PCR Product size (bp) Reference

300 Vidal et al. (2004)

482 Vidal et al. (2004)

273 Rodas et al. (2009)

630 Aranda et al. (2007),Vilchez et al. (2009)

166 Rodas et al. (2009)

120 Rodas et al. (2009)

348 Vidal et al. (2004)

584 Vidal et al. (2004)

518 Toma et al. (2003)

J. Tobias, S.-R. Vutukuru / Microbiological Research 167 (2012) 564– 570 567

F dder;

3 8 (Bfpl

iofld2

3i

aist

ig. 1. Single PCR of reference controls with specific primers. Lane M, 100-bp size la (Eae), lane 4 (Stx1), lane 5 (Stx2), lane 6 (VTcom); EPEC-38068: lane 7 (Eae), lane

ane 12 (STp), lane 13 (STh).

ndicating the specificity of the primers in each step of the devel-ped multiplex PCR system. Each of the developed PCR steps in theowchart had a PCR program of less than 1 h, and the entire proce-ure including running the gels and analysing the results was about–2.5 h.

.3. Application of the developed multiplex PCR on E. coli clinicalsolates

To examine whether the developed multiplex PCR can be

pplied on E. coli clinical isolates, isolated from stool samples ofnfants with diarrhea, 50 samples were prepared and tested. All theamples were first examined by the first step of the developed mul-iplex PCR (i.e. PCR-I). Fig. 4 shows example of 14 samples which

SampleSample

(isolated (isolated E. coliE. coli ))

Multiplex PCR by prim

pCVD432, Eae, LT, STp

If + fo r pCVD432: EAEC

If + fo r Ea e : EHEC or EPEC

Multiplex PCR by prim

VTcom and Bfp

If + for VTcom: EHEC

If + fo r Bf p: Typical EPECyp

Optional PCR w ith Stx1 and Stx 2

PCR-III (optional)

Fig. 2. Flowchart for multiplex PCR. (–) indicates no amplification of the tested

lane 1, EAEC-38077 (pCVD432); lane 2, EAEC-2669-1 (pCVD432); EHEC (DNA): lane); EPEC-23a-1: lane 9 (Eae), lane 10 (Bfp); lane 11 ETEC-E-1744 (LT), ETEC-E-371:

some of them were identified as EAEC (samples 2, 3, 4, 5, 10, and12), ETEC with STp (samples 1), and ETEC with LT + STp (sample6). Also in this step of the multiplex PCR sample 7 was found to beEae-positive (Fig. 4). The remaining samples were also examined inthe first step of the multiplex PCR (data not shown). Following theflowchart for our developed multiplex PCR, all the samples whichwere Eae-positive were then examined in the second step of themultiplex PCR (i.e. PCR-II). As shown in Fig. 5, EHEC by amplifi-cation of Stx1 + Stx2 with VTcom primers (sample 17) and typicalEPEC by amplification of bfp with Bfp primers (sample 24) were

identified. Sample 17 was further examined in the optional PCR-IIIstep and detection of Stx2 was observed (data not shown). Ampli-fication of Bfp or Stx1+Stx2 of the remaining Eae-positive sampleswas not observed, indicating that these samples were atypical EPEC.

ers:

, STh

PCR-I

If + fo r LT/STp/STh: ETEC

ers:

PCR IIPCR-II

If - for Bf p and VTcom:

Atypical EPECAtypical EPE C

target gene, while (+) indicates amplification of the tested target gene.

568 J. Tobias, S.-R. Vutukuru / Microbiological Research 167 (2012) 564– 570

Fig. 3. Multiplex PCR of reference controls with specific primers. Lane M, 100-bp size ladder. In lanes 1–4, the PCR reactions contained the primers for pCVD432, Eae, Bfp,LT, STp and STh: lane 1 (EAEC-38077), lane 2 (EHEC DNA), lane 3 (EPEC-38068), lane 4 (ETEC-E-371). In lanes 5–6 the PCR reactions contained the primers VTcom and forBfp: lane-5 (EHEC DNA), lane-6 (EPEC-38068). Lane 7, EHEC DNA with stx1 + stx2.

Fig. 4. First step (PCR-I) of the multiplex PCR on 13 samples consisting of DNA from E. coli isolates isolated from stool samples of infants, as described in materials andmethods. Lane M, 100-bp size ladder. Detection of CVD432 (samples 2, 3, 4, 5, 6, 10, and 12), LT (sample 6), STp (sample 1 and 6), STh (sample 6), and Eae (sample 7) isobserved.

Fig. 5. Second step (PCR-II) of the multiplex PCR on 14 samples, which were found as Eae-positive based on the PCR-I. Lane M, 100-bp size ladder. Detection of VT-com(samples 17) and Bfp (sample 24) is observed.

iologic

Twc

4

bscmnT(oost(

lsmEei(eReptutTb(vppe

tsf2BoeiStuoieshdpsEpow

J. Tobias, S.-R. Vutukuru / Microb

hese results indicated that our developed multiplex PCR systemas applicable on clinical isolates isolated from stool, and for their

ategorization into the main four DEC categories.

. Discussion

Different non-molecular methods such as phenotypic assaysased on virulence characteristics, biochemical assays, anderotyping are available and can be used for identification andharacterization of DEC E. coli (Nataro and Kaper 1998). Theseethods correlate with specific categories of DEC, however they are

ot solely sufficient for identification of the main DEC categories.he genes which encode the virulence of DEC were characterizedNataro and Kaper 1998) based on which PCR systems were devel-ped to identify the DEC according to their specific virulence genesf (Nataro and Kaper 1998). Based on these PCRs, multiplex PCRystems as practical and rapid diagnostic tools for the routine iden-ification of all human DEC catogories have also been developedToma et al. 2003; Aranda et al. 2007; Vidal et al. 2004).

Using multiplex PCR, or DNA hybridization, for examining iso-ated E. coli from stool samples of children with diarrhea, severaltudies from different regions in world have shown that EAEC is theain prevalent DEC isolated from these stool samples, followed by

TEC, EPEC, or EHEC (Bueris et al. 2007; Porat et al. 1998; Nessat al. 2007; Rajendrana et al. 2010). In addition, EIEC has been foundn several different geographical areas as the least prevalent DECPorat et al. 1998; Nguyen et al. 2005; Aranda et al. 2007; Khairunt al. 2007; Hien et al. 2008; Okeke 2009; Hardegen et al. 2010;ajendrana et al. 2010; Reyes et al. 2010). We were therefore inter-sted to set up a multiplex PCR which can identify the four mainrevalent categories of DEC. The primers used in our two-step mul-iplex PCR system were chosen based on the prevalence of theirse in several other studies and as well as their specificity for iden-ification of target genes of the main four categories of the DEC.he pCVD432 primers for detection of EAEC have been shown toe 100% specific and highly sensitive in different study locationsCennimo et al. 2007), and these primers may help to identify moreirulent typical EAEC strains because a positive result based onresence of CVD432 can be considered a surrogate marker for theresence of the master regulator gene in EAEC, i.e. aggR (Huangt al. 2006).

Several studies have described multiplex PCR systems by whichhe identification of all the DEC categories, including EIEC, is pos-ible. However, in such multiplex PCR systems individual primersor detection of STp, STh, and Bfp were not included (Toma et al.003; Vidal et al. 2004; Aranda et al. 2007; Khairun et al. 2007;randal et al. 2007; Vilchez et al. 2009; Rajendrana et al. 2010),r the system included fluorescent detection by RT-PCR (Brandalt al. 2007). In multiplex PCR systems in which one set of primerss used to detect both STh and STp, detection of only STp- or onlyTh-positive ETEC isolates may be missed. Such detection is essen-ial in epidemiological research for DEC infections. In addition, these of multiplex systems which are based on fluorescence detectionf the PCR products may not be applicable in all labs particularlyn low-budgeted laboratories like in developing countries. Fujiokat al. (2009) have also described a multiplex PCR system, in whicheparate primers for detection of both STh and STp were included,owever their multiplex PCR system did not include primers foretection of Bfp and therefore detection of typical EPEC was notossible. Kimata et al. (2005) have also described a multiplex PCRystem for amplification of 12 target genes for identification of

AEC, EHEC, EPEC, ETEC and EIEC, including separate and specificrimers for detection of STh, STp, and Bfp. In their system, detectionf all the virulence factors was not clearly shown and an extra bandas observed when all the primers were included in the system.

al Research 167 (2012) 564– 570 569

This extra band was disappeared only when two sets of primers fordetection of EPEC, including primers for detection of CVD432, hadbeen excluded from the multiplex PCR. Moreover the sequences ofsome primers were not indicated, and the PCR products in somecases were very close to each other. Therefore, in general, draw-backs such as lack of specific primers for detection of STp, STh,and Bfp, expensive multiplex PCR systems, multiplex PCR systemswhich result in non-specific bands, or PCR products with similarsizes might reduce the cost-effectiveness of such long or expensivesystems in diagnostic laboratories.

In the first step of our multiplex PCR system, i.e. PCR-I, the mostprevalent DEC categories, i.e. EAED, ETEC, and Eae-expressing DECcan be easily and rapidly identified. This is then followed by asecond step multiplex PCR, PCR-II, to further sub-categorize theEae-expressing DEC into EHEC, typical-EPEC, and atypical-EPEC.The results from the described multiplex PCR are in agreementwith single PCR for all the examined controls of the four main DECcategories, indicating the specificity of our established multiplexPCR system. Moreover, the use of commercial ReddyMix, whichexcept the required primers and addition of MgCl2, contains all theother necessary components for PCR, enhances the reproducibil-ity of the system. In addition, the length of the PCR programs usedin each step of our multiplex PCR was less than 1 h and in totalwithin about 2–2.5 h the samples were analyzed. In several otherstudies which describe multiplex PCR systems, only the length ofthe PCR programs were 2 h or more (Vidal et al. 2004; Toma et al.2003; Kimata et al. 2005; Vilchez et al. 2009; Hardegen et al. 2010;Fujioka et al. 2009). In addition, the multiplex PCR reactions in oursystem resulted in clear and specific PCR-product bands, with novisible non-specific bands, indicating the specificity of the primersin each of the steps in the developed multiplex PCR system. As wehave also shown, the developed system was applied on isolatesof E. coli isolated from stools of infants with diarrhea and cate-gorization of these isolates into the main four categories of DEC,including detection of both typical and atypical EPEC isolates aswell as detection of STp- and STh-positive ETEC isolates, was suc-cessfully observed. This indicated that our developed system wasclearly applicable on clinical isolates from stool samples and fortheir specific categorization.

In overall, the combination of the selected primers used in theherein described two-step multiplex PCR, including the primers forindividual detection of STp, STh, and Bfp, as well as the rapidnessand easiness of the described system makes it useful in high numberof laboratories specially in developing countries for identificationof the main categories of DEC and also for the identification of thespecific subtypes of both EPEC and ETEC isolates from stool samples.

Acknowledgments

The authors thank very much Prof. Dani Cohen and Mrs. AnyaBialik for providing the clinical E. coli isolates, and also thankvery much Prof. Ann-Mari Svennerholm for constructive inputsthroughout the study and for financing the study using a grant fromthe Swedish Research Council.

References

Aranda KR, Fabbricotti SH, Fagundes-Neto U, Scaletsky IC. Single multiplex assay toidentify simultaneously enteropathogenic, enteroaggregative, enterotoxigenic,enteroinvasive and Shiga toxin-producing Escherichia coli strains in Brazilianchildren. FEMS Microbiol Lett 2007;267:145–50.

Brandal LT, Lindstedt BA, Aas L, Stavnes TL, Lassen J, Kapperud G. OctaplexPCR and fluorescence-based capillary electrophoresis for identification ofhuman diarrheagenic Escherichia coli and Shigella spp. J Microbiol Methods

2007;68:331–41.

Bueris V, Sircili MP, Taddei CR, Fernandes dos Santos M, Franzolin MR, Martinez MB,et al. Detection of diarrheagenic Escherichia coli from children with and with-out diarrhea in Salvador, Bahia, Brazil. Mem Inst Oswaldo Cruz (Rio de Janeiro)2007;102:839–44.

5 iologic

C

F

H

H

H

J

KK

K

NN

N

enteric infections associated with diarrheagenic Escherichia coli. J Clin Microbiol

70 J. Tobias, S.-R. Vutukuru / Microb

ennimo DJ, Koo H, Mohamed JA, Huang DB, Chiang T. EnteroaggregativeEscherichia coli: a review of trends, diagnosis, and treatment. Infect Med2007(March):100–10.

ujioka M, Kasai K, Miura T, Sato T, Otomo Y. Rapid diagnostic method for thedetection of diarrheagenic Escherichia coli by multiplex PCR. Jpn J Infect Dis2009;62:476–80.

ardegen C, Messler S, Henrich B, Pfeffer K, Würthner J, MacKenzie CR. A set of novelmultiplex Taqman real-time PCRs for the detection of diarrhoeagenic Escherichiacoli and its use in determining the prevalence of EPEC and EAEC in a universityhospital. Ann Clin Microbiol Antimicrob 2010;9:5.

ien BTT, Scheutz F, Cam PD, Serichantalergs O, Huong TT, Thu TM, et al. Diar-rheagenic Escherichia coli and shigella strains isolated from children in a hospitalcase–control study in Hanoi, Vietnam. J Clin Microbiol 2008;46:996–1004.

uang DB, Mohanty A, DuPont HL, Okhuysen PC, Chiang T. A review of anemerging enteric pathogen: enteroaggregative Escherichia coli. J Med Micro-biol 2006;55(October (Pt 10)):1303–11, Review. Erratum in: J Med Microbiol2007;56(Pt 1):142.

erse AE, Martin WC, Galen JE, Kaper JB. Oligonucleotide probe for detection of theenteropathogenic Escherichia coli (EPEC) adherence factor of localized adherentEPEC. J Clin Microbiol 1990;28:2842–4.

aper JB. Defining EPEC. Rev Microbiol (Sao Paulo) 1996;27:130–3.hairun N, Dilruba A, Johirul I, Lutful Kabir FM, Hossain MA. Usefulness of a multiplex

PCR for detection of diarrheagenic Escherichia coli in a diagnostic microbiologylaboratory setting. Bangladesh J Med Microbiol 2007;01:38–42.

imata K, Shima T, Shimizu M, Tanaka D, Isobe J, Gyobu Y, et al. Rapid catego-rization of pathogenic Escherichia coli by multiplex PCR. Microbiol Immunol2005;49:485–92.

ataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol 1998;11:142–201.essa K, Ahmed D, Islam J, Kabir FL, Hossain MA. Usefulness of a multiplex PCR for

detection of diarrheagenic Escherichia coli in a diagnostic microbiology labora-tory setting. Bangladesh J Med Microbiol 2007;1:38–42.

guyen TV, Le Van P, Le Huy C, Gia KN, Weintraub A. Detection and characterizationof diarrheagenic Escherichia coli from young children in Hanoi. Vietnam J ClinMicrobiol 2005;43:755–60.

al Research 167 (2012) 564– 570

Okeke IN. Diarrheagenic Escherichia coli in sub-Saharan Africa: status, uncertaintiesand necessities. J Infect Dev Ctries 2009;3:817–42.

Parashar U, Umesh D, Bresee JS, Joseph S, Glass RI, Roger I. The global burden ofdiarrhoeal disease in children. Bull WHO 2003;81:236.

Porat N, Levy A, Fraser D, Deckelbaum RJ, Dagan R. Prevalence of intestinal infectionscaused by diarrheagenic Escherichia coli in Bedouin infants and young childrenin Southern Israel. Pediatr Infect Dis J 1998;17:482–8.

Qadri E, Svennerholm AM, Faruque As, Sack RB. Enterotoxigenic Escherichia coli indeveloping countries: epidemiology, microbiology, clinical features, treatment,and prevention. Clin Microbiol Rev 2005;18:465–83.

Rajendrana P, Rao Ajjampura SS, Chidambarama D, Chandrabosea G, ThangarajbB, Sarkarb R, et al. Pathotypes of diarrheagenic Escherichia coli in childrenattending a tertiary care hospital in South India. Diagn Microbiol Infect Dis2010;68:117–22.

Reyes D, Vilchez S, Paniagua M, Colque-Navarro P, Weintraub A, Möllby R,et al. Diarrheagenic Escherichia coli markers and phenotypes among fecalE. coli isolates collected from Nicaraguan infants. J Clin Microbiol 2010;48:3395–6.

Rodas C, Iniguez V, Qadri F, Wiklund G, Svennerholm A-M, Sjöling Å.Development of multiplex PCR assays for detection of enterotoxigenicEscherichia coli colonization factors and toxins. J Clin Microbiol 2009;47:1218–20.

Toma C, Lu Y, Higa N, Nakasone N, Chinen I, Baschkier A, et al. Multiplex PCRassay for identification of human diarrheagenic Escherichia coli. J Clin Microbiol2003;42:2669–71.

Trabulsi LR, Keller R, Tardelli Gomes TA. Typical and atypical enteropathogenicEscherichia coli. Emerg Infect Dis 2002;8:508–13.

Vidal P, Vidal M, Lagos R, Levine M, Prado V. Multiplex PCR for diagnosis of

2004;42:1787–9.Vilchez S, Reyes D, Paniagua M, Bucardo F, Möllby R, Weintraub A. Prevalence of

diarrhoeagenic Escherichia coli in children from Leon, Nicaragua. J Med Microbiol2009;58:630–7.