shoot-applied meja suppresses root nodulation in lotus
TRANSCRIPT
Shoot-applied MeJA Suppresses Root Nodulation in Lotus japonicus. Tomomi Nakagawa, Masayoshi Kawaguchi
*Corresponding author: Tomomi Nakagawa
Laboratory of Plant Physiology, Graduate School of Science, University of Tokyo, Hongo,
Tokyo, 113-0033, Japan.
Tel: +81-3-5841-4458; Fax: +81-3-5841-4458
E-mail: [email protected]
Subject areas: environmental and stress responses, growth and development,
Number of black and white figures: 3
Number of color figures: 2
Number of tables: 0
Running title: MeJA Suppresses Nodulation in Lotus japonicus
Plant and Cell Physiology 2005 The Japanese Society of Plant Physiologists (JSPP); all rights reserved.
Plant and Cell Physiology Advance Access published November 21, 2005 at Pennsylvania State U
niversity on September 12, 2016
http://pcp.oxfordjournals.org/D
ownloaded from
Authors: Tomomi Nakagawa1,2,*, Masayoshi Kawaguchi1,3 1Department of Biological Sciences, Graduate School of Science, The University of Tokyo, 7-3-1
Hongo, Bunkyo, Tokyo 113-0033, Japan 2Research Fellowships of the Japan Society for the Promotion of Science for Young Scientists
(JSPS), Japan Society for the Promotion of Science, 8 Ichi-Ban-Cho, Chiyoda, Tokyo 102-8472
Japan. 3Core Research for Evolutional Science and Technology (CREST), Japan Science and
Technology Agency, 4-1-8 Honcho, Kawaguchi, Saitama 332-0112, Japan
Abbreviations: AUT, autoregulation of root nodulation; SAR: systemic acquired
resistance; ISR, induced systemic resistance; MeJA, methyl jasmonate; MeSA, methyl
salicylate; JA, jasmonic acid; SA, salicylic acid; ET, ethylene
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
Abstract To maintain a symbiotic balance, leguminous plants have a systemic regulatory
system called autoregulation of nodulation (AUT). Since AUT is schematically similar
to systemic resistance found in plant-pathogen interactions, we examined the effects of
methyl jasmonate (MeJA) or methyl salicylate (MeSA) on nodulation in Lotus japonicus.
Shoot-applied MeJA strongly suppressed nodulation in the wild-type and even
hyper-nodulation in the har1 mutant, whereas MeSA exhibited no effect. MeJA
inhibited early stages of nodulation, including infection thread formation and NIN gene
expression, and also suppressed lateral root formation. These findings suggest that
jasmonic acid and/or its related compounds participate in AUT signaling.
Keywords: autoregulation, ISR, MeJA, nodule, SAR, symbiosis
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
Plants survive in the environment amidst a vast amount of microorganisms,
including pathogenic bacteria. To prevent invasions by harmful microorganisms, plants
have evolved various defense systems involving preformed barriers and induced defense
mechanisms. Recognition of invaders by plants triggers induced resistance which is
locally activated at the infection site and also at uninfected tissues to systemically protect
the plant against subsequent attack.
One well-studied phenomenon is systemic acquired resistance (SAR), which
confers systemic resistance against a broad spectrum of plant pathogens and is
characterized by an accumulation of salicylic acid (SA) and pathogenesis-related proteins
(PRs) at the infection sites and in uninfected organs (for a review see Durrant and Dong
2004). The application of SA leads to the activation of SAR (for a review see Malamy
and Klessig 1992). In contrast, expression of a bacterial salicylate hydrolase (nahG)
gene, which inactivates SA by conversion to catechol, prevents the activation of SAR
(Lawton et al. 1995). Therefore, SA is an indispensable and sufficient signal molecule
for SAR induction.
Another kind of induced resistance is known as induced systemic resistance
(ISR) (for a review see Van Loon et al. 1998). A non-pathogenic bacterial strain,
Pseudomonas fluorescens WCS417r, colonizing roots, has been shown to trigger ISR in
the shoots of several plant species. Root colonization of WCS417r in Arabidopsis
systemically prevents the proliferation of pathogenic bacteria such as Pseudomonas
syringae pv. tomato, Fusarium oxysporum and Xanthomonas campestris pv. armoaciae
(Pieterse et al. 2000). Plants unable to accumulate SA by introducing the nahG gene
undergo normal WCS417r-induced ISR, whereas jasmonate (JA)- or ethylene
(ET)-insensitive plant mutants fail to elicit ISR (Pieterse et al. 1996, 2002, Ton et al.
2002), indicating that JA or ET signaling is indispensable for ISR.
Such an ISR-like system is also documented in the symbiotic interaction
between legumes and rhizobia (for a review see Caetano-Anolles and Gresshoff 1991).
In 1984, Kosslak and Bohlool demonstrated that plant resistance induced by rhizobial
infection transmits from infected roots to uninfected roots and prevents further infection
of rhizobia. This systemic regulation program in plants is called autoregulation of
nodulation (AUT; Caetano-Anolles and Gresshoff 1991), and allows leguminous plants
to keep the symbiotic balance by suppressing excessive bacterial invasion as well as
nodulation that consumes a lot of photosynthates. To date, ET has been demonstrated to
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
serve as a negative regulator of rhizobial infection. For example, an ET-insensitive
mutant of Medicago truncatula, sickle, is hyper-infected by its symbionts, Sinorhizobium
meliloti, but the nodulation zone in the sickle root is comparative to that in the wild-type
(Penmetsa and Cook 1997). In contrast, AUT-impaired mutants isolated from pea,
soybean, Lotus japonicus and M. truncatula, can be characterized by a hyper-nodulating
phenotype with a wider nodulation zone (Caetano-Anolles and Gresshoff 1991,
Szczyglowski et al. 1998, Wopereis et al. 2000, Kawaguchi et al. 2002, Penmetsa et al.
2003). Grafting experiments together with split root experiments using
hyper-nodulating mutants indicate that AUT consists of two long-distance signals, a
root-derived signal and an autoregulation signal. The former is generated in roots in
response to rhizobia (especially in response to Nod factors), whereas the latter is
produced in shoots, on receiving the root-derived signal. Recently, the first genes,
HAR1 and NTS1 (NARK), that play a central role in AUT were identified by positional
cloning in L. japonicus and soybean (Krusell et al. 2002, Nishimura et al. 2002, Searle et
al. 2003), however, none of other genes or endogenous signals related to AUT have been
identified.
See Figure 1
Like SAR and ISR, AUT is induced by bacterial infections and consequently
exhibits systemic resistance against bacteria. In addition, it has been reported that L.
japonicus har1 and soybean nts1 mutants were hyper-infected by a parasitic nematode,
Meloidogyne incognita as well as by arbuscular mycorrhizal fungi (Solaiman et al. 2000,
Lohar and Bird 2003, Meixner et al. 2005). These findings led us to speculate that SA or
JA that plays a pivotal role in SAR or ISR may be involved in AUT in legumes. Based
on the schematic similarity among these systemic resistances, we hypothesized that the
mechanism(s) preventing excessive infection of bacteria and excessive nodulation in
AUT may share some common components with SAR and ISR. To test this possibility,
MeSA or MeJA was applied to shoots that are considered to be a primary source of an
unidentified autoregulation signal for nodulation (Caetano-Anolles and Gresshoff 1991).
At first, we examined the effects of MeSA and MeJA on nodulation using L.
japonicus wild-type plants (Gifu B-129). As shown in Fig. 1A, MeSA at 10-4 M and 10-3
M did not show a marked effect on nodulation. In contrast, shoot-sprayed MeJA at 10-4
M and 10-3 M significantly suppressed nodulation (Fig. 1A). Notably, MeJA also
strongly inhibited even the hyper-nodulating phenotype of L. japonicus har1-4 mutant
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
(Fig. 1A and 2), which is a strong allele of har1 with a missense mutation in the LRR
domain of a receptor-like kinase (Nishimura et al. 2002). A dose response analysis
indicated that both wild-type and har1-4 had similar sensitivity to higher concentrations
(10-4 to 10-3 M) of MeJA on nodulation, however, MeJA at lower concentrations (10-6 to
10-5 M) significantly inhibited the formation of nodules in har1-4 than wild-type (Fig.
1B). Since the nodulation of wild-type plants are suppressed by AUT and har1-4 lacks
the AUT signal, lower concentrations of MeJA could be more effective on nodule
suppression in har1 mutants. Jasmonate and its related compounds are also known to
inhibit plant growth, decompose photosynthetic pigments and promote senescence
(Staswick et al. 1992). Nodule suppression by shoot-applied MeJA may be due to its
secondary effect via plant growth inhibition. To address this question, we examined the
effects of MeJA on plant growth and the chlorophyll content. The application of MeJA
(10-6 M to 10-3 M) to the shoots of wild-type plants reduced both shoot and root fresh
weights. In har1-4, MeJA had little inhibitory effect on plant growth at a range of 10-6 M
to 10-4 M (Fig. 1C). In contrast, the same concentrations of MeJA significantly inhibited
nodulation in har1-4. Since the growth of har1-4 was shown to be strongly inhibited by
hyper-nodulation, reduced nodulation might mask the growth defects by MeJA. We also
measured the contents of total chlorophyll after MeJA treatment. The application of
MeJA to shoots of wild-type plants reduced the chlorophyll content in a dose dependent
manner. MeJA ranging from 10-6 M to 10-5 M had apparently no effect in har1-4 (Fig.
1D) but significantly suppressed nodulation. These results suggest that nodule
suppression by MeJA may not be a secondary effect due to plant growth inhibition and
pigment degradation.
See Fig. 2
See Fig. 3
In order to define the stage of nodulation that was blocked by shoot-sprayed
MeJA, wild-type seedlings were inoculated with M. loti NZP2235 carrying the lacZ gene.
In wild-type plants without MeJA treatment, root hair curlings with infection foci
(bacterial colonization), infection threads and nodule primordia illuminated by blue
staining were found 5 days after inoculation (Fig. 3A and B). When MeJA was applied
at 10-4 M, root hair curling, infection threads and nodule primordia formation were
significantly reduced (Fig. 3C). Notably, the application of MeJA at 10-3 M almost
entirely blocked root hair deformation and curling. These results indicate that
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
shoot-applied MeJA inhibits early stages of bacterial infection as well as nodule
initiation. NIN encodes a putative transcriptional regulator required for infection thread
formation and inception of the nodule primordia. NIN is also known as one of the early
nodulin genes rapidly induced in response to Nod factors. The effects of MeJA
application on the expression of NIN after M. loti inoculation were examined (Fig. 4). In
our experimental conditions, NIN expression was highly induced at 14 hours after M. loti
inoculation in mock-treatment plants. Application of MeJA at 10-4 M reduced the
transcript level of NIN by 50% up to 40 hours following inoculation, and at 10-3 M
reduced the level by 15% in the same period. At 72 hours after inoculation, the
expression of NIN was transiently suppressed in the roots of mock-treatment plants
possibly by the action of AUT. The transcript level of NIN was fully recovered at 135
hours after inoculation, whereas, MeJA at 10-3 M still suppressed the NIN expression.
These data suggest that the inhibition of infection and nodule formation by MeJA occurs
upstream of the induction of NIN transcripts.
See Fig. 4
The lateral root is a postembryonic organ that develops endogenously, like the
root nodules. In the absence of rhizobia, har1 develops short primary roots with an
increased number of lateral roots (Szczyglowski et al. 1998, Wopereis et al. 2000,
Kawaguchi et al. 2002). Under our growth conditions, har1-4 plants formed slightly
more lateral roots than the wild-type 20 days after sowing (Fig. 5A and B). The
exogenous addition of MeJA to the shoots reduced the number of lateral roots in a dose
dependent manner in both the wild-type and har1-4 plants. Depending on the increase in
MeJA concentration, the growth of primary roots was also inhibited (Fig. 5C). The
growth of the primary root in wild-type plants was more sensitive to MeJA than har1-4,
whereas the formation of lateral roots in har1-4 was more sensitive to MeJA than
wild-type plants. Interestingly, the application of MeJA at 10-4 M reduced the number of
lateral roots by 50% whereas only a 10% reduction was found in the growth of primary
roots of har1-4 plants. These results indicate that shoot-applied MeJA does not recover
the short primary root phenotype of har1-4, but rather that increased lateral root
formation is restored.
See Fig. 5
On the basis of schematic similarity among SAR, ISR and AUT signaling, we
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
hypothesized that MeSA or MeJA may be involved in the systemic regulation of
nodulation. Paying attention to a current model in which the AUT signal is produced in
the shoots and then transmitted to the roots, we applied these substances to the aerial
portion of plants. As a result, MeJA, but not MeSA, exhibited a strong inhibitory effect
on nodulation. The effect could be observed even in the har1 hyper-nodulating mutant.
In addition, MeJA also inhibited lateral root initiation. These findings indicate that
HAR1 may possibly mediate the systemic regulation of nodule and lateral root
development via activation of the production of endogenous JAs in the shoots. Since
JAs have a vital role in ISR and systemic wound signaling to suppress subsequent
invasion, it is possible that JA and/or its derivatives act as an AUT signal.
One way to examine this hypothesis is to compare endogenous JAs between the
wild-type and the har1 mutant during the rhizobial infection process. It should be noted,
however, that the analysis of endogenous JA and ET levels in the leaves of
ISR-expressing plants revealed no changes in the production of these signal molecules
(Pieterse et al. 2000). In addition, Verhagen et al. surveyed the transcriptional response
of over 8,000 Arabidopsis genes none of which showed an altered expression pattern in
the leaves of ISR-induced plants (Verhagen et al. 2004). Therefore, we consider that
isolation of JA-deficient and -insensitive mutants and/or treatment of wild-type plants
with a JA-biosynthetic inhibitor that was developed recently would be promising way to
investigate involvement of JA signaling in nodulation and ISR studies. Finally, it should
be noted that the effect of JA on nodulation contrasts with that on tuber formation in
potato, which is positively regulated by JA-derivatives such as tuberonic acid and its
glucosides (Koda et al. 1988; Yoshihara et al. 1989).
Materials and Methods In our all experiments, surface-sterilized seeds of L. japonicus B-129 Gifu and
har1-4 were sown into sterile plastic growth boxes with sterilized? vermiculite moistened
with liquid B&D medium with or without 0.5 mM KNO3. All plants were grown in a
Biotron LH-100 (Nihon Ika Co., Ltd., Japan) under a 16-h light (100 uEm-1s-2)/8-h dark
cycle at 23ûC. Rhizobia inoculation was performed as previously described (Nishimura
et al. 2002). For treatments, one ml of MeJA (Wako, Japan) or MeSA (Wako, Japan)
diluted in 10% ethanol was sprayed to shoots at indicated concentrations. Chlorophyll
content was quantified by the method of Kirk and Allen (1965). Quantification of
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
infection events was examined according to the method of Wopereis et al. (2000).
Total RNAs were isolated using RNeasy Plant Mini Kit (Qiagen, Japan).
Following DNase I treatment, reverse transcription was carried out with QuantiTect
Reverse Transcription Kit (Qiagen, Japan). Semi- quantitative PCR was performed on
an ABI PRISM® 7000 Sequence Detection System (Applied Biosystems) using
QuantiTect� SYBR® green PCR kit (Qiagen) to amplify the target transcripts from
diluted cDNA. Sample volumes were normalized for equal amplification of DNA
fragments with primers specific for ATP synthase gene (AW719841). It was reported
that ATP synthase has a constitutive expression profile (Radutoiu et al. 2003). PCR
cycling conditions comprised an initial denaturation step at 95ûC for 15 min followed by
40 cycles at 94ûC for 15 s, 60ûC for 30 s, and 72ûC for 45 s. The primers used for
transcript amplification were: LjATPsyn-F, 5'- ACATGCTTGCACCATACCAA -3';
LjATPsyn-F, 5'- TCCCCAACTCCAGCAAATAC -3'; LjNIN1-F, 5'-
CAATGCTCTTGATCAGGCTGTTGA -3'; LjNIN1-R, 5'-
GAGTGCTAATGGCAAATTGTGTGTC -3'. Melting curve analysis was used to
determine their identity.
Acknowledgments We thank Yuko Ohashi and Shigemi Seo for helpful advice; Hiroshi Kouchi
and Asuka Kuwabara for advice and comments on the manuscript. This work was
carried out with support by the Core Research for Evolutional Science and Technology
(CREST) fund, Reserch Fellowships from the Japan Society for the Promotion of Science
for Young Scientists, and the Special Coordination Funds for Promoting Science and
Technology from the Ministry of Education, Culture, Sports, Science and Technology,
Japan.
References
Caetano-Anolles, G. and Gresshoff, P.M. (1991) Plant genetic control of nodulation. Annu.
Rev. Microbiol. 45: 345-382.
Durrant, W.E. and Dong, X. (2004) Systemic acquired resistance. Annu. Rev. Phytopathol.
42: 185-209.
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
Kawaguchi, M., Imaizumi-anraku, H., Koiwa, H., Niwa, S., Ikuta, A., Syono, K. and
Akao, S. (2002) Root, root hair, and symbiotic mutants of the model legume Lotus
japonicus. MPMI 15: 17-26.
Kirk, J.T., Allen, R.L. (1965) Dependence of chloroplast pigment synthesis on protein
synthesis: effect of actidione. Biochem. Biophys. Res. Commun. 21: 523-530.
Krusell, L., Madsen, L.H., Sato, S., Aubert, G., Genua, A., Szczyglowski, K., Duc, G.,
Kaneko, T., Tabata, S., de Bruijn, F., Pajuelo, E., Sandal, N. and Stougaard, J. (2002)
Shoot control of root development and nodulation is mediated by a receptor-like kinase.
Nature 420: 422-426.
Koda, Y., Omer, E.-S.A., Yoshihara, T. Shibata, H., Sakamura, S. and Okazawa, Y.
(1988) Isolation of a specific tuber-inducing substance from potato leaves. Plant Cell
Physiol. 29: 1047-1051.
Kosslak, R.M. and Bohlool, B.B. (1984) Suppression of nodule development of one side
of a split root system of soybeans caused by prior inoculation of the other side. Plant
Physiol. 75: 125-130.
Lawton, K., Weymann, K., Friedrich, L., Vernooij, B., Uknes, S. and Ryals, J. (1995)
Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene.
MPMI 8: 863-870.
Lohar, D.P. and Bird, D.M. (2003) Lotus japonicus: A new model to study Root-Parasitic
Nematodes. Plant Cell Physiol. 44: 1176-1184.
Malamy, J. and Klessig, D.F. (1992) Salicylic acid and plant disease resistance. Plant J. 2:
643-654.
Meixner, C., Ludwig-Muller, J., Miersch, O., Gresshoff, P.M., Staehelin, C. and
Vierheilig, H. (2005) Planta: Online published only at on Sept. 1, 2005
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
Nishimura, R., Hayashi, M., Wu, G.-J., Kouchi, H., Imaizumi-Anraku, H., Murakami, Y.,
Kawasaki, S., Akao, S., Ohmori, M., Nagasawa, M., Harada, K. and Kawaguchi, M.
(2002) HAR1 mediates systemic regulation of symbiotic organ development. Nature 420:
426-429.
Penmetsa, R.V. and Cook, D.R. (1997) A legume ethylene-insensitive mutant
hyperinfected by its rhizobial symbiont. Science 275: 527-530.
Penmetsa, R.V. Frugoli, J.A., Smith, L.S., Long, S.L. and Cook, D.R. (2003) Dual genetic
pathway controlling nodule number in Medicago truncatula. Plant Physiol. 131:
998-1008.
Pieterse, C.M.J., van Pelt, J.A., Ton, J., Parchmann, S., Mueller, M.J., Budhala, A.J., M é
traux, J.P. and van Loon, L.C. (2000) Rhizobacteria-mediated induced systemic
resistance (ISR) in Arabidopsis requires sensitivity to jasmonate and ethylene but is not
accompanied by an increase in their production. Physiol. Mol. Plant Pathol. 57: 123-134.
Pieterse, C.M.J., van Wees, S.C.M., Ton, J., van Pelt, J.A. and van Loon, L.C. (2002)
Signaling in rhizobacteria-induced systemic resistance in Arabidopsis thaliana. Plant
Biol. 4: 535-544.
Radutoiu, S., Madsen, L.H., Madsen, E.B., Felle, H.H., Umehara, Y., Grenlund, M., Sato,
S., Nakamura, Y., Tabata, S., Sandal, N. and Stougaard, J. (2003) Plant recognition of
symbiotic bacteria requires two LysM receptor-like kinases. Nature 425: 585-592.
Searle, I.R., Men, A.E., Laniya, T.S., Buzas, D.M., Iturbe-Ormaetxe, I., Carroll, B.J. and
Gresshoff, P.M. (2003) Long-distance signaling in nodulation directed by a
CLAVATA1-like receptor kinase. Science 299: 109-112.
Solaiman, M.Z., Senoo, K., Kawaguchi, M., Imaizumi-Anraku, H., Akao, S., Tanaka, A.
and Obata, H. (2000) Characterization of mycorrhizas formed by Glomus sp. on root of
hypernodulating mutants of Lotus japonicus. J. Plant Res.: 113: 443-448.
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
Staswick, P.E., Su, W. and Howell, S.H. (1992) Methyl jasmonate inhibition of root
growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant.
PNAS 89: 6837-6840.
Szczyglowski, K., Shaw, R.S., Wopereis, J., Copeland, S., Hamburger, D., Kasiborski, B.,
Dazzo, F.B. and de Bruijn, F.J. (1998) Nodule organogenesis and symbiotic mutants of
the model legume Lotus japonicus. MPMI 11: 684-697.
Ton, J., de Vos, M., Robben, C., Buchala, A.J., M é traux, J.-P., van Loon, L.C. and
Pieterse, C.M.J. (2002) Characterisation of Arabidopsis enhanced disease susceptibility
mutants that are affected in systemically induced resistance. Plant J. 29: 11-29.
van Loon, L.C., Bakker, P.A. and Pieterse, C.M.J. (1998) Systemic resistance induced by
rhizosphere bacteria. Annu. Rev. Phytopathol. 36: 453-483.
Verhagen, B.W.M., Glazebrook, J., Zhu, T., Chang, H.-S., van Loon, L.C. and Pieterse,
C.M.J. (2004) The transcriptome of rhizobacteria-induced systemic resistance in
Arabidopsis. MPMI 17; 895-908.
Wopereis, J., Pajuelo, E., Dazzo, F.B., Jiang, Q., Gresshoff, P.M., de Bruijn, F.J.,
Stougaard, J. and Szczyglowski, K. (2000) Short root mutant of Lotus japonicus with a
dramatically altered symbiotic phenotype. Plant J. 23: 97-114.
Yoshihara, T., Omer, E.-L.A., Koshino, H., Sakamura, S., Kikuta, Y. and Koda, Y.
(1989) Structure of a tuber-inducing stimulus from potato leaves (Solanum tuberosum
L.). Agric. Biol. Chem. 53: 2835-2837.
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
Fig. 1 Effect of MeJA on nodulation in Lotus japonicus. (A) Wild-type Gifu and
har1-4 plants were inoculated with M. loti MAFF30-3099 and then sprayed with MeJA or
MeSA on the aerial portion of seedlings 2 and 6 days after inoculation. (B) MeJA effect
on nodulation. MeJA was sprayed 1 day before, and 1 and 6 days after inoculation.
Fresh weight (C) and the chlorophyll content (D) of plants shown in (B) were determined.
Plants were harvested at 12 days after inoculation. Values shown represent the mean ±
standard deviation (SD) of at least 10 seedlings. Open bar: wild-type, solid bar: har1-4.
Fig. 2 MeJA suppressed the hyper-nodulation phenotype of har1-4 roots. Wild-type
(A) and har1-4 (B and C) plants were inoculated with M. loti NZP2235 carrying the lacZ
gene. The aerial portion of these plants was sprayed with mock (A and B) or 10-4M
MeJA 1, 5 and 8 days after inoculation. Plants were harvested 10 days after inoculation.
Bar: 1cm.
Fig. 3 MeJA effect on early nodulation response. Wild-type plants were inoculated
with M. loti NZP2235 carrying the lacZ gene and shortly after, aerial portions of seedlings
were sprayed with MeJA. Plants were harvested 5 days after inoculation. The number
of curled root hairs (A), infection threads (B, arrowhead) and nodule primordia (B) were
counted (C). Bar: 50 μm in (A) and 200 μm in (B). Hac: root hair curling, IF:
infection thread, NP: nodule primordia. Values shown represent the mean ± SD of at
least 10 seedlings.
Fig. 4 Effect of MeJA on expression of NIN. Wild-type plants were sprayed with mock
(open bar), 10-4 M (solid bar) or 10-3 M (shaded bar) of MeJA 24 hours prior to and 0 and
72 hours after M. loti inoculation. Results are shown as fold increase compared to roots
at time zero. Values shown represent the mean ± SD of three experiments.
Fig. 5 MeJA effect on lateral root formation under non-symbiotic conditions. Plants
were grown in B&D medium containing 0.5 mM KNO3 for twenty days, and then
harvested. MeJA was sprayed 7, 12 and 17 days after germination. Values shown
represent the mean ± SD of at least 10 seedlings. (A) Photograph of MeJA-treated roots.
Bar: 1 cm (B) Effect of MeJA on lateral root formation. (C) Effect of MeJA on primary
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
root growth. Open bar: wild-type, solid bar: har1-4.
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from
at Pennsylvania State University on Septem
ber 12, 2016http://pcp.oxfordjournals.org/
Dow
nloaded from