shred is a regulatory cascade that reprograms ubr1 ... · dale muzzey, georg h.h. borner, sebastian...

Article

SHRED Is a Regulatory Ca
scade that ReprogramsUbr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress
Graphical Abstract

non-stress conditionsSHRED inactive

stress conditionsSHRED active

Ubr1Ubr1

Roq1∆21

N-end rulesubstrate

Roq1uncleaved

Roq1∆21binding

degradation

misfoldedprotein

UbUb

cleavage

Ynm3

degradation

Highlights

d Stress induces the synthesis of Roq1, which undergoes

cleavage by the protease Ynm3

d Cleaved Roq1 modulates substrate specificity of the N-end

rule ubiquitin ligase Ubr1

d Roq1-bound Ubr1 promotes selective proteasomal

degradation of misfolded proteins

d This pathway, termed SHRED, adapts protein quality control

to changing cellular needs

Szoradi et al., 2018, Molecular Cell 70, 1–13June 21, 2018 ª 2018 Elsevier Inc.https://doi.org/10.1016/j.molcel.2018.04.027

Authors

Tamas Szoradi, Katharina Schaeff,

Enrique M. Garcia-Rivera, ...,

Dale Muzzey, Georg H.H. Borner,

Sebastian Schuck

[email protected]

In Brief

Szoradi et al. uncover SHRED, a stress

response pathway that hinges on the

previously uncharacterized regulatory

protein Roq1. Proteolytically cleaved

Roq1 binds to the N-end rule ubiquitin

ligase Ubr1 as a pseudosubstrate and

directs Ubr1 toward misfolded proteins,

thereby promoting the degradation of

aberrant proteins.

mailto:[email protected].�de

https://doi.org/10.1016/j.molcel.2018.04.027

Please cite this article in press as: Szoradi et al., SHRED Is a Regulatory Cascade that Reprograms Ubr1 Substrate Specificity for Enhanced ProteinQuality Control during Stress, Molecular Cell (2018), https://doi.org/10.1016/j.molcel.2018.04.027

Molecular Cell

Article

SHRED Is a Regulatory Cascade that ReprogramsUbr1 Substrate Specificity for EnhancedProtein Quality Control during StressTamas Szoradi,1 Katharina Schaeff,1 Enrique M. Garcia-Rivera,2,5 Daniel N. Itzhak,3 Rolf M. Schmidt,1 Peter W. Bircham,1

Kevin Leiss,1 Juan Diaz-Miyar,1 Vivian K. Chen,2,6 Dale Muzzey,4,7 Georg H.H. Borner,3 and Sebastian Schuck1,8,*1Center for Molecular Biology of Heidelberg University (ZMBH), DKFZ-ZMBH Alliance and CellNetworks Cluster of Excellence,

69120 Heidelberg, Germany2Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, CA 94143, USA3Department of Proteomics and Signal Transduction, Max Planck Institute of Biochemistry, 82152 Martinsried, Germany4Department of Cellular and Molecular Pharmacology, University of California, San Francisco, San Francisco, CA 94158, USA5Present address: nference, Inc., Cambridge, MA 02141, USA6Present address: Department of Biology, Stanford University, Stanford, CA 94305, USA7Present address: Counsyl, Inc., South San Francisco, CA 94080, USA8Lead Contact

*Correspondence: [email protected]://doi.org/10.1016/j.molcel.2018.04.027

SUMMARY

When faced with proteotoxic stress, cells mountadaptive responses to eliminate aberrant proteins.Adaptive responses increase the expression of pro-tein folding and degradation factors to enhance thecellular quality control machinery. However, it is un-clear whether and how this augmented machineryacquires new activities during stress. Here, we un-cover a regulatory cascade in budding yeast thatconsists of the hydrophilin protein Roq1/Yjl144w,the HtrA-type protease Ynm3/Nma111, and the ubi-quitin ligase Ubr1. Various stresses stimulate ROQ1transcription. The Roq1 protein is cleaved by Ynm3.Cleaved Roq1 interacts with Ubr1, transforming itssubstrate specificity. Altered substrate recognitionby Ubr1 accelerates proteasomal degradation ofmisfolded as well as native proteins at the endo-plasmic reticulum membrane and in the cytosol. Weterm this pathway stress-induced homeostaticallyregulated protein degradation (SHRED) and proposethat it promotes physiological adaptation by repro-gramming a key component of the quality controlmachinery.

INTRODUCTION

Cells are frequently challenged by changing physiological condi-

tions. An important consequence of such stress is impaired pro-

tein folding. The resulting accumulation of misfolded proteins

poses a serious threat to cell function and is associated

with various disorders, including major age-related neurodegen-

erative diseases (Balchin et al., 2016; Labbadia and Mori-

moto, 2015).

The cellular quality control machinery recognizes misfolded

proteins, typically on the basis of surface-exposed hydrophobic

residues, and refolds, sequesters, or degrades them (Buch-

berger et al., 2010). Molecular chaperones are essential for pro-

tein folding, refolding, and sequestration (Balchin et al., 2016).

Ubiquitin ligases are central players in protein degradation

and attach ubiquitin to misfolded proteins as a mark for

destruction. Different subcellular compartments are equipped

with distinct sets of ubiquitin ligases. In yeast, for instance,

the membrane of the endoplasmic reticulum (ER) contains

Hrd1 and Doa10, which function in ER-associated protein

degradation (ERAD; Ruggiano et al., 2014). The nucleus con-

tains several quality control ubiquitin ligases, including San1

(Gardner et al., 2005), and the cytosol contains Ubr1, Ubr2,

Hul5, and Rsp5 (Eisele and Wolf, 2008; Fang et al., 2011,

2014; Heck et al., 2010; Nillegoda et al., 2010). However, there

is functional overlap between certain ubiquitin ligases. For

example, Doa10 also contributes to nuclear and cytosolic qual-

ity control, San1 helps to eliminate misfolded cytosolic pro-

teins, and Ubr1 participates in ERAD (Heck et al., 2010; Prasad

et al., 2010; Ravid et al., 2006; Stolz et al., 2013; Swanson

et al., 2001).

Stress-induced protein misfolding elicits adaptive cellular

responses that promote folding and degradation of aberrant

proteins. Accumulation of misfolded proteins in the ER lumen

triggers the unfolded protein response (UPR). The UPR induces

numerous genes whose products enhance ER protein folding

and ERAD (Travers et al., 2000; Walter and Ron, 2011). Mis-

folded proteins in the cytosol activate the heat shock response

(HSR), which increases chaperone levels and stimulates cyto-

solic protein degradation (Labbadia and Morimoto, 2015;

Verghese et al., 2012). ER membrane proteins with misfolded

cytosolic domains induce transcriptional programs that are

distinct from the classical UPR and HSR, suggesting that this

Molecular Cell 70, 1–13, June 21, 2018 ª 2018 Elsevier Inc. 1

mailto:[email protected]


A

GFPN Pho8*

Rtn1Pho8*-GFP

N CPY* GFP

Rtn1CPY*-GFP

N GFP

ER lumen

cytosolRtn1-GFP

repo

rter l

evel

s (%

)

C

Rtn1-GFPRtn1Pho8*-GFP

5tunicamycin treatment (h)

0 1 2 3 40

20

40

60

80

100

E

Rtn1-GFP

Rtn1Pho8*-GFPRtn1Pho8*-GFP + Tm

Rtn1-GFP + Tm

repo

rter r

emai

ning

(%)

0 1 2 3 4 5time after promoter shut-off (h)

0

20

40

60

80

100

120

GFP

Pgk1

DRtn1-GFP Rtn1Pho8*-GFP

Tm (h) 0 1 2 3 4 5

Hmg2-GFP

Rtn1CPY*-GFPRtn1Pho8*-GFP

Rtn1-GFP

0

20

40

60

80

100

repo

rter r

emai

ning

(%)

0 1 2 3 4cycloheximide treatment (h)

B

F

0 1 2 3 4 5

repo

rter r

emai

ning

(%)

0 1 2 3 4 5time after promoter shut-off (h)

0

20

40

60

80

100

120

Rtn1Pho8*-GFP + TmRtn1Pho8*-GFP + Tm + MG132

Figure 1. Stress Induces Proteasomal

Degradation of ER Proteins with Misfolded

Cytosolic Domains

(A) Schematic of reporter proteins.

(B) Flow cytometry of total cellular GFP fluores-

cence after cycloheximide treatment. Error bars

represent mean ± SEM; n = 5.

(C) Flow cytometry of cellular reporter levels after

tunicamycin (Tm) treatment. Error bars represent

mean ± SEM; n = 4.

(D)WesternblotofGFPandPgk1after Tm treatment.

(E) Flow cytometry of total cellular GFP fluores-

cence after promoter shutoff in cells expressing

Rtn1-GFP or Rtn1Pho8*-GFP from the GAL pro-

moter. Error bars represent mean ± SEM; n = 4.

(F) As in (E) with cells expressing GAL promoter-

driven Rtn1Pho8*-GFP and treated with Tm or with

Tm + MG132. Error bars represent mean ± SEM;

n = 4.

See also Figures S1–S3.


class of quality control substrates is sensed and handled in

unique ways (Buck et al., 2015). Finally, a variety of unfavorable

conditions activate the environmental stress response (ESR),

which expands chaperone capacity and globally downregu-

lates protein synthesis (Gasch et al., 2000). The UPR, HSR,

and ESR remodel the quality control machinery by adjusting

the abundance of its constituent parts. However, quality control

factors such as chaperones and ubiquitin ligases are also

regulated post-translationally (Cloutier and Coulombe, 2013;

Zheng and Shabek, 2017). Adaptive responses may, therefore,

not only expand the quality control machinery but also alter

how certain parts of this machinery function.

Here, we investigate protein quality control at the interface

of the ER and the cytosol in budding yeast, Saccharomyces

cerevisiae. We uncover stress-induced homeostatically regu-

lated protein degradation (SHRED), a stress-inducible pathway

for the degradation of misfolded ER membrane and cytosolic

proteins. We show that SHRED involves reprogramming of

the ubiquitin ligase Ubr1 by a proteolytically processed

regulator.

2 Molecular Cell 70, 1–13, June 21, 2018

RESULTS

Stress Induces Degradation of ERProteins with Misfolded CytosolicDomainsTo analyze protein quality control at the ER

membrane,wegenerated the reporter pro-

teins Rtn1-GFP, Rtn1CPY*-GFP, and

Rtn1Pho8*-GFP (Figure 1A). We used the

reticulon protein Rtn1 as a scaffold,

because it is anchored in the ER mem-

brane by hydrophobic hairpin structures

(Voeltz et al., 2006) and is, therefore, un-

coupled from quality control mechanisms

monitoring the ER lumen. To introduce

misfolded domains, we fused folding-

defective CPY* (Stolz and Wolf, 2012) or

Pho8* (FigureS1) to the cytosolicC terminusofRtn1. The resulting

reporter proteins were membrane associated and localized to the

peripheral ER (Figure S2). To assay their turnover, we performed

cycloheximide chase experiments with the Rtn1-based reporters

and the well-studied ERAD substrate Hmg2-GFP (Hampton et al.,

1996). Hmg2-GFP was degraded rapidly, whereas Rtn1-GFP

showed no turnover. Rtn1CPY*-GFP was degraded, albeit less

quickly than Hmg2-GFP. In contrast, Rtn1Pho8*-GFP was as

long lived as Rtn1-GFP (Figures 1B and S3A).

The misfolded yet stable Rtn1Pho8*-GFP provided an ideal

model substrate to investigate whether stress affects the degra-

dation of misfolded ER membrane proteins. We first examined

constitutively expressed Rtn1-GFP and Rtn1Pho8*-GFP in cells

treated with tunicamycin, which causes protein misfolding by

preventing N-linked glycosylation. Rtn1-GFP levels decreased

slightly, whereas Rtn1Pho8*-GFP levels dropped to less than

20% (Figures 1C and 1D). Rtn1CPY*-GFP levels showed a

similar decline (Figure S3B). To determine whether this behavior

reflected enhanced degradation, we followed pre-existing re-

porter molecules in promoter shut-off experiments. Rtn1-GFP

WT∆ubr1∆ynm3∆roq1

Tm (h)

WT

∆ubr1

∆ynm3

∆roq1

A

0 1 2 3 4 5

Rtn1Pho8*-GFP

0 1 2 3 4 5tunicamycin treatment (h)

0

20

40

60

80

100

repo

rter l

evel

s (%

)

B Rtn1Pho8*-GFP

C

FE

D

repo

rter r

emai

ning

(%)


tunicamycin treatment (h)

0

20

40

60

80

100

Rtn1Pho8*-GFP, promoter shut-off

0 1 2 3 4 5

WT∆ubr1

∆ubr2∆rad6

∆san1∆ubr1 ∆san1

tunicamycin treatment (h)

0

20

40

60

80

100

repo

rter l

evel

s (%

)

Rtn1Pho8*-GFP

0 1 2 3 4 5

repo

rter r

emai

ning

(%)

WTcdc48-3

Rtn1Pho8*-GFP, promoter shut-off

tunicamycin treatment (h)0 1 2 3 4 5

0

20

40

60

80

100

120

0

20

40

60

80

∆ubr1 ∆ynm3WT ∆roq1 ∆ubr1∆ynm3

∆ubr1∆roq1

∆ynm3∆roq1

Rtn1Pho8*-GFP, promoter shut-off100

repo

rter r

emai

ning

(%)

120

Figure 2. Stress-Induced Proteasomal

Degradation of Rtn1Pho8*-GFP Requires

Ubr1, Ynm3, Roq1, Rad6, and Cdc48

(A) Western blot of GFP after tunicamycin (Tm)

treatment. Equal amounts of total protein were

analyzed for each time point. WT, wild-type.

(B) Flow cytometry of cellular Rtn1Pho8*-GFP

levels after Tm treatment. Error bars represent

mean ± SEM; n = 5.

(C) Flow cytometry of total cellular GFP fluores-

cence after promoter shut-off and Tm treatment

in cells expressing Rtn1Pho8*-GFP from the GAL

promoter. Error bars represent mean ± SEM; n = 5.

(D) As in (B). Error bars represent mean ± SEM;

n = 3.

(E) As in (C). Error bars represent mean ± SEM;

n = 3.

(F) As in (C), except that percent of reporter re-

maining after 5-hr Tm treatment is depicted. Error

bars represent mean ± SEM; n = 4.

See also Figures S3 and S4.


and Rtn1Pho8*-GFP were placed under the control of the regu-

latable GAL promoter, expression was induced with galactose

and then repressed with glucose, and reporter levels were moni-

tored in the absence or presence of tunicamycin. Reporter mole-

cules produced during galactose induction were associated

with the ER membrane (Figures S3C and S3D). Without tunica-

mycin, Rtn1-GFP and Rtn1Pho8*-GFP levels remained essen-

tially unchanged, consistent with their slow turnover at steady

state. With tunicamycin, Rtn1-GFP levels remained constant,

but Rtn1Pho8*-GFP levels decreased substantially, showing

that the reporter was degraded (Figure 1E). Tunicamycin-

induced degradation of Rtn1Pho8*-GFPwas blocked by the pro-

teasome inhibitor MG132 (Figure 1F). Hence, ER stress induces

selective proteasomal degradation of ER membrane proteins

with misfolded cytosolic domains.

Stress-InducedMisfoldedProteinDegradationRequiresUbr1, Ynm3, and Roq1To uncover the machinery for stress-induced degradation of

Rtn1Pho8*-GFP, we conducted a genetic screen. Cells express-

ing the reporter were mutagenized and

screened by fluorescence microscopy

and flow cytometry for mutants that

had normal steady-state levels of

Rtn1Pho8*-GFP but failed to degrade it

during stress. Complementation analysis

and whole-genome sequencing revealed

defects in five genes: PRE2, UMP1,

UBR1, YNM3/NMA111, and YJL144W.

The first two encode a proteasome sub-

unit and a proteasome maturation factor,

respectively, consistent with proteasomal

degradation of Rtn1Pho8*-GFP. The

identification of UBR1 is in line with the

roles of this ubiquitin ligase in protein

quality control. YNM3 encodes the only

yeast protease of the HtrA family

(Clausen et al., 2011). YJL144W is a poorly characterized gene

encoding a hydrophilin protein (Dang and Hincha, 2011). We

name this gene ROQ1, for regulator of quality control.

Deletion of UBR1, YNM3, or ROQ1 did not alter steady-state

levels of Rtn1Pho8*-GFP. However, the tunicamycin-induced

decline of Rtn1Pho8*-GFP levels was slowed (Figures 2A

and 2B). The same was true when DTT was used as an alterna-

tive ER stressor (Figure S4A). Promoter shut-off experiments

showed that the deletions inhibited degradation of pre-existing

Rtn1Pho8*-GFP (Figure 2C). Since reporter molecules synthe-

sized prior to promoter shut-off were associated with the ER

(Figures S3C and S3D), Ubr1, Ynm3, and Roq1 must act on

ER-localized Rtn1Pho8*-GFP.

To complement the screen, we examined known quality control

components for roles in the degradation of Rtn1Pho8*-GFP. Ubr2

was dispensable, as were Hrd1 and Doa10 (Figures 2D and S4B).

San1 deletion caused a minor inhibition but had no effect in the

absence of Ubr1. The ubiquitin-conjugating enzyme Rad6, which

interactswithUbr1 (Dohmenetal., 1991),was required (Figure2D).

The essential AAA ATPase Cdc48, which extracts proteins from

Molecular Cell 70, 1–13, June 21, 2018 3

PKA-as Rtn1Pho8*-GFP, promoter shut-off B

0 1 2 3 4 51NM-PP1 treatment (h)

0

20

40

60

80

100

repo

rter r

emai

ning

(%)


0

20

30

70

80

90

10

60

C

RO

Q1

mR

NA

leve

ls

wild-type

0 1 3tunicamycintreatment (h)

1NM-PP1treatment (h)

PKA-as

estradioltreatment (h)

GEMGAL-ROQ1

0 1 3 0 1 3

A

D

analog-sensitive proteinkinase A (PKA-as)

Msn2/4

stress-responsive genes

ATP analog(1NM-PP1)

inactive GEMtranscription factor

estradiol

GAL-ROQ1 gene

active GEMtranscription factor

GEM GAL-ROQ1 Rtn1Pho8*-GFPE

0

20

40

60

80

100

0 2 4 6estradiol treatment (h)

repo

rter l

evel

s (%

)

1 3 5

WT∆ubr1∆ynm3

F GEM GAL-ROQ1

estradiol treatment (h)0 2 4 6

0

20

40

60

80

100

repo

rter l

evel

s (%

)

Gal4DBD

M2TAD

Gal4DBD

M2TAD

Rtn1-GFPRtn1Pho8*-GFP

ATP

Hsf1

120

Figure 3. Regulation of SHRED by the Envi-

ronmental Stress Response and Roq1

(A) Schematic illustrating activation of the ESRwith

the ATP analog 1NM-PP1.

(B) Flow cytometry of total cellular GFP fluores-

cence after promoter shut-off and 1NM-PP1

treatment. Error bars represent mean ± SEM; n = 4.

(C) ROQ1 mRNA levels after tunicamycin, 1NM-

PP1, or estradiol treatment. Error bars represent

mean ± SEM; n = 3.

(D) Schematic illustrating induction of GAL pro-

moter-driven ROQ1 transcription by activation of

the GEM transcription factor with estradiol. GEM

contains the Gal4 DNA-binding domain (Gal4

DBD), an estrogen-binding domain, and the Msn2

transactivation domain (M2 TAD).

(E) Flow cytometry of cellular Rtn1Pho8*-GFP

levels after estradiol treatment. Error bars repre-

sent mean ± SEM; n = 3.

(F) Flow cytometry of cellular Rtn1-GFP and

Rtn1Pho8*-GFP levels after estradiol treatment.

Error bars represent mean ± SEM; n = 4.

See also Figure S4.


the ER (Ruggiano et al., 2014), was tested with the temperature-

sensitive cdc48-3 allele. Promoter shut-off experiments at 30�C,a semi-permissive temperature at which cdc48-3 cells still grow,

showed that degradation of Rtn1Pho8*-GFP involves Cdc48

(Figure 2E).

Finally, we asked whether Ubr1, Ynm3, and Roq1 act in parallel

or in a single pathway. Individual and pairwise gene deletions in-

hibited degradation of Rtn1Pho8*-GFP to similar extents, indi-

cating a single pathway (Figure 2F). Thus, Ubr1, Ynm3, and Roq1

are part of a linear pathway responsible for stress-induced degra-

dation of Rtn1Pho8*-GFP. We refer to this pathway as SHRED.

Regulation of SHRED by the Environmental StressResponse and Roq1Next, we investigated how stress regulates SHRED. Degradation

of Rtn1Pho8*-GFP upon tunicamycin treatment did not require


Ire1 or Hac1, ruling out the UPR as the

relevant signaling pathway (Figure S4C).

Prolonged ER stress affects protein ki-

nase A (PKA) signaling, which controls

the ESR (Gasch et al., 2000; Pincus

et al., 2014). Therefore, we testedwhether

PKA can regulate degradation of

Rtn1Pho8*-GFP. PKA normally represses

the transcription factors Msn2/4 and

Hsf1. Stress inactivates PKA, allowing

Msn2/4 and Hsf1 to induce stress-

responsive genes (Verghese et al.,

2012). To manipulate PKA, we used cells

in which the three PKA isoforms

Tpk1/2/3 had been modified so that they

can be specifically inhibited with the bulky

non-hydrolyzable ATP analog 1NM-PP1

(Figure 3A; Hao and O’Shea, 2011). PKA

inhibition on its own was sufficient to

trigger degradation of Rtn1Pho8*-GFP, which required Ubr1,

Ynm3, and Roq1 (Figure 3B). Thus, SHRED can be induced by

activation of the ESR. Accordingly, degradation of Rtn1Pho8*-

GFP by SHRED was also induced by growth to post-diauxic

phase, a natural starvation condition that activates the ESR

(Figure S4D).

How does the ESR stimulate SHRED? The mRNA levels of

UBR1 and YNM3 do not rise during ER stress (Travers et al.,

2000). The same was true for their protein levels (data not

shown). In contrast, many stresses induce ROQ1 transcription

(Gasch et al., 2000; Travers et al., 2000). Indeed, tunicamycin

increased ROQ1 mRNA levels 10-fold within 3 hr as measured

by real-time qPCR (Figure 3C). Activation of the ESR by inhibition

of PKA caused even stronger induction. Therefore, we asked

whether ROQ1 transcription was a molecular switch for acti-

vating SHRED. If so, enforced ROQ1 expression should trigger

Roq1

Ub-Roq

1

∆ynm3 ∆roq1 Rtn1Pho8*-GFP

10R

21R

11T

12H

13K

14K

15S

16N

17S

18S

22S

19I

20L

23Q

24R

25D

Ub-Roq1∆X

7T

8I

9Y

0

20

40

60

80

repo

rter l

evel

s (%

)

E

D

HA

WT∆18 ∆19 ∆20 ∆21 ∆22 ∆23WT WT WT WT WT

Roq1-HA(74)

15 kDa

0

20

40

60

80

repo

rter l

evel

s (%

)

F ∆ynm3 ∆roq1Rtn1Pho8*-GFP

Ub-Roq

1R22

AR22

LR22

K

Ub-Roq1∆21

*

0

20

40

60

80

repo

rter l

evel

s (%

)

G∆roq1 Rtn1Pho8*-GFP

L21P

L21V

R22A

R22L

Roq1

R22K

15 kDa

Ub-Roq

1∆21

no R

oq1

WT R

oq1

H

HA

WT L21P

Roq1-HA(74)

L21V

55 kDaPgk1

10 kDa

A Rtn1Pho8*-GFP

repo

rter l

evel

s (%

)


0

20

40

60

80

100

∆ynm3∆ynm3 + pYNM3∆ynm3 + pYNM3(S236A)

WT ∆ynm3

Roq1-HA

55 kDa

B

Pgk1

15 kDa

10 kDa

HA

MG132

C

WT ∆ynm3

Pgk1

HA

Roq1-HA(74)

15 kDa

10 kDa

55 kDa

- +- +

Figure 4. Ynm3 Cleaves Roq1 to Activate It

(A) Flow cytometry of cellular Rtn1Pho8*-GFP

levels after tunicamycin (Tm) treatment. Error bars


(B) Western blot of HA and Pgk1 from cells ex-

pressing Roq1-HA. MG132 treatment for 4 hr

where indicated. The double arrow indicates

Ynm3-dependent Roq1 cleavage fragments.

(C) As in (B), from cells expressing Roq1-HA(74).

(D) Western blot of HA fromDroq1 cells expressing

Ub-Roq1-HA(74) orDynm3Droq1 cells expressing

Ub-Roq1DX-HA(74) variants. The double arrow

indicates native Roq1 cleavage fragments.

(E) Flow cytometry of cellular Rtn1Pho8*-GFP

levels after Tm treatment for 5 hr. Letters below the

graph indicate the identity of the N-terminal resi-

dues. The orange box marks the variants

also shown in (D). Error bars represent mean ±

SEM; n = 3.

(F) Flow cytometry of cellular Rtn1Pho8*-GFP

levels in cells expressing Ub-Roq1D21 variants

after Tm treatment for 5 hr. Error bars represent

mean ± SEM; n = 3.

(G) As in (F), in cells expressing full-length Roq1

variants.

(H) Western blot of HA and Pgk1. The double arrow

denotes the native Roq1 cleavage fragments, and

the asterisk denotes an alternative cleavage

product.

See also Figure S5.


misfolded protein degradation. To test this notion, we placed

ROQ1 under the control of the GAL promoter in cells harboring

the artificial transcription factor GEM. This enables activation

of the GAL promoter with the heterologous steroid b-estradiol

(Figure 3D; Pincus et al., 2014). As expected, estradiol strongly

induced ROQ1 transcription (Figure 3C). Strikingly, ROQ1

induction in otherwise untreated cells caused degradation of

Rtn1Pho8*-GFP, which was completely dependent on Ubr1

and Ynm3 (Figure 3E). Enforced ROQ1 transcription did not

affect cell growth, arguing against the possibility that it triggered

protein degradation indirectly by causing stress (Figure S4E).

Furthermore, Rtn1-GFP was unaffected, showing that Roq1-

induced protein degradation was selective (Figure 3F). These

results show that induction of ROQ1 tran-

scription is a critical step in SHRED.

Ynm3 Cleaves Roq1 to Activate ItWe next focused on Ynm3. Catalytically

inactive Ynm3(S236A) (Padmanabhan

et al., 2009) did not support stress-

induced degradation of Rtn1Pho8*-GFP,

despite normal expression levels (Figures

4A and S5A). Hence, Ynm3 protease ac-

tivity is required for reporter degradation.

Functional Ynm3-GFP localizes to the nu-

cleus (Padmanabhan et al., 2009) (Figures

S5B and S5C) and does not undergo

nucleocytoplasmic shuttling, even during

stress (Belanger et al., 2009). This

localization was incongruent with Ynm3 directly cleaving

Rtn1Pho8*-GFP, which mainly localizes to the peripheral ER.

Instead, the localization of Ynm3 raised the possibility that its

relevant substrate has access to the nucleus.

Roq1 consists of only 104 amino acids, likely allowing it to

freely enter the nucleus. Therefore, we tested whether Roq1

was a substrate of Ynm3. We generated C-terminally tagged

Roq1-hemagglutinin (HA), which restored Rtn1Pho8*-GFP

degradation in Droq1 cells when expressed from the endoge-

nous ROQ1 promoter (Figure S5D). Detection of Roq1-HA by

western blotting required expression from the strong GPD pro-

moter, in line with the very low abundance of the Roq1 protein

(Ghaemmaghami et al., 2003). In wild-type cells, Roq1-HA


∆ubr1∆ubr1 + pUBR1

∆ubr1 + pUBR1(G173R)∆ubr1 + pUBR1(D318N)

repo

rter l

evel

s (%

)

B


0

20

40

60

80

100

Rtn1Pho8*-GFPARecognition of type-1and type-2 N-terminalresidues by Ubr1

type-1site

type-2site

additionalsite(s)

LFWYI

R-DR-E

RKH

DE

NQ

D

fold

cha

nge

mC

herr

y/sf

GFP

(log

2)

-2

-1.5

-1

-0.5

0

1.5

1

1.5

2

GEM GAL-ROQ1 Ubiquitin-X-mCherry-sfGFP

stabilized by Roq1overexpression

destabilized by Roq1overexpression

K GR H N D Q E T M CA S V FP W L I Y

E

time (min)

Pgk1

full-length

cleaved

0 5 13 20

cycloheximide

Roq1-HA(74)

C

Roq1∆21-HA(74)

Roq1∆21(R22A)-HA(74)

FLAG-ubr1(G173R)

FLAG-Ubr1

Westernanti-FLAG

Westernanti-HA

lysate (6% of IP input) IP anti-HA

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

Ubr1

Roq1∆21

Figure 5. Cleaved Roq1 Regulates Ubr1 through the Ubr1 Type-1 Site and Is Rapidly Degraded

(A) Schematic illustrating recognition of N-end rule substrates by Ubr1.

(B) Flow cytometry of cellular Rtn1Pho8*-GFP levels after tunicamycin treatment. Error bars represent mean ± SEM; n = 3.

(C) Western blot of FLAG and HA from total cell lysates and anti-HA immunoprecipitates from Dubr1 Droq1 cells expressing FLAG-Ubr1 and Roq1D21-HA(74)

variants where indicated. IP, immunoprecipitation.

(D) Flow cytometry of mCherry/sfGFP fluorescence in untreated and estradiol-treated cells expressing a ubiquitin-X-mCherry-sfGFP N-end rule substrate and

Roq1 under the estradiol-inducible promoter system. Plotted on a log2 scale is the fold change of mCherry/sfGFP fluorescence upon estradiol treatment for 6 hr.

(legend continued on next page)




showed an apparent molecular weight of 15 kDa (Figure 4B) and

was occasionally detected as a double band (data not shown).

Proteasome inhibition raised the levels of full-length Roq1-HA

and revealed additional bands, including a second double

band at 13 kDa that was absent in Dynm3 cells. The simplest

interpretation of this finding is that Ynm3 cleaves Roq1. The

fact that Roq1-HA fragments lacking approximately 2 kDa could

be detected with an antibody against the C-terminal HA tag indi-

cates cleavage near the N terminus. Cleavage of Roq1-HA

appeared to be inefficient, possibly because the HA tag compro-

mised substrate recognition by Ynm3. Therefore, we inserted an

HA tag after residue 74. The resulting internally tagged Roq1,

called Roq1-HA(74), was functional (Figure S5D). Western blot-

ting showed two double bands at 15 and 13 kDa, even without

proteasome inhibition. The bands at 13 kDa were abolished in

Dynm3 cells (Figure 4C). Thus, Ynm3 likely also directly cleaves

Roq1-HA(74). The reason for the appearance of full-length and

cleaved Roq1 as double bands remains to be established.

To determine the size of cleaved Roq1, we used Roq1 trunca-

tions as molecular rulers. We generated N-terminal ubiquitin fu-

sions of Roq1-HA(74) lacking the first 18 to 23 residues, called

Ub-Roq1D18-HA(74) to Ub-Roq1D23-HA(74). The ubiquitin moi-

ety is removed after translation, yielding truncated Roq1 (Bach-

mair et al., 1986). The small sizes of these variants allowed their

separation by tricine-SDS-PAGE. All truncations appeared as

double bands, similar to cleaved Roq1 (Figure 4D). Cleaved

Roq1 derived from full-length Roq1-HA(74) had the same

apparent molecular weight as artificially created Roq1D21-

HA(74), suggesting Roq1D21 as the most likely native cleavage

fragment. We hypothesized that Ynm3 cleaves Roq1 to activate

it and that the active form is N-terminally truncated Roq1. If so,

expression of a Roq1 cleavagemimic should obviate the require-

ment for Ynm3. Indeed, Roq1D21 fully restored degradation of

Rtn1Pho8*-GFP in Dynm3 Droq1 cells. In contrast, Roq1D20

and Roq1D22, the next best candidate cleavage fragments

based on electrophoretic mobility, could not bypass Ynm3 (Fig-

ure 4E, orange box). These results identify Roq1D21 as the

native, physiologically active cleavage fragment and show that

the sole essential function of Ynm3 in SHRED is to cleave

Roq1 after leucine-21.

Intriguingly, Roq1D23 also bypassed Ynm3, even though its

electrophoretic mobility indicated that it was smaller than the

native Roq1 cleavage fragment (Figure 4D and orange box in Fig-

ure 4E). Therefore, we tested additional truncations, ranging

from Roq1D7 to D25. Revealingly, all Roq1 variants with an

N-terminal arginine, lysine, aspartate, asparagine, or glutamine

bypassed Ynm3 (Figure 4E). Proteins starting with aspartate,

asparagine, or glutamine can gain an N-terminal arginine residue

by de-amidation and arginylation (Varshavsky, 2011). These ob-

servations suggest that cleaved Roq1 needs a positively

charged N-terminal residue to be active. To test this notion, we

mutated the N-terminal arginine-22 in Roq1D21 to alanine,

leucine, or lysine. R22A and R22L were inactive, whereas

Letters below the graph indicate the identity of the N-terminal residues. Increa

destabilization of N-end rule substrates by Roq1 overexpression, respectively. D

(E) Western blot of HA and Pgk1.

See also Figure S6.

R22K behaved like wild-type Roq1D21 (Figure 4F). Introducing

these mutations into full-length Roq1 gave the same results,

confirming that a positively charged residue at position 22 was

required (Figure 4G). To probe the relationship between Roq1

activity and cleavage, we mutated leucine-21 in full-length

Roq1. Mutation to proline inactivated Roq1, but mutation to

the structurally similar valine yielded active Roq1 (Figure 4G).

The impact of these mutations on Roq1 functionality correlated

with their effects on cleavage: the L21P mutation strongly dimin-

ished generation of Roq1D21, whereas the functionally neutral

L21V mutation permitted cleavage after residue 21 (Figure 4H).

Hence, activation of Roq1 requires a proteolytic processing

step that exposes a positively charged N-terminal residue.

Cleaved Roq1 Regulates Ubr1 and Is Rapidly DegradedArginine and lysine are destabilizing N-terminal residues and are

recognized by Ubr1 as part of the N-end rule (Varshavsky, 2011).

Two substrate-binding sites for N-terminal residues have been

delineated in Ubr1: the type-1 site for positively charged residues

and the type-2 site for bulky hydrophobic residues. In addition,

Ubr1 contains at least one additional binding site for substrates

with internal degradation determinants (Figure 5A). The type-2

site can be mutated independently of the type-1 site, whereas

disruption of the type-1 site tends to affect also the type-2 site

(Kitamura and Fujiwara, 2013; Tasaki et al., 2009; Xia et al.,

2008). In our system, Ubr1(D318N) was a specific type-2 site

mutant and Ubr1(G173R) was a type-1 site mutant that retained

partial activity toward type-2 N-end rule substrates (Figure S6A).

Using these mutants, we tested which sites were required for

stress-induced misfolded protein degradation. Ubr1(D318N)

restored degradation of Rtn1Pho8*-GFP inDubr1 cells, whereas

Ubr1(G173R) was completely inactive (Figure 5B). Hence,

degradation of Rtn1Pho8*-GFP specifically requires the Ubr1

type-1 site.

The Ubr1 type-1 site is unlikely to directly recognize

Rtn1Pho8*-GFP. First, Rtn1 starts with methionine-serine. Sec-

ond, the divergent behaviors of Rtn1-GFP and Rtn1Pho8*-GFP

indicate that the relevant degradation determinant resides in

the internal Pho8* domain. However, besides recognizing

N-end rule substrates, the type-1 site can mediate allosteric

regulation. Specifically, occupancy of the type-1 and type-2

sites by dipeptides relieves autoinhibition of a third, unmapped

substrate-binding site (Du et al., 2002). Therefore, we hypothe-

sized that the positively charged N terminus of cleaved Roq1

interacts with and regulates Ubr1 through the type-1 site to pro-

mote recognition of misfolded proteins.

To test this model, we performed co-immunoprecipitation ex-

periments with Roq1D21 and Ubr1. Roq1D21-HA(74) interacted

with FLAG-Ubr1 (Figure 5C). Importantly, this interaction was not

detected with Roq1D21(R22A) or Ubr1(G173R). These findings

indicate that cleaved Roq1 binds to the Ubr1 type-1 site through

its N-terminal arginine. Our model furthermore implies that

cleaved Roq1 interferes with the recognition of type-1 N-end

sed and decreased mCherry/sfGFP fluorescence indicates stabilization and

ata are the mean of three experiments.


0 1 2 3 4tunicamycin treatment (h)

5

C

repo

rter l

evel

s (%

)

0

20

40

60

80

100

B

Tm (h)

CFTR-HA

Pgk1

Tm (h)

CFTR-HA

Pgk1

100 68 ± 1 56 ± 5 100 65 ± 3 54 ± 6

0 3 5 0 3 5

∆hrd1 ∆doa10 ∆ynm3 ∆hrd1 ∆doa10 ∆roq1

100 55 ± 2 30 ± 2 100 70 ± 1 69 ± 5

0 3 5 0 3 5

∆hrd1 ∆doa10 ∆hrd1 ∆doa10 ∆ubr1

A

WT∆u

br1∆y

nm3

∆roq

1W

T∆u

br1∆y

nm3

∆roq

1W

T∆u

br1∆y

nm3

∆roq

10

20

40

60

80

repo

rter l

evel

s (%

)

Rtn1Pho8*-GFP Rtn1CPY*-GFP Yop1Pho8*-GFP

Dre

porte

r lev

els

(%)

0

20

40

60

80

100

Luciferase(DM)-mCherry



Luciferase(DM)-mCherryLuciferase-mCherry

Figure 6. SHRED Mediates Degradation of

Misfolded ER Membrane and Cytosolic

Proteins

(A) Flow cytometry of cellular GFP levels after

tunicamycin (Tm) treatment for 5 hr. Error bars


(B) Western blot of HA and Pgk1 after Tm treat-

ment. Values are mean ± SEM; n = 3 and for each

strain indicate HA signal relative to Pgk1 signal

normalized to t = 0.

(C) Flow cytometry of cellular Luciferase-mCherry

and Luciferase(DM)-mCherry levels after Tm

treatment. Error bars represent mean ± SEM; n = 7.

(D) Flow cytometry of cellular Luciferase(DM)-

mCherry levels after Tm treatment. Error bars


See also Figure S7.


rule substrates. To test this prediction, we used ubiquitin-fused

X-mCherry-sfGFP constructs as N-end rule substrates, with X

representing one of the 20 proteinogenic amino acids.

mCherry-sfGFP consists of slow-maturing mCherry and fast-

maturing superfolder GFP (sfGFP). Because of these different

maturation times, the mCherry/sfGFP fluorescence ratio in-

creases with protein age and provides a readout for the stability

of X-mCherry-sfGFP variants (Khmelinskii et al., 2012). Expres-

sion of Roq1 stabilized variants starting with a type-1 residue

(R, K, H, N, D, and Q), showing that Roq1 interfered with their

degradation (Figure 5D). In contrast, variants starting with a

type-2 residue (W, F, L, I, and Y) were destabilized, showing

that Roq1 accelerated their degradation. These effects strictly

depended on Ubr1 and Ynm3 (Figure S6B). Thus, cleaved

Roq1 competes with N-end rule substrates for the Ubr1 type-1

site. Accordingly, Roq1 diminished the interaction between

Ubr1 and the type-1 substrate R-mCherry-sfGFP as judged

by co-immunoprecipitation experiments (Figure S6C). The

enhanced degradation of type-2 substrates by Roq1 agrees

with the previous finding that occupancy of the type-1 site accel-

erates turnover of type-2 substrates (Baker and Varshav-

sky, 1991).

We then sought to determine how Ubr1 is inactivated again.

Full-length and cleaved Roq1-HA(74) showed half-lives of about

5 min in cycloheximide chase experiments (Figure 5E). Protea-

some inhibition stabilized cleaved Roq1 (Figure S6D). Cleaved

Roq1 had about 2-fold higher steady-state levels in the absence

of Ubr1, but its degradation was only slightly delayed, indicating

aminor role for Ubr1 in Roq1 turnover (Figure S6D). These results

show that Roq1 is highly unstable and suggest that its levels

closely follow ROQ1 gene activity. Hence, activation of Ubr1 is


rapidly terminated once stress induction

of the ROQ1 gene ceases.

SHRED Mediates Degradation ofDiverse Membrane and CytosolicProteinsTo explore the scope of protein degrada-

tion by SHRED, we first examined addi-

tional model substrates. We compared

Rtn1Pho8*-GFP, Rtn1CPY*-GFP, and Yop1Pho8*-GFP. The

latter contained the reticulon-like ER protein Yop1 and was

stable at steady state (Figure S7A). Tunicamycin stimulated

degradation of all three reporters through SHRED (Figure 6A).

Degradation was more strongly inhibited in Dubr1 than in

Dynm3 or Droq1 cells, indicating that Ubr1 has additional

stress-induced degradative roles. Next, we analyzed human

cystic fibrosis transmembrane conductance regulator (CFTR),

a polytopic transmembrane protein that is constitutively

degraded through Hrd1 and Doa10 (Gnann et al., 2004; Zhang

et al., 2001). ER stress upregulates ERAD (Travers et al., 2000),

so that these ubiquitin ligases are likely relevant also for stress-

induced CFTR degradation. Therefore, we assessed the role of

SHRED in the degradation of CFTR in a Dhrd1 Ddoa10 back-

ground. Tunicamycin still accelerated CFTR degradation in this

background, which required Ubr1, Ynm3, and Roq1 (Figure 6B).

To determine whether SHRED also targets cytosolic proteins,

we tested Luciferase-mCherry and Luciferase(DM)-mCherry.

These reporters are based on firefly luciferase, with the latter car-

rying destabilizing mutations (Gupta et al., 2011). Accordingly,

Luciferase(DM)-mCherry was turned over more rapidly at steady

state (Figure S7B). Furthermore, stress selectively promoted the

degradation of Luciferase(DM)-mCherry, which required Ubr1,

Ynm3, and Roq1 (Figures 6C and 6D). Similarly, stress stimu-

lated the SHRED-dependent degradation of stGnd1-mCherry,

a misfolded cytosolic protein derived from yeast Gnd1 (Heck

et al., 2010) (Figures S7C and S7D). Hence, SHRED mediates

stress-induced degradation of a range of misfolded ER mem-

brane and cytosolic proteins.

To search for endogenous SHRED substrates, we acutely

overexpressed Roq1 in wild-type and Dubr1 cells by means of

ER (Rtn1Pho8*-GFP)ER (Rtn1Pho8*-GFP)cytoplasmERcytoplasmcytoplasm and ERcytoplasmnucleusnucleusnucleusnucleusplasma membraneGolgi complexvacuole membranecytoplasmmitochondriacytoplasmcytoplasmnucleusmitochondria

000

10202000

101020202020202000

2020

GFPPho8Caf20Mmm1Ncs6Srp14Mum2Srb7Srb2Rnt1Rsa3Fcy2Cog7Dap2Hst2Ddl1Aap1Yfr006wEaf5Agc1

FDR (%)

change by Roq1 oe

in WT

change by deletion of

UBR1localization

A Candidate SHRED substrates

reduced by >25% reduced by 10-25% changed by <10%

C

leve

ls re

lativ

e to

WT

1

0.8

0

0.2

0.4

0.6

WT WT +Roq1 oe

∆ubr1 ∆ubr1 + Roq1 oe

PTR2 mRNA

-log 10

p-v

alue

B

CIN8

PTR2

ROQ1

-6 -4 -2 0 2 4 6fold change Δubr1+Roq1 / Δubr1 (log2)

0

1

2

3

4

5

UBR1PTR2

-6 -4 -2 0 2 4 6fold change Δubr1 / WT(log2)

0

1

2

3

4

5

UBR1

PTR2ROQ1

-6 -4 -2 0 2 4 6fold change WT+Roq1 / WT (log2)

0

1

2

3

4

5

E

Roq1ROQ1 gene

stress

cleavageexposingarginine-22

Ynm3

Ub

proteasome

misfoldedprotein

Ubr1 Roq1+

rapidturnover

D

WT

∆ubr1

∆roq1

∆ubr1 ∆roq1

WT

∆ubr1

∆roq1

∆ubr1 ∆roq1

untreated

+ 4%ethanol

(legend on next page)




the estradiol-inducible system and analyzed the resulting prote-

omic changes by quantitative mass spectrometry. Roq1 overex-

pression decreased Rtn1Pho8*-GFP levels by about 35% in

wild-type cells, but not in Dubr1 mutants. We applied a series

of statistical filters with false discovery rates (FDRs) of 0%,

10%, and 20% and identified 5, 8, and 18 additional proteins

whose levels were reduced by >25% upon Roq1 overexpression

in wild-type cells (Figure 7A, third column) but changed by <10%

upon Roq1 overexpression in Dubr1 mutants (data not shown).

Of these candidate substrates, Caf20, Mmm1, Ncs6, and

Srp14 showed a <10% difference between wild-type and

Dubr1 cells in the absence of Roq1 overexpression and thus

closely matched the behavior of Rtn1Pho8*-GFP (Figure 7A,

fourth column). These proteins localize to the cytoplasm and

the ER membrane and are involved in diverse processes,

including translation initiation, ER-mitochondria tethering, tRNA

thiolation, and protein targeting to the ER.

In contrast to Rtn1Pho8*-GFP, at least four candidate sub-

strates (Aap1, Yfr006w, Eaf5, and Agc1) were also clearly

reduced by deletion of UBR1 alone. Hence, these proteins are

downregulated by Ubr1 when SHRED is active but are upregu-

lated by Ubr1 when SHRED is inactive. A complementary ana-

lysis aimed at low-abundance proteins additionally identified

Ptr2 as a protein strikingly exhibiting this behavior, i.e., Ptr2

levels were reduced by Roq1 overexpression in wild-type cells

and by deletion of UBR1, but Roq1 overexpression had no

further effect on Ptr2 levels in Dubr1 cells (Figure 7B). Ptr2 im-

ports peptides at the plasmamembrane. These peptides alloste-

rically activate Ubr1 to degrade Cup9, a transcriptional repressor

acting on the PTR2 gene. Degradation of Cup9, therefore, leads

to increased Ptr2 levels (Turner et al., 2000). The strong decrease

in Ptr2 protein levels upon Roq1 overexpression suggested that

Roq1 interferes with Ubr1-mediated degradation of Cup9, re-

sulting in repression of the PTR2 gene. Cup9 protein levels

were too low to be detectable. However, Roq1 overexpression

strongly reduced PTR2 mRNA levels in wild-type cells and had

no effect on the already diminished levels in Dubr1 cells (Fig-

ure 7C). These data show that Roq1 stimulates Ubr1 to degrade

certain misfolded and native proteins and additionally inhibits

Ubr1-mediated degradation of Cup9. Together with the

opposing effects of Roq1 on type-1 and type-2 N-end rule sub-

strates, these results indicate that Roq1 profoundly changes

Ubr1 substrate specificity.

Finally, to begin to address the physiological role of SHRED,

we analyzed cell growth in the presence of the folding stressor

ethanol. Deletion of UBR1 rendered cells ethanol sensitive (Fig-

ure 7D), as reported previously (Heck et al., 2010). Deletion of

ROQ1 had a milder phenotype but also caused ethanol sensi-

tivity. Deletion of ROQ1 in Dubr1 cells did not exacerbate their

Figure 7. SHRED Targets Endogenous Proteins and Helps Counteract

(A) Candidate endogenous SHRED substrates. oe, overexpression.

(B) Global effects of Roq1 overexpression and UBR1 deletion on protein express

between two strains; the y axis shows the result of a t test for that difference (two-t

(C) PTR2 mRNA levels in WT and Dubr1 cells without and with ROQ1 overexpr


(D) Growth assay of cells on regular and ethanol-containing plates. Series repres

(E) Model of SHRED.


growth defect, suggesting that lack of Roq1 is inconsequential

in the absence of Ubr1. These results are consistent with the

model that Roq1 helps to counteract protein folding stress by

regulating Ubr1.

DISCUSSION

We have found that Roq1, Ynm3, and Ubr1 act in a stress-induc-

ible pathway to mediate proteasomal degradation of misfolded

ERmembrane and cytosolic proteins. Roq1 is a conditionally ex-

pressed regulator that is cleaved by the protease Ynm3 and re-

programs the ubiquitin ligase Ubr1 through its newly exposed

N-terminal arginine. When ROQ1 transcription declines upon

stress resolution, rapid pathway inactivation is ensured by the

instability of the Roq1 protein (Figure 7E). We name this pathway

SHRED, for stress-induced homeostatically regulated protein

degradation. By virtue of being a branch of the environmental

stress response, SHRED makes protein degradation responsive

to a broad range of stimuli.

A key step in SHRED is induction of ROQ1 transcription. The

ROQ1 promoter contains a stress response element (consensus

sequence AGGGG) and, thus, a binding site for the stress-

responsive transcription factors Msn2/4 (Verghese et al.,

2012). In addition, it is bound by the heat shock transcription fac-

tor Hsf1 (Yamamoto et al., 2005). Therefore, multiple signaling

mechanisms converge onto this promoter, explaining why it re-

sponds to numerous inputs. Of note, ROQ1 mRNA levels are

also strongly increased by expression of the SHRED substrate

CFTR (Buck et al., 2015) and by an accumulation of untranslo-

cated and, presumably, misfolded secretory proteins in the

cytosol (Mutka and Walter, 2001).

The Roq1 protein is cleaved by the HtrA endopeptidase Ynm3

between leucine-21 and arginine-22. This cleavage site is

consistent with the preference of the bacterial and human

Ynm3 homologs, DegP/Q and HtrA2, for aliphatic residues at

the position preceding the scissile peptide bond (Kolmar et al.,

1996; Vande Walle et al., 2007). Subsequently, cleaved Roq1

regulates Ubr1. It has been shown that dipeptides synergistically

activate Ubr1 through its type-1 and type-2 substrate-binding

sites, promoting degradation of the transcriptional repressor

Cup9 (Du et al., 2002). In contrast, regulation of Ubr1 by Roq1 in-

volves only the type-1 site. This regulation results in slowed

degradation of Ubr1 type-1 substrates, accelerated degradation

of Ubr1 type-2 substrates, inhibition of Cup9 degradation, and

enhanced degradation of misfolded proteins. Thus, Roq1 repro-

grams Ubr1 substrate preference. Exactly how Roq1 achieves

this complex modulation—for instance, through allosteric regu-

lation of Ubr1 or by acting as a substrate adaptor—remains

to be uncovered. However, it is clear that Ubr1 is a versatile

Protein Folding Stress

ion. For each protein, the x axis shows the average fold change of expression

ailed; n = 4). The ‘‘volcano’’ lines indicate thresholds of significance (FDR = 5%).

ession. Data are normalized to WT without ROQ1 overexpression. Error bars

ent 5-fold dilutions from one step to the next.


molecular machine that possesses distinct modes of regulation

for different physiological purposes.

Homeostatic feedback regulation of a pathway requires that

its activity can be dynamically tuned up and down. For SHRED,

this is achieved by stress inducibility of the ROQ1 gene, together

with instability of the Roq1 protein. Rapid protein turnover en-

sures tight coupling of stress levels, ROQ1 transcription, and

Roq1 protein levels. Hence, SHRED activity swiftly returns to

basal levels when misfolded proteins have been eliminated.

This is reminiscent of the UPR and the regulation of proteasome

biogenesis by the transcription factors Hac1 and Rpn4, both of

which are extremely short lived (Kawahara et al., 1997; Xie and

Varshavsky, 2001).

Misfolded proteins can be repaired or degraded. Repair by

refolding is energetically less expensive than degradation

and re-synthesis. Therefore, protein repair is likely preferred

under otherwise favorable conditions (Buchberger et al.,

2010). During stress, increased misfolding may eventually

overwhelm chaperone capacity and imperil cell homeostasis.

Under such conditions, averting dysfunction presumably takes

precedent over energy considerations, and misfolded protein

degradation is favored. Stress may, thus, shift the balance be-

tween repair and degradation toward degradation, resulting in

more aggressive quality control (Shao and Hegde, 2016).

SHRED helps mediate this shift during adaptation to stress.

Hence, SHRED appears to be similar to the induction of

ERAD by the UPR and the augmentation of proteasome

biogenesis by Hsf1 and Rpn4 (Hahn et al., 2006; Travers

et al., 2000). SHRED, however, tunes the quality control ma-

chinery at the post-translational level. Interestingly, SHRED

is also activated by nutrient scarcity, which is unlikely to cause

widespread protein misfolding. SHRED may, therefore, addi-

tionally function in protein degradation for regulatory pur-

poses, in line with the identification of native, folding-compe-

tent proteins as SHRED substrates.

Could SHRED be evolutionarily conserved? Roq1 belongs

to the ubiquitous family of hydrophilin proteins, which have

only limited sequence similarity and are thought to be intrinsi-

cally disordered (Battaglia et al., 2008). Given these features

and the small size of Roq1, it is unsurprising that metazoan

sequence homologs are not obvious. Functional analogs,

however, remain possible. HtrA proteases related to Ynm3

are present from bacteria to mammals and function in protein

quality control, mitochondrial homeostasis, and apoptosis

(Clausen et al., 2011; Desideri and Martins, 2012; Fahrenkrog,

2011; Vande Walle et al., 2008). Additionally, human HtrA2 has

been implicated in ERAD (Huttunen et al., 2007). Ubr1 is also

conserved in mammals, and the type-1 sites of yeast and hu-

man Ubr1 are structurally similar (Choi et al., 2010; Matta-Ca-

macho et al., 2010). Moreover, mouse Ubr1 acts in the N-end

rule pathway but also helps to degrade misfolded proteins

(Sultana et al., 2012). Finally, the regulatory principles of

SHRED may be shared between yeast and mammals. Human

HtrA2 is imported into the mitochondrial intermembrane

space where it is cleaved, possibly by itself (Seong et al.,

2004). Induction of apoptosis triggers HtrA2 release into the

cytosol, where it antagonizes inhibitors of apoptosis (IAPs).

It does so by means of an IAP-binding motif at the extreme

N terminus of cleaved HtrA2. This activity depends on the

new N-terminal residue—an alanine, in this case (Martins,

2002). IAPs are ubiquitin ligases, which, upon interaction

with an IAP-binding motif, ubiquitinate themselves and cause

their own degradation (Buetow and Huang, 2016). Thus, in

analogy to SHRED, cleavage of HtrA2 creates a regulator

that activates ubiquitin ligases with its new N terminus. Over-

all, these intriguing clues remain to be connected, but they

raise the possibility that mechanisms related to SHRED exist

in higher eukaryotes.

Deteriorating quality control during stress and aging is a key

factor for the onset of neurodegenerative diseases. Moreover,

cancer cells suffering from chronic folding stress depend on

heightened quality control for survival (Balchin et al., 2016; Lab-

badia andMorimoto, 2015). Thus, both stimulating and inhibiting

quality control may have therapeutic benefits. A promising strat-

egy to reap these benefits is to pharmacologically target path-

ways that regulate quality control, including the UPR, the HSR,

and possible mammalian counterparts of SHRED.

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCES TABLE

d CONTACT FOR REAGENT AND RESOURCE SHARING

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

d METHOD DETAILS

B Plasmid construction

B Yeast strain generation

B Growth conditions

B Western blotting

B Pho8 assay

B Light microscopy

B Subcellular fractionation

B Flow cytometry

B Genetic screen

B Growth assays

B Quantitative real-time PCR

B Immunoprecipitation

B Mass spectrometry

d QUANTIFICATION AND STATISTICAL ANALYSIS

d DATA AND SOFTWARE AVAILABILITY

SUPPLEMENTAL INFORMATION

Supplemental Information includes seven figures and two tables and can be

found with this article online at https://doi.org/10.1016/j.molcel.2018.04.027.

ACKNOWLEDGMENTS

We are indebted to Peter Walter for inspiration, generosity, and support. We

thank Charles Boone, Jeff Brodsky, Ulrich Hartl, Erin O’Shea, and David

Pincus for reagents; the Flow Cytometry and FACS facility at the ZMBH and

the Nikon Imaging Center at Heidelberg University for assistance; and Bernd

Bukau, Claudio Joazeiro, Anton Khmelinskii, Michael Knop, Marius Lemberg,

Frauke Melchior, Axel Mogk, Dimitrios Papagiannidis, and Anne-Lore Schlaitz

for advice and comments on the manuscript. This work was funded by grant

EXC 81 from the Deutsche Forschungsgemeinschaft.




AUTHOR CONTRIBUTIONS

Conceptualization, S.S. and T.S.; Software, D.M.; Formal Analysis, G.H.H.B.;

Investigation, P.W.B., J.D.-M., V.K.C., D.N.I., K.L., E.M.G.-R., K.S., R.M.S.,

S.S., and T.S.; Writing – Original Draft, S.S.; Writing – Review & Editing, S.S.

and T.S.

DECLARATION OF INTERESTS

The authors declare no competing interests.

Received: November 11, 2017

Revised: March 12, 2018

Accepted: April 27, 2018

Published: May 31, 2018

SUPPORTING CITATIONS

The following reference appears in the Supplemental Information: Schuck

et al. (2014).

REFERENCES

Bachmair, A., Finley, D., and Varshavsky, A. (1986). In vivo half-life of a protein

is a function of its amino-terminal residue. Science 234, 179–186.

Baker, R.T., and Varshavsky, A. (1991). Inhibition of the N-end rule pathway in

living cells. Proc. Natl. Acad. Sci. USA 88, 1090–1094.

Balchin, D., Hayer-Hartl, M., and Hartl, F.U. (2016). In vivo aspects of protein

folding and quality control. Science 353, aac4354.

Battaglia, M., Olvera-Carrillo, Y., Garciarrubio, A., Campos, F., and

Covarrubias, A.A. (2008). The enigmatic LEA proteins and other hydrophilins.

Plant Physiol. 148, 6–24.

Belanger, K.D., Walter, D., Henderson, T.A., Yelton, A.L., O’Brien, T.G.,

Belanger, K.G., Geier, S.J., and Fahrenkrog, B. (2009). Nuclear localisation

is crucial for the proapoptotic activity of the HtrA-like serine protease

Nma111p. J. Cell Sci. 122, 3931–3941.

Buchberger, A., Bukau, B., and Sommer, T. (2010). Protein quality control in

the cytosol and the endoplasmic reticulum: brothers in arms. Mol. Cell 40,

238–252.

Buck, T.M., Jordan, R., Lyons-Weiler, J., Adelman, J.L., Needham, P.G.,

Kleyman, T.R., and Brodsky, J.L. (2015). Expression of three topologically

distinct membrane proteins elicits unique stress response pathways in the

yeast Saccharomyces cerevisiae. Physiol. Genomics 47, 198–214.

Buetow, L., and Huang, D.T. (2016). Structural insights into the catalysis and

regulation of E3 ubiquitin ligases. Nat. Rev. Mol. Cell Biol. 17, 626–642.

Choi, W.S., Jeong, B.-C., Joo, Y.J., Lee, M.-R., Kim, J., Eck, M.J., and Song,

H.K. (2010). Structural basis for the recognition of N-end rule substrates by the

UBR box of ubiquitin ligases. Nat. Struct. Mol. Biol. 17, 1175–1181.

Clausen, T., Kaiser, M., Huber, R., and Ehrmann, M. (2011). HTRA proteases:

regulated proteolysis in protein quality control. Nat. Rev. Mol. Cell Biol. 12,

152–162.

Cloutier, P., and Coulombe, B. (2013). Regulation of molecular chaperones

through post-translational modifications: decrypting the chaperone code.

Biochim. Biophys. Acta 1829, 443–454.

Cox, J., Hein, M.Y., Luber, C.A., Paron, I., Nagaraj, N., and Mann, M. (2014).

Accurate proteome-wide label-free quantification by delayed normalization

and maximal peptide ratio extraction, termed MaxLFQ. Mol. Cell.

Proteomics 13, 2513–2526.

Dang, N.X., and Hincha, D.K. (2011). Identification of two hydrophilins that

contribute to the desiccation and freezing tolerance of yeast

(Saccharomyces cerevisiae) cells. Cryobiology 62, 188–193.

Desideri, E., and Martins, L.M. (2012). Mitochondrial stress signalling: HTRA2

and Parkinson’s disease. Int. J. Cell Biol. 2012, 607929.


Dohmen, R.J., Madura, K., Bartel, B., and Varshavsky, A. (1991). The N-end

rule is mediated by the UBC2(RAD6) ubiquitin-conjugating enzyme. Proc.

Natl. Acad. Sci. USA 88, 7351–7355.

Du, F., Navarro-Garcia, F., Xia, Z., Tasaki, T., and Varshavsky, A. (2002). Pairs

of dipeptides synergistically activate the binding of substrate by ubiquitin

ligase through dissociation of its autoinhibitory domain. Proc. Natl. Acad.

Sci. USA 99, 14110–14115.

Eisele, F., and Wolf, D.H. (2008). Degradation of misfolded protein in the cyto-

plasm is mediated by the ubiquitin ligase Ubr1. FEBS Lett. 582, 4143–4146.

Fahrenkrog, B. (2011). Nma111p, the pro-apoptotic HtrA-like nuclear serine

protease in Saccharomyces cerevisiae: a short survey. Biochem. Soc.

Trans. 39, 1499–1501.

Fang, N.N., Ng, A.H.M., Measday, V., and Mayor, T. (2011). Hul5 HECT ubiq-

uitin ligase plays amajor role in the ubiquitylation and turnover of cytosolicmis-

folded proteins. Nat. Cell Biol. 13, 1344–1352.

Fang, N.N., Chan, G.T., Zhu, M., Comyn, S.A., Persaud, A., Deshaies, R.J.,

Rotin, D., Gsponer, J., and Mayor, T. (2014). Rsp5/Nedd4 is the main ubiquitin

ligase that targets cytosolic misfolded proteins following heat stress. Nat. Cell

Biol. 16, 1227–1237.

Gardner, R.G., Nelson, Z.W., and Gottschling, D.E. (2005). Degradation-medi-

ated protein quality control in the nucleus. Cell 120, 803–815.

Gasch, A.P., Spellman, P.T., Kao, C.M., Carmel-Harel, O., Eisen, M.B., Storz,

G., Botstein, D., and Brown, P.O. (2000). Genomic expression programs in the

response of yeast cells to environmental changes. Mol. Biol. Cell 11,

4241–4257.

Ghaemmaghami, S., Huh, W.-K., Bower, K., Howson, R.W., Belle, A.,

Dephoure, N., O’Shea, E.K., and Weissman, J.S. (2003). Global analysis of

protein expression in yeast. Nature 425, 737–741.

Gnann, A., Riordan, J.R., andWolf, D.H. (2004). Cystic fibrosis transmembrane

conductance regulator degradation depends on the lectins Htm1p/EDEM and

the Cdc48 protein complex in yeast. Mol. Biol. Cell 15, 4125–4135.

Gupta, R., Kasturi, P., Bracher, A., Loew, C., Zheng, M., Villella, A., Garza, D.,

Hartl, F.U., and Raychaudhuri, S. (2011). Firefly luciferase mutants as sensors

of proteome stress. Nat. Methods 8, 879–884.

Hahn, J.-S., Neef, D.W., and Thiele, D.J. (2006). A stress regulatory network for

co-ordinated activation of proteasome expression mediated by yeast heat

shock transcription factor. Mol. Microbiol. 60, 240–251.

Hampton, R.Y., Koning, A., Wright, R., and Rine, J. (1996). In vivo examination

of membrane protein localization and degradation with green fluorescent pro-

tein. Proc. Natl. Acad. Sci. USA 93, 828–833.

Hao, N., and O’Shea, E.K. (2011). Signal-dependent dynamics of transcription

factor translocation controls gene expression. Nat. Struct. Mol. Biol.

19, 31–39.

Heck, J.W., Cheung, S.K., and Hampton, R.Y. (2010). Cytoplasmic protein

quality control degradation mediated by parallel actions of the E3 ubiquitin

ligases Ubr1 and San1. Proc. Natl. Acad. Sci. USA 107, 1106–1111.

Huttunen, H.J., Guenette, S.Y., Peach, C., Greco, C., Xia, W., Kim, D.Y.,

Barren, C., Tanzi, R.E., and Kovacs, D.M. (2007). HtrA2 regulates b-amyloid

precursor protein (APP) metabolism through endoplasmic reticulum-associ-

ated degradation. J. Biol. Chem. 282, 28285–28295.

Itzhak, D.N., Tyanova, S., Cox, J., and Borner, G.H.H. (2016). Global, quantita-

tive and dynamic mapping of protein subcellular localization. eLife 5, 1–36.

Kawahara, T., Yanagi, H., Yura, T., and Mori, K. (1997). Endoplasmic reticulum

stress-induced mRNA splicing permits synthesis of transcription factor

Hac1p/Ern4p that activates the unfolded protein response. Mol. Biol. Cell 8,

1845–1862.

Khmelinskii, A., Keller, P.J., Bartosik, A., Meurer, M., Barry, J.D., Mardin, B.R.,

Kaufmann, A., Trautmann, S., Wachsmuth, M., Pereira, G., et al. (2012).

Tandem fluorescent protein timers for in vivo analysis of protein dynamics.

Nat. Biotechnol. 30, 708–714.

Kitamura, K., and Fujiwara, H. (2013). The type-2 N-end rule peptide recogni-

tion activity of Ubr11 ubiquitin ligase is required for the expression of peptide

transporters. FEBS Lett. 587, 214–219.

http://refhub.elsevier.com/S1097-2765(18)30349-6/sref1








































































































Kolmar, H., Waller, P.R.H., and Sauer, R.T. (1996). The DegP and DegQ peri-

plasmic endoproteases of Escherichia coli: specificity for cleavage sites and

substrate conformation. J. Bacteriol. 178, 5925–5929.

Labbadia, J., and Morimoto, R.I. (2015). The biology of proteostasis in aging

and disease. Annu. Rev. Biochem. 84, 435–464.

Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and

memory-efficient alignment of short DNA sequences to the human genome.

Genome Biol. 10, R25.

Martins, L.M. (2002). The serine protease Omi/HtrA2: a second mammalian

protein with a Reaper-like function. Cell Death Differ. 9, 699–701.

Matta-Camacho, E., Kozlov, G., Li, F.F., and Gehring, K. (2010). Structural

basis of substrate recognition and specificity in the N-end rule pathway. Nat.

Struct. Mol. Biol. 17, 1182–1187.

Mutka, S.C., andWalter, P. (2001). Multifaceted physiological response allows

yeast to adapt to the loss of the signal recognition particle-dependent protein-

targeting pathway. Mol. Biol. Cell 12, 577–588.

Nillegoda, N.B., Theodoraki, M.A., Mandal, A.K., Mayo, K.J., Ren, H.Y.,

Sultana, R., Wu, K., Johnson, J., Cyr, D.M., and Caplan, A.J. (2010). Ubr1

and Ubr2 function in a quality control pathway for degradation of unfolded

cytosolic proteins. Mol. Biol. Cell 21, 2102–2116.

Padmanabhan, N., Fichtner, L., Dickmanns, A., Ficner, R., Schulz, J.B., and

Braus, G.H. (2009). The yeast HtrA orthologue Ynm3 is a protease with chap-

erone activity that aids survival under heat stress. Mol. Biol. Cell 20, 68–77.

Pincus, D., Aranda-Dıaz, A., Zuleta, I.A., Walter, P., and El-Samad, H. (2014).

Delayed Ras/PKA signaling augments the unfolded protein response. Proc.

Natl. Acad. Sci. USA 111, 14800–14805.

Prasad, R., Kawaguchi, S., and Ng, D.T. (2010). A nucleus-based quality con-

trol mechanism for cytosolic proteins. Mol. Biol. Cell 21, 2117–2127.

Ravid, T., Kreft, S.G., and Hochstrasser, M. (2006). Membrane and soluble

substrates of the Doa10 ubiquitin ligase are degraded by distinct pathways.

EMBO J. 25, 533–543.

Ruggiano, A., Foresti, O., and Carvalho, P. (2014). Quality control: ER-associ-

ated degradation: protein quality control and beyond. J. Cell Biol. 204,

869–879.

Schuck, S., Prinz, W.A., Thorn, K.S., Voss, C., and Walter, P. (2009).

Membrane expansion alleviates endoplasmic reticulum stress independently

of the unfolded protein response. J. Cell Biol. 187, 525–536.

Schuck, S., Gallagher, C.M., and Walter, P. (2014). ER-phagy mediates selec-

tive degradation of endoplasmic reticulum independently of the core auto-

phagy machinery. J. Cell Sci. 127, 4078–4088.

Seong, Y.M., Choi, J.Y., Park, H.J., Kim, K.J., Ahn, S.G., Seong, G.H., Kim,

I.K., Kang, S., and Rhim, H. (2004). Autocatalytic processing of HtrA2/Omi is

essential for induction of caspase-dependent cell death through antagonizing

XIAP. J. Biol. Chem. 279, 37588–37596.

Shao, S., and Hegde, R.S. (2016). Target selection during protein quality con-

trol. Trends Biochem. Sci. 41, 124–137.

Sprouffske, K., andWagner, A. (2016). Growthcurver: an R package for obtain-

ing interpretable metrics from microbial growth curves. BMC Bioinformatics

17, 172.

Stolz, A., andWolf, D.H. (2012). Use of CPY and its derivatives to study protein

quality control in various cell compartments. MethodsMol. Biol. 832, 489–504.

Stolz, A., Besser, S., Hottmann, H., andWolf, D.H. (2013). Previously unknown

role for the ubiquitin ligase Ubr1 in endoplasmic reticulum-associated protein

degradation. Proc. Natl. Acad. Sci. USA 110, 15271–15276.

Sultana, R., Theodoraki, M.A., and Caplan, A.J. (2012). UBR1 promotes pro-

tein kinase quality control and sensitizes cells to Hsp90 inhibition. Exp. Cell

Res. 318, 53–60.

Swanson, R., Locher, M., and Hochstrasser, M. (2001). A conserved ubiquitin

ligase of the nuclear envelope/endoplasmic reticulum that functions in both

ER-associated and Matalpha2 repressor degradation. Genes Dev. 15,

2660–2674.

Tasaki, T., Zakrzewska, A., Dudgeon, D.D., Jiang, Y., Lazo, J.S., and Kwon,

Y.T. (2009). The substrate recognition domains of the N-end rule pathway.

J. Biol. Chem. 284, 1884–1895.

Taxis, C., and Knop, M. (2006). System of centromeric, episomal, and integra-

tive vectors based on drug resistance markers for Saccharomyces cerevisiae.

Biotechniques 40, 73–78.

Travers, K.J., Patil, C.K., Wodicka, L., Lockhart, D.J., Weissman, J.S., and

Walter, P. (2000). Functional and genomic analyses reveal an essential coordi-

nation between the unfolded protein response and ER-associated degrada-

tion. Cell 101, 249–258.

Turner, G.C., Du, F., and Varshavsky, A. (2000). Peptides accelerate their up-

take by activating a ubiquitin-dependent proteolytic pathway. Nature 405,

579–583.

Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A., Hein, M.Y., Geiger, T., Mann,

M., and Cox, J. (2016). The Perseus computational platform for comprehen-

sive analysis of (prote)omics data. Nat. Methods 13, 731–740.

Vande Walle, L., Van Damme, P., Lamkanfi, M., Saelens, X., Vandekerckhove,

J., Gevaert, K., and Vandenabeele, P. (2007). Proteome-wide identification of

HtrA2/Omi substrates. J. Proteome Res. 6, 1006–1015.

Vande Walle, L., Lamkanfi, M., and Vandenabeele, P. (2008). The mitochon-

drial serine protease HtrA2/Omi: an overview. Cell Death Differ. 15, 453–460.

Varshavsky, A. (2011). The N-end rule pathway and regulation by proteolysis.

Protein Sci. 20, 1298–1345.

Verghese, J., Abrams, J., Wang, Y., and Morano, K.A. (2012). Biology of the

heat shock response and protein chaperones: budding yeast

(Saccharomyces cerevisiae) as a model system. Microbiol. Mol. Biol. Rev.

76, 115–158.

Voeltz, G.K., Prinz, W.A., Shibata, Y., Rist, J.M., and Rapoport, T.A. (2006).

A class of membrane proteins shaping the tubular endoplasmic reticulum.

Cell 124, 573–586.

Walter, P., and Ron, D. (2011). The unfolded protein response: from stress

pathway to homeostatic regulation. Science 334, 1081–1086.

Xia, Z.,Webster, A., Du, F., Piatkov, K., Ghislain, M., and Varshavsky, A. (2008).

Substrate-binding sites of UBR1, the ubiquitin ligase of the N-end rule

pathway. J. Biol. Chem. 283, 24011–24028.

Xie, Y., and Varshavsky, A. (2001). RPN4 is a ligand, substrate, and transcrip-

tional regulator of the 26S proteasome: a negative feedback circuit. Proc. Natl.

Acad. Sci. USA 98, 3056–3061.

Yamamoto, A., Mizukami, Y., and Sakurai, H. (2005). Identification of a novel

class of target genes and a novel type of binding sequence of heat shock tran-

scription factor in Saccharomyces cerevisiae. J. Biol. Chem. 280,

11911–11919.

Zhang, Y., Nijbroek, G., Sullivan, M.L., McCracken, A.A., Watkins, S.C.,

Michaelis, S., and Brodsky, J.L. (2001). Hsp70 molecular chaperone facilitates

endoplasmic reticulum-associated protein degradation of cystic fibrosis trans-

membrane conductance regulator in yeast. Mol. Biol. Cell 12, 1303–1314.

Zheng, N., and Shabek, N. (2017). Ubiquitin ligases: structure, function, and

regulation. Annu. Rev. Biochem. 86, 129–157.
















































































































STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies

Mouse monoclonal anti-GFP (clones 7.1/13.1) Roche Cat#11814460001; RRID: AB_390913

Mouse monoclonal anti-mCherry (clone 1C51) Abcam Cat#Ab125096; RRID: AB_11133266

Rabbit polycolnal anti-mCherry Biovision Cat#5993; RRID: AB_1975001

Rabbit polyclonal anti-Sec61 Schuck et al., 2009 N/A

Mouse monoclonal anti-Pgk1 (clone 22C5) Abcam Cat#Ab113687; RRID: AB_10861977

Mouse monoclonal anti-Pho8 (clone 1D3A10) Abcam Cat#Ab113688; RRID: AB_10860792

Mouse monoclonal anti-FLAG (clone M2) Sigma-Aldrich Cat#F1804; RRID: AB_262044

Mouse monoclonal anti-FLAG-agarose (clone M2) Sigma-Aldrich Cat#A2220; RRID: AB_262044

Mouse monoclonal anti-HA (clone 6E2) Cell Signaling Cat#2367S; RRID: AB_10691311

Rat monoclonal anti-HA (clone 3F10) Roche Cat#11867423001; RRID: AB_390918

Mouse monoclonal anti-HA-agarose (clone HA-7) Sigma-Aldrich Cat#A2095; RRID: AB_257974

Chemicals, Peptides, and Recombinant Proteins

Beta-estradiol Sigma-Aldrich Cat#E8875; CAS: 50-28-2

MG132 Merck Cat#474790-20MG; CAS: 133407-82-6

1NM-PP1 Merck Cat#529581-1MG; CAS: 221244-14-0

Tunicamycin Merck Cat#654380-50MG; CAS: 11089-65-9

Deposited Data

Mass spectrometry proteomics data This paper https://www.ebi.ac.uk/pride/archive/,

ProteomeXchange: PXD008962

Original data This paper https://doi.org/10.17632/ks6h7p7wbg.1

Experimental Models: Organisms/Strains

See Table S2 N/A N/A

Oligonucleotides

knock-in_URA_fw: atttatggtgaaggataagttttgaccatca

aagaaggttagcttgtctgtaagcggatg

This paper N/A

knock-in_URA_rev: gaagctttttctttccaattttttttttttcgtc

attatacatgttctttcctgcgttatcc

This paper N/A

URA part2 fw: TTGTGAGTTTAGTATACATGC This paper N/A

URA part1 rev: ATTCGGTAATCTCCGAACAG This paper N/A

Recombinant DNA

See Table S1 N/A N/A

Software and Algorithms

Bowtie Langmead et al., 2009 http://bowtie-bio.sourceforge.net/index.shtml

Growthcurver Sprouffske and Wagner, 2016 https://cran.r-project.org/web/packages/

growthcurver/index.html

MaxQuant Cox et al., 2014 http://www.coxdocs.org/doku.php?id=

maxquant:start

Perseus Tyanova et al., 2016 http://www.coxdocs.org/doku.php?id=

perseus:start

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to andwill be fulfilled by the Lead Contact, Sebastian

Schuck ([email protected]).

e1 Molecular Cell 70, 1–13.e1–e5, June 21, 2018

mailto:[email protected]

https://www.ebi.ac.uk/pride/archive/

https://doi.org/10.17632/ks6h7p7wbg.1

http://bowtie-bio.sourceforge.net/index.shtml

https://cran.r-project.org/web/packages/growthcurver/index.html

https://cran.r-project.org/web/packages/growthcurver/index.html

http://www.coxdocs.org/doku.php?id=maxquant:start

http://www.coxdocs.org/doku.php?id=maxquant:start

http://www.coxdocs.org/doku.php?id=perseus:start

http://www.coxdocs.org/doku.php?id=perseus:start


EXPERIMENTAL MODEL AND SUBJECT DETAILS

S. cerevisiae strains were generated in theW303 (leu2-3,112 trp1-1 ura3-1 his3-11,15 can1-100) or BY4741 (his3D1 leu2D0met15D0

ura3D0) background. Strains were cultured at 30�C in SCD (2% glucose, 0.7% yeast nitrogen base, amino acids, lacking uracil or

leucine where appropriate to maintain plasmid selection), SC-raf (2% raffinose, 0.7% yeast nitrogen base, amino acids) or YPD

(1% yeast extract, 2% peptone, 2% glucose) as indicated in ‘‘Method Details’’ below.

METHOD DETAILS

Plasmid constructionPlasmids used in this study are listed in Table S1. Sequence information is available upon request. Pho8* constructs contain residues

61-550 of Pho8 with an F352S mutation and an additional but irrelevant N247D mutation. Rtn1CPY*-GFP contains full-length CPY

with a G255R mutation. Hmg2-GFP contains residues 1-671 of Hmg2. pRS303K-GPD-TagBFP and pRS303H-GPD-TagBFP are

based on pRS303K and pRS303H (Taxis and Knop, 2006) and were provided by Michael Knop (Heidelberg University). Lucif-

erase-mCherry and Luciferase(DM)-mCherry contain wild-type firefly Luciferase or double mutant (DM) luciferase(R188Q,R261Q)

(Gupta et al., 2011). stGnd1-mCherry contains residues 1-150 of Gnd1. To generate pRS316-TCYC1, the CYC1 terminator from

pRS413ADH was inserted into the XhoI/KpnI site of pRS316. To generate pRS316-Pynm3-Ynm3, pRS316-PROQ1-Roq1 and

pRS316-PUBR1-Ubr1, the YNM3, ROQ1 and UBR1 coding sequences including 331, 328 and 582 bp of upstream sequence were

amplified from W303 genomic DNA and inserted into the BamHI/XhoI site of pRS316-TCYC1. Point mutations were introduced ac-

cording to theQuikchange site-directedmutagenesis kit (Stratagene). Insertionswere introduced by linearization of the recipient vec-

tor by restriction digest or inverse PCR, amplification of the insert with primers creating homologous ends to the recipient vector, and

ligation with the NEBuilder HiFi DNA assembly master mix (NEB). Deletions were similarly generated by inverse PCR with primers

removing part of the plasmid sequence and enabling re-ligation of homologous ends.

Yeast strain generationStrains used in this study are listed in Table S2. Unless indicated otherwise, strains were derived from W303 mating type a (strain

SSY122). Chromosomal integrations were introduced with PCR products or the integrative plasmids described above. Gene dele-

tion, tagging or insertion was confirmed by colony PCR. For strains generated with integrative plasmids, clones with a single copy of

the expression cassettes were selected by flow cytometry or western blotting. To generate strains with the F352S mutation in the

endogenous PHO8 gene along with isogenic control strains, the sequence encoding Pho8(136-566) together with the kanamycin

resistance cassette was amplified from pFA6a-Pho8D60(F352S)-kanMX6 or pFA6a-Pho8D60-kanMX6 and integrated into the

PHO8 locus. Except for the F352S mutation, this leaves the PHO8 coding sequence intact. To generate strains SSY2323 and

SSY2324 with chromosomal Roq1D21 variants, Ub-Roq1D21-HA(74) or Ub-Roq1D21(R22A)-HA(74) together with the URA3 gene

were amplified from plasmids pSS764 or pSS927 with primers knock-in_URA_fw/rev and integrated into the ura3 locus of strain

SSY792. To generate strains containing nat::GEM-PGAL1-ROQ1 (SSY1856, 1857 and 1858), the ROQ1 promoter was first replaced

with kan::GEM-PGAL1 using plasmid pFA6a-kanMX6-GEM-PGAL1. The kanamycin resistance cassette was then replaced with the

nat resistance cassette by marker swap. To generate strains containing ura3::PGPD-Ub-X-mCherry-sfGFP-kan, Ub-X-mCherry-

sfGFP together with the kanamycin resistance cassette were amplified from plasmids pAK146-160, pMAM46-48 or pMAM66-67

with primers URA part2 fw/URA part1 and integrated into the ura3 locus. To generate strains SSY2376 containing both Ub-

Roq1D21-HA(74) and Ub-R-mCherry-sfGFP in the ura3 locus, Ub-X-mCherry-sfGFP together with the kanamycin resistance

cassette were amplified from plasmid pMaM66 with primers URA part1 rev/URA part2 fw and integrated into the intact URA3

gene of strain SSY2323.

Growth conditionsFor steady state analyses, cultures were grown to saturation, diluted and grown for at least 9 h so that they reached mid log phase

(OD600 = 0.5 - 1). For cycloheximide chase experiments, cells in mid log phase were treated with 50 mg/ml cycloheximide (Sigma). For

ER stress treatment, cells in mid log phase were diluted to OD600 0.05 and either left untreated or treated with tunicamycin (Merck) or

8 mM DTT (Applichem). The standard tunicamycin concentration was 1 mg/ml, but 2 mg/ml were used in flow cytometry experiments

for maximum effectiveness of the drug. For proteasome inhibition, MG132 (Merck) was used at a final concentration of 80 mM and

strains lacking PDR5where used tomakeMG132 effective. For inhibition of analog-sensitive protein kinase A, 1NM-PP1 (Merck) was

used at 3 mM. For activation of the Gal4-ER-Msn2 transcription factor, b-estradiol (Sigma) was dissolved in ethanol and used at a final

concentration of 400 nM for up to six hours for flow cytometric measurements and for eight hours for mass spectrometric analysis.

For analyses after galactose induction, cultures were grown to early log phase (OD600 = 0.2) in SC-raf medium, galactose was added

to a final concentration of 2% and cells were grown for another 2 - 3 h. For promoter shut-off, galactose-induced cells were diluted

1:10 into SCD. For growth to post-diauxic phase, cultures in mid log phase were diluted to OD600 0.5 and grown for 10 h.

Molecular Cell 70, 1–13.e1–e5, June 21, 2018 e2


Western blottingCells were collected by centrifugation, washed once with water and disrupted by bead beating with a FastPrep 24 (MP Biomedicals)

in 50 mM Tris-HCl pH 7.5 containing 0.5 mMEDTA, 1 mMPMSF and complete protease inhibitors (Roche). Proteins were solubilized

by addition of 1.5% SDS and incubation at 65�C for 5 min. Lysates were cleared at 16,000 g at 4�C for 2 min and protein concen-

trations were determined with the BCA assay kit (Thermo Scientific Pierce). Equal amounts of protein were resolved by SDS-

PAGE and transferred onto nitrocellulose membranes. Membranes were probed with primary and HRP-coupled secondary

antibodies and incubated with homemade ECL. Chemiluminescence was detected with an ImageQuant LAS 4000 imaging system

(GE Healthcare). Images were quantified with ImageJ and processed with Adobe Photoshop. Antibodies were mouse-anti

GFP 7.1/13.1 (Roche), mouse anti-mCherry 1C51 (Abcam) for detection of Luciferase-mCherry, rabbit anti-mCherry (Biovision) for

detection of R-mCherry-sfGFP, rabbit anti-Sec61 (Peter Walter, UCSF), mouse anti-Pgk1 22C5 (Abcam), mouse anti-Pho8

1D3A10 (Abcam), mouse anti-FLAG M2 (Sigma), mouse anti-HA 6E2 (Cell Signaling) for detection of CFTR-HA, and rat anti-HA

3F10 (Roche) for detection of HA-tagged Roq1.

Pho8 assayCells were grown to mid log phase (OD600 = 0.5 - 1) in SCD. Two ODs of cells were collected by centrifugation, washed with water,

resuspended in 200 ml cold lysis buffer (20 mM PIPES pH 6.8, 1% Triton X-100, 50 mM KCl, 100 mM KOAc pH 7.5, 10 mM MgSO4,

10 mM ZnSO4, 1 mM PMSF, complete protease inhibitors), and disrupted as above. For each duplicate reaction, 50 ml lysate were

combined with 200 ml reaction buffer (250 mM Tris pH 8.5, 1% Triton X-100, 10 mM MgSO4, 10 mM ZnSO4) containing 1.25 mM

p-nitrophenyl phosphate (Sigma) as substrate and incubated at 37�C. The reaction was stopped by addition of 250 ml 1 M

glycine/KOH pH 11. Absorption was measured at 405 nm and one unit phosphatase activity was defined as 1 nmol p-nitrophenol

produced per min and mg total protein.

Light microscopyCells were imaged live at room temperature. Images were acquired with a spinning-disk confocal microscope (a Nikon TE2000 in-

verted microscope equipped with a Yokogawa CSU-X1 confocal scanning unit, Hamamatsu C9100-02 EMCCD camera and Nikon

Plan Apo VC 100x/1.4 NA oil objective lens or a Leica DMi8 inverted microscope equipped with a Yokogawa CSU-X1 confocal scan-

ning unit, Hamamatsu C9100-13 EMCCD camera and a Leica HC PL APO 100x/1.4 NA CS2 oil objective lens) and processed with

Adobe Photoshop.

Subcellular fractionationCells were harvested at 1,000 g at room temperature for 5min, washedwith 100mMTris-HCl pH 9.4 with 10mMNaN3 and incubated

at 30�C for 10 min in the same buffer additionally containing 10 mM DTT. Cells were pelleted, resuspended in spheroplast buffer

(50 mM Tris-HCl pH 7.5, 1 M sorbitol, 1 mM PMSF and complete protease inhibitors) and treated with zymolyase T20 (0.2 U/OD

of cells, MP Biomedicals) at 30�C for 10 min. Spheroplasts were collected at 1,000 g at 4�C for 5 min, washed with ice-cold sphe-

roplast buffer and resuspended in lysis buffer (50mMTris-HCl pH 7.5, 1mMEDTA, 200mMsorbitol, 1mMPMSF, complete protease

inhibitors). Lysates were homogenized in a Dounce homogenizer (Kimble Chase, clearance 0.01 – 0.06 mm) and cleared at 500 g at

4�C for 5 min. One half of the supernatant was kept as total lysate T, the other half was centrifuged at 16,000 g at 4�C for 15 min. The

supernatant was collected as soluble fraction S. The pellet, containing total cell membranes, was washed once and resuspended in

lysis buffer as pellet fraction P. Proteins in T, S and P were solubilized by addition of 1.5% SDS and incubation at 65� for 5 min. Equal

fractions were analyzed by western blotting.

Flow cytometryCultures for flow cytometry were grown in 1mLmedium in 96 deep-well plates. At each time point, 100 ml aliquots were removed and

fluorescence and cell number were measured with a BD Biosciences FACS Canto flow cytometer equipped with a high-throughput

sampler. For experiments measuring the degradation of constitutively expressed reporter proteins, regular GFP was used as a tag.

To determine cellular reporter levels, GFP fluorescence was first corrected for autofluorescence by subtracting the fluorescence of

identically treated control cells not expressing GFP. Corrected GFP fluorescence was divided by the fluorescence of constitutively

expressed cytosolic BFP as a measure for cell volume. To determine the effect of stress treatment, at each time point the GFP/BFP

ratios of treated cells were divided by those of corresponding untreated cells. This step accounted for minor changes in reporter

levels that were unrelated to stress treatment but caused by the dilution of the cultures at the beginning of the experiment. The re-

sulting reporter levels were expressed in per cent of those at t = 0. For cycloheximide chase and promoter shut-off experiments, re-

porters tagged with fast-maturing sfGFP instead of slow-maturing regular GFP were used. This ameliorated the problem that new

fluorescence can be generated after reporter synthesis has ceased because of the delayedmaturation of fully synthesized but incom-

pletely folded GFP. Total GFP amounts were determined bymultiplying autofluorescence-correctedmean cellular GFP fluorescence

by cell number. These amounts were expressed as reporter remaining in per cent of the amounts at t = 0.



Genetic screenStrain SSY633 was grown in YPDmedium to 108 cells/ml. Cells from 1mL culture were washed twice with H2O, resuspended in 1mL

0.1 M sodium phosphate buffer pH 7.0 and treated with 50 ml ethyl methanesulfonate (EMS, Sigma) at 30�C for 60 min. EMS was

quenched with 0.8mL 5% (w/v) NaS2O3, and cells were washed twice with 5mL 5% (w/v) NaS2O3 and once with H2O. This treatment

resulted in approximately 65% lethality. Mutants were grown on YPD plates and replicated onto thin SCD plates containing 1 mg/ml

tunicamycin. 56,000 colonies were screened by fluorescence microscopy for mutants with high levels of GFP. As a secondary

screen, flow cytometry was used to identify mutants that had normal steady state levels of Rtn1Pho8*-GFP and failed to degrade

it upon tunicamycin treatment. Mating with strain SSY644 showed that all 184 remaining mutants had recessive mutations, and

complementation analysis defined five groups. Representatives from each group were backcrossed three times with SSY633. Six

to ten mutant haploids from the last crossing were mixed and genomic DNA was isolated from the mutants and from strains

SSY633 and SSY644. Sequencing libraries were prepared with the NEBNext DNA sample prep kit (NEB) and single-read sequencing

was done on a HiSeq 2000 sequencer (Illumina). Sequencing reads were aligned to the S. cerevisiae W303 reference genome with

Bowtie (Langmead et al., 2009). Using custom PHP scripts, the frequency of each of the four nucleobases was determined for each

position of the genomes of SSY633, SSY644 and the various mutants. Heterogeneous positions in the mutants indicated irrelevant

mutations segregating randomly between mutant and wild-type haploids during crossing. Homogeneous positions for which the

base in a mutant differed from the bases in SSY633 and SSY644 indicated mutations that segregated with the mutant phenotype.

Growth assaysFor growth assays in liquid culture, strains SSY1488 and 1559 were grown to mid log phase in SCD, diluted to an OD600 of 0.05, and

either treated with 400 nM estradiol or left untreated. Forty-eight well plates were seeded with 500 ml culture and absorbance at

600 nm was measured in five minute intervals using a Tecan Infinite M1000 Pro microplate reader over 20 hours. A shaking routine

consisting of 90 s linear shaking, 30 s rest and 120 s orbital shaking was used to keep cells in suspension in between reads. The area

under the growth curves was used as a measure for cell growth as calculated by the R package Growthcurver (Sprouffske and

Wagner, 2016). For growth assays on solid medium, strains SSY875, 1782, 1729 and 792 were grown to mid-log phase in SCD. Cul-

tures were diluted to an OD600 of 0.2, dilution series with fivefold dilution steps were prepared and spotted onto YPD plates or YPD

plates containing 4% ethanol. Plates were incubated at 30�C for 1.5 and 3 days, respectively.

Quantitative real-time PCRFive ODs of cells were collected by centrifugation, washed once with cold H2O and resuspended in 400 ml TES buffer

(10 mM Tris pH 7.5, 10 mM EDTA, 0.5% (w/v) SDS). Four-hundred ml water-saturated phenol were added, samples were incubated

at 65�C for 60min and phase separation was induced by centrifugation at 16,000 g at 4�C for 5min. The aqueous phasewas collected

and extracted twice with 400 ml water-saturated phenol and once with 400 ml chloroform. RNA was precipitated by addition of 40 ml

3 M NaOAc, pH 5.3, 1 mL ice-cold 100% ethanol and centrifugation at 16,000 g at 4�C for 5 min. Pellets were washed once with 1 mL

ice-cold 70% ethanol and resuspended in 30 ml H2O. Synthesis of cDNA was done with the Protoscript II kit (NEB) using d(T)23VN

primers. PCRs were run on a LightCylcer II 480 (Roche) using the SensiFAST SYBR No-ROX kit (Bioline). TAF10 mRNA served as

internal standard to determine relative ROQ1 mRNA levels. Information on PCR conditions and primer sequences is available

upon request.

ImmunoprecipitationTen ODs of cells in mid log phase were harvested and lysed as above in IP buffer (100 mMNaCl, 10% glycerol, 0.1% NP-40, 0.5 mM

EDTA, 25 mMHEPES pH 7.5) supplemented with complete protease inhibitors and 1mMPMSF. Lysates were cleared at 12,000 g at

4�C for 10 minutes. Six percent of the lysate (about 60 mg total protein) were kept as input. Roq1-HA(74) and FLAG-Ubr1 were immu-

noprecipitated with 30 ml anti-HA-agarose beads (clone HA-7, Sigma) or anti-FLAG-agarose beads (clone M2, Sigma), respectively,

at 4�C for 30 minutes. Beads were washed three times with cold lysis buffer and bound protein was eluted with SDS-PAGE sample

buffer at 95�C for 5 minutes. Samples were analyzed by western blotting as above.

Mass spectrometryStrains SSY1488 (WT), 1559 (WT+Roq1), 2143 (Dubr1) and 1561 (Dubr1+Roq1) were grown tomid log phase in SCD, diluted to anOD

of 0.05 and treated with 400 nM estradiol for 8 h. Three ODs of cells were harvested and lysed as for western blotting except that

PMSF was omitted. Samples were processed and analyzed on a Q Exactive HF Hybrid Quadrupole-Orbitrap mass spectrometer

as described (Itzhak et al., 2016). Full proteomes from each of the four strains were quantified from four independent biological rep-

licates. Raw files were processed with MaxQuant and searched against the yeast protein database (SwissProt) downloaded from

UniProt. Protein expression levels were quantified and normalized based on their intensities using the MaxLFQ algorithm imple-

mented in MaxQuant software (Cox et al., 2014). Protein groups were filtered to remove hits to the reverse decoy database, proteins

exclusively identified through modified peptides, and common contaminants (with the exception of GFP, which was retained in

the list). Furthermore, only proteins with four normalized label-free quantification values (LFQ intensities) in at least one of the

analyzed strains were retained in the set. 3377 protein groups passed these criteria. Rtn1Pho8*-GFP was not separately added to

the database; rather, the GFP was treated as representative of the whole construct. Since endogenous Pho8 is expressed at low

Molecular Cell 70, 1–13.e1–e5, June 21, 2018 e4


levels, the behavior of detected Pho8 also largely reflects that of Rtn1Pho8*-GFP. In contrast, endogenous Rtn1 is highly expressed,

and hence detected Rtn1 does not reflect the behavior of Rtn1Pho8*-GFP. LFQ intensities were compared to gauge protein expres-

sion differences between strains. Two complementary analyses were carried out, one based on a series of filters, and another

applying imputation of missing values and standardized volcano plot analysis (Tyanova et al., 2016).

(1) Filter-based analysis

To identify proteins that show a similar Roq1-dependent downregulation as Rtn1Pho8*-GFP, we custom-designed a sensitive and

false discovery rate (FDR)-controlled filter analysis. LFQ data were log-transformed to obtain approximately normally distributed

data. For each protein, the difference in expression between WT+Roq1 and WT cells was calculated, and averaged over the four

replicates, to obtain the average (paired) fold change in expression. Candidate hits had ratios < 1 on a linear scale. We chose a

cut-off of < 0.75 based on the change observed in the positive controls, GFP and Pho8. Next, we subjected all differences to a

t test (paired, one-tailed). Proteins then had to pass a variable p value filter (see below). Furthermore, for each protein we calculated

the average paired fold change between expression in Dubr1+Roq1 and Dubr1 cells; proteins were required to show very small

changes (between 0.9 and 1.1 fold). Only proteins passing all three filters were considered candidate hits. For FDR control, we

applied the same filters, but swapped the WT/WT+Roq1 strains with the Dubr1/Dubr1+Roq1 strains (mock dataset). With this

data configuration we did not expect to see any real changes, and hence simulated experimental noise. The FDRwas then calculated

as the number of hits identified with themock dataset, divided by the number of hits obtainedwith the analysis dataset. The FDR level

was controlled by changing the p value cut-off of the t test. P values set to 0.0095, 0.02, and 0.05 resulted in estimated FDRs of 0%,

10%, and 20%, respectively. The positive controls GFP and Pho8 passed as hits at the 0%FDR level. Furthermore, we also evaluated

the fold change between WT and Dubr1 cells to identify proteins that are constitutively regulated by Ubr1.

(2) Imputation-assisted analysis

The above test does not cover proteins that are not identified in all strains. Hence, we performed amore inclusive analysis, with lower

statistical power. We imputed missing values from a normal distribution (downshift 1.8 SDs, width 0.3 SDs). Pairwise comparison of

strains was achieved via a t test (non-paired, two-tailed), with permutation-based FDR control (FDR = 5%, S0 = 0.5), implemented in

Perseus software (Tyanova et al., 2016).

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical details of experiments are listed in the figure legends. The value of n indicates the number of independent experiments.

DATA AND SOFTWARE AVAILABILITY

The accession number for the mass spectrometry proteomics data reported in this paper is ProteomeXchange: PXD008962 via the

PRIDE partner repository. The original data represented in the figures are available from Mendeley Data (https://doi.org/10.17632/

ks6h7p7wbg.1).




shred is a regulatory cascade that reprograms ubr1 ... · dale muzzey, georg h.h. borner, sebastian...

Documents