When Peggy Harmann was thir-teen, she realized there was more to life. She asked her

grandparents to take her to church with them. She became a Christian at a little country church, and the church became her spiritual family. She began working for a Fortune 500 company while in high school and continued there for 32 years. During that time, she was blessed with a wonderful husband, Jeff, and kids (now adults) Joey and Elizabeth. She received her bachelor’s degree and advanced in the company through various roles,

travelling the world and gaining a variety of skills.

Peggy started attending the Seminary with online classes and driving to classes once a week and was finding it to be a ful-filling experience—a lifelong dream. One day she and Jeff realized God was calling them to some changes from their long-time corporate jobs. To make some deci-sions about specific ministries in which to be involved, they drove to Niagra Falls on a retreat and studied the book, 48 Days to Work You Love. God spoke to

Bringing Hope to the

Hopeless

Continue on page 3

2

Greetings alumni and friends:

You and I are painfully aware of the economic situation our country has been in for an extended season now. Has the seminary gone unscathed by the economic downturn? No. Has the seminary good news to share during this difficult time? Yes.

Just as Charles Dickens in his famous Tale of Two Cities said, “It was the best of times; it was the worst of times. . .” We have good news, and we have profound challenges.

GOOD NEWS

*The seminary continues to proclaim the Wes-leyan Pentecostal message without compromise.

*While other seminaries have seen hundreds of thousands of dollars of loss (and some have experienced the loss of millions) in their endow-ments, we have not lost one cent, and to the con-trary, our endowments have grown.

*We continue to hear stirring stories about our graduates making a difference in the United States and around the world. This newsletter shares one such story on the cover page.

*We just finished an accreditation process with the national and regional accrediting bodies that review us in detail. They were very complimen-tary about our work and something very rare hap-pened. There were no findings/notations against us after their thorough review.

*The Holy Spirit is moving deeply in our cha-pel services. I invite you to visit our web site at www.ptseminary.edu and hear highlights of some of our chapel services.

*We continue to have effective, dedicated long-term professors in the classroom.

*With sacrifice and great care, we have bal-anced our budget every year for many years.

*The Church of God of Prophecy has recently named us as their official seminary.

*We continue to meet enrollment goals.

*Each year, we provide more scholarships than the year before.

PROFOUND CHALLENGES

*Due to reduction in funds sent to Church of God World Missions by local churches, we have been informed that it is necessary for World

Missions to phase out sponsorship of students brought to the Seminary from around the world. This year, we will lose $44,416.00 in funding which means one less student is here this year and fur-ther reductions of students from around the world will take place over the next four years. Read the story on page 14 of the student who would have come this year to the seminary if the funding had not been cut back. In addition, there is a waiting list of potential global leaders who need financial assistance to attend the Seminary in the future.

*A number of students from across the U.S. looked forward to starting their educational jour-ney at the seminary this semester, but even with the scholarships we could give them, they had to delay their education in order to raise additional funds.

*Because of the reduction in funds sent to de-nominational headquarters by our churches, we have seen a gradual cut in monies provided to us by the denomination in the amount of $415,000.00 over the last two years. This has meant we have had to do more with less, and at times, even less with less.

LOOKING AHEAD WITH FAITH

Each student that comes to the seminary is better grounded in Pentecostal theology. Each student that graduates from the seminary is mak-ing a difference where God sends them. THAT IS GOOD NEWS! We are doing a good work, and we are thankful to God that we can rely upon his promise in 2 Corinthians 9:8:

And God is able to make all grace abound toward you, that ye, always have all suf-ficiency in all things, may abound to every good work.

I firmly believe that no student should be pre-vented from coming to the seminary because of finances. That is a goal of mine. Some people tell me it is unrealistic, but I believe you and I want to make a difference, and we will join together to make it a reality through our giving. With a ma-jor reduction in denominational funding over the last few years, and the potential for more to come, we rely even more upon you as our partner in the significant work of our seminary.

Steven Jack Land

President & Professor of Pentecostal Theology

Has the seminary

good news to share during this difficult

time? Yes!

3

Want to Sharpen Your

Leadership Gifts?

“The Doctor of Ministry pro-gram at the Pentecostal Seminary is a 30-hour program that offers the opportunity to receive doc-toral level training in the practice of ministry. Students have focused their DMin via their electives, proj-ect, dissertation and other work in areas in pastoral ministry, coun-seling, chaplaincy, administration, missions, ministry education, dis-cipleship and Christian formation, and other areas.

The DMin emphasizes academic and ministry work in the student’s ministry context, with two-weeks in October each year on the main campus for three years. Students represent various parts of the Unit-ed States and several parts of the World. Core work includes Theol-ogy, Bible, Administration, Con-flict Resolution, and other areas.”

them about specific ministries in which to pour their gifts and talents; two of those were Native American ministries and local food ministry. They retired in December 2008 to move into these ar-eas of service.

Peggy serves as Children’s Pastor at East Sparta Church of God. Peggy researched the demographics of their local community and found that ap-proximately 50% of the local children were on free or reduced lunch. She also discovered that teachers were hav-ing to provide clothing and food for many children, sending food home in their backpacks on Fridays. Peggy and Jeff initiated a program of feeding hot meals at their church to approximately 200 people each week. Now, not only are community children being served on Wednesday evenings at the church, but church members are interacting and ministering to the families as well thanks to a great team of volunteers and a caring local church! A plan has been drafted to expand the meal ministry, potentially with various partners.

In 2008, Peggy and Jeff met Johnny Hughes and Indian Ministries North America (IMNA) which is a multi-de-nominational ministry that also receives support from the Church of God. This ministry has a youth mentoring and leadership program. The last two years, IMNA took a group of First Americans youth ministering across America. This summer one stop was the Pine Ridge, South Dakota reservation, one of the poorest areas in the USA, where there were many child/teen suicides each week.

Into this area where there is no hope, INMA carried the message of hope. They held concerts and worked in street ministry. They worked on providing a culturally relevant message, and devel-oping Christian leaders from the youth participating in the mentoring program. Among her summer ministry experi-ences, Peggy and Jeff spent two weeks in Arizona and New Mexico ministering in service at Southwest Indian Ministry of the Church of God. They helped with youth and kids camps, did some teach-ing, and helped with food preparation.

Peggy’s desire is to see the First Americans youth appreciating their culture while embracing the hope of Christ.

“I am thankful for a seminary that guides

those who are listening for His voice and

prepares those who hear to do His will.”Just as many students who come to

PTS, Peggy has a heart of compassion for the lost and those whose lives feel destitute and hopeless. By attending the Seminary and participating in the com-munity of faith on the campus, Peggy was supported and encouraged by fac-ulty and students to continue to pursue her call to ministry. Peggy shared: “The faces of Native American children who live in extreme poverty will not leave my mind. Remembering the smiles of those who have accepted Jesus Christ encour-ages me as I have asked God to lead me into how I am to continue to minister to the needy children and to Native Amer-icans. I know I will continue making a difference, and the seminary has played a crucial role in preparing me for effec-tive ministry. I am thankful for a semi-nary that guides those who are listen-ing for His voice and prepares those who hear His voice to do His will.”

There are many others who, like Peggy, have a dream of giving hope to the hopeless, but they are not able to attend the Seminary due to finan-cial need. Others have to take a break from their studies while they find a way to finance another semester at the seminary. Your gifts to support minis-terial training at the seminary pave the way for students to step onto a path of providing hope to the hopeless and into a life of making a significant difference in the lives of others.

Contact the Department

of Ministries today to apply for admission.

1-800-228-9126

Continued from page 1

4

KENNETH ARCHER, Ph.D.

Kenneth Archer is Associate Pro-fessor of Theology at the Seminary. Prior to joining the faculty in 2001, he served as adjunct faculty for 5 years at Ashland Theological Seminary and was pastor of Mohicanville Commu-nity Church. He and his wife, Melissa, have two sons, Trent and Tyler. Melis-sa is adjunct faculty at the Seminary,

teaching New Testament Greek.

Dr. Archer has published another monograph entitled A Pentecostal Hermeneutic: Spirit, Scripture and Community (CPT Press, 2009). It is another important contribution to Pentecostal hermeneutics. This book is available through Amazon.com.

CORKY ALEXANDER

Corky Alexander (99) defended his dissertation

entitled “Inter-tribal Pentecost: Praxis Transforma-

tion in Native American Worship” on January 5,

2010 at Fuller Theological Seminary, School of In-

tercultural Studies. He graduated in June with his

D.Miss. Dr. Alexander is adjunct faculty at PTS and

Patten University (Oakland, CA). He serves as direc-

tor of instruction at Bradley Cleveland Services in

Cleveland, TN.

Corky is married to Dr. Kimberly E. Alexander

(95), Associate Professor of Historical Theology and

Assistant Dean for Student Assessment at PTS. They

have three daughters: Hope, Emma, and Leslie, and

two grandsons, Lex and Cole.

Congratulations Dr. Alexander!

KIMBERLY E. ALEXANDER, Ph.D.

Dr. Kimberly Alexander was busy representing

PTS during the month of June. She attended the ATS

meeting in Montreal in conjunction with the CAOS

(Chief Academic Officers Society) meeting. She pre-

sented a paper entitled “The Pentecostal Healing

Community” at the University of Bangor’s (Wales)

Pentecostal Ecclesiology Conference and made a

presentation on Pentecostal historical theological

method at a post-graduate seminar at the University

of Birmingham (UK).

LEE ROY MARTIN, D.Th.

Dr. Lee Roy Martin has published a new and exciting study of the book of Jonah. Written for adults and ar-ranged in five lessons, the work in-cludes a thorough study of Jonah, a teacher’s outline, student handouts, and study questions. The format al-lows the study to be used by an indi-vidual, in a small group, or in a church

class. The book is available for order by calling Path-way Press (1-800-553-8506). Powerpoint presen- tations to accompany the study are downloadable from the following web-site: http://web.me.com/lrm777/Jonah/Home.html.

D Th

vivivivivividududududualalalalal,, , , , ininininin aa a s s smammall group, or invvvvvv

5

CHERYL BRIDGES JOHNS, Ph.D.

Cheryl Bridges Johns was on sab-batical during the spring 2010 school term. She spent the semester in New York City researching the archives of Wilbert W. White, the father of the inductive method of Bible study. She is currently writing an updated book on the inductive method, revising and modifying it for the 21st century. Look for more information on the re-lease of her new book.

Ken Davis Joins the Administration

Ken Davis has just joined the seminary as Vice President for Institutional Advancement. Ken is a graduate of Kent State Uni-versity and Duke Law School. He practiced law for 20 years in Akron, Ohio, before God called him into the ministry as associ-ate pastor at Canton Temple of

Praise in Canton, Ohio. He served in that role for four years before being appointed as Assistant Di-rector of Stewardship Ministries for the Church of God. After three years in that position, he was appointed Director of Stewardship Ministries and served in that position for six years before he ac-cepted the offer of the seminary to work here.

Ken served on the seminary board for four years and has had a connection with the seminary for over 20 years (he served for many years on the Steward-ship Commission). He has been a friend to many of our professors and staff for many years, and we are enjoying having him with us and laboring with us.

When asked about his new position, Ken related, “I want to be responsive to God’s will for my life. The decision to come here was made after much prayer and fasting. The seminary is one of the best things happening in the Church of God. I have been a big fan from the first time I visited the seminary over 20 years ago. The seminary is crucial to the work of the Church of God. I am honored and humbled by the opportunity to help the seminary as it teaches and guides those called into ministry. It is my goal to establish long-term relationships and partnerships with our students, alumni, donors, faculty and staff.”

Ken’s wife, Debbie, is the administrative assis-tant to Dr. Lamar Vest who is the president of the American Bible Society. Ken and Debbie have been married for 31 years and have a son, Daniel, who is studying at Ohio State to be a teacher.

Ken can be reached at 423-478-7707

and kdavis@ptseminary.edu.

1. Go to www.ptseminary.

edu/Alumni & Friends

2. Update your contact in-

formation

3. One individual will be

entered into a drawing to

receive a free Kindle, and

five will receive a recent

faculty publication.

1. Go to www.ptseminary.

ni & FriendsUpdate and Win!

6

70’S

MARVIN WOODS (76) pastors the Bolivar (TN) COG. They have three sons: Mark, Kevin, and Galen; seven grandchildren and 4 great-grandchildren. Marvin and Jane are actively involved with Men and Women of Action and are presently involved in building a parson-age for their church.

80’S

MICHAEL COOPER (82) pastors the Lynnville COG (IA). His family enjoys the rural setting and min-istering within their community. Pray for the congrega-tion as they consider adding additional space. Michael and Brenda have three sons: Michael II, Erik and Hansel.

ENRIQUE ORELLANA (82) is pastoring the old-est Hispanic Church of God in the USA, Fuente de Vida Christian Center, founded in 1938 and joined with the COG in 1941. He and Denise have been married since 1979 and have two children: Noelia Celeste and Israel.

JOHN RENFRO (82) is an ACPE Supervisor (Candi-date) in Conway, SC. They recently graduated their sec-ond Level 1 CPE group.

JOHN AITON (83) is full-time police offer and de-partment chaplain for the Rock Hill (SC) Police Dept and SC state chaplain for the Fraternal Order of Police. He attends the Fort Mill COG.

STEPHEN HALL (84) has pastored Bilton Evangeli-cal Church in Rugby, England for 19 years. The church is beginning a coffee shop for the community. He serves the Manna House Counseling Service in Northampton, England as a lecturer and has just completed a post-graduate advanced diploma in CBT with Derby University.

RONALD HOUSE (85) is current-ly raising his budget to go to Zambia, Africa.

LANE LAVENDER (87) is senior pastor of Union Road COG (Gasto-nia, NC).

LLOYD (86) and Edna FRAZIER were appointed as missionaries to Haiti in 1982 where they served for 22 1/2 years. Brother Frazier was in Haiti on the day of the earthquake with Lovell and Virginia Cary. He shares, “God was good in keeping us through the earthquake.” Since then he has been asked to serve on a committee with Hugh Carver, Director of MWOA, and Richard Baker, Projects Coordinator--Worldwide, to help in co-ordinating the reconstruction in Haiti. “I count it a privi-lege to be able to serve the people in Haiti.”

JOHN TIPEI (87) is rector/president of the Pente-costal Theological Institute (Bucharest, Romania).

R.C. HUGH NELSON (89) is senior pastor of the Church of God of East Flatbush; president of Gayle Academy for Children, Inc.; president of Hope Center Development Corp.; board member of the COG divi-sion of education; chaplaincy coordinator for New York COG; and trustee, Brookdale University Hospital & Medical Center.

THOMAS ROSSON (89) is a missionary with Church of God World Missions serving as education di-rector in Central and Eastern Europe and CIS, president of the Eurasian Theological Seminary (Moscow), and president of the Bulgarian Theological College.

90’S

MICHAEL ARP (90) is senior pastor of Family Faith Ministries (Charlevoix, MI). He is married to Carla and they have three sons: Dustin, Caleb and Brandon.

7

PAMELA KAY OVERBEY published her book, After Divorce...What Do I Do With Me?, in November 2009 through Derek Press. Pamela Kay is a cur-rent student at the Seminary and works for the International Department of Women’s Ministries with the Church of God. Her book can be purchased on Amazon.com. The book deals with the aftermath of divorce and gives prin-ciples for recovery.

GENE (98) and RUTH (98) BORDEAUX were dis-placed from Louisiana following Hurricane Katrina and relocated to Knoxville, TN where he works as an addic-tion counselor at Behavioral Health Group Knoxville Medical Clinic.

MICKEY JETT (90), is an Army chaplain and is en-rolled in the DMin program at Erskine Theological Sem-inary.

Chaplain (Lieutenant Colonel) JOSEPH MELVIN (90) is director of the chaplain Family Life Center at Fort Bragg, NC with the Army.

TIM CRANFILL (91) is director of pastoral care, Southeast Baptist Hospital, clinical pastoral education faculty for Baptist Health System, and clinical member of the South Texas Sexual Assault Response Team for Methodist Specialty and Transplant Hospital, all in San Antonio, TX. He completed his D.Min. in 2004.

STEPHEN HARMON, Jr. (91) serves the U.S. Mili-tary Ministry of the Navigators as a Navigator Associate. He is on active duty with U.S. Army as a Retiree Recall and is assigned to Human Resources Command in Alex-andria, VA.

NEIL (91) and Jennifer LAWRENCE serve as mis-sionaries with Church of God World Missions. Their main ministry is teaching at Discipleship College (Eldo-ret, Kenya). They also have open-air evangelism with the Eagles’ Wings Gospel Team whose goal is to “Disciple Africans to reach Africa—through teaching, preaching and music.”

TERRY SIMMONS (91) is an active duty army chap-lain serving at Fort Jackson, SC at the US Army Chaplain Center and School.

RAY HURT (92) graduated from Asbury Theological Seminary with his D.Min. in 1995. He and his wife, Car-olyn, have served as senior pastor of Princeton Church of God in West Virginia since 1992.

JOSEPH PHILLIP MILLER (92) serves as full-time clinical chaplain for the NC Department of Corrections at the Mountain View Correctional Institution, serves on the chaplain’s steering committee of the NC Dept. of Corrections, and senior pastor of Higher Ground Wor-ship Center (Pineola, NC).

CHRISTIAN C. SANDRU (92) is a chaplain/spiritu-al and religious director with the city of Toronto, Kipling Acres. He assists the Eastern Ontario COG State Office with preaching and counseling.

US Army Chaplain (MAl) STEVEN CANTRELL (93) took part in recent ceremonies at Fort Benning, Georgia, at the national dedication of the 173d Airborne Brigade Memorial, honoring the service and sacrifice of those who proudly wore the Sky Soldier patch on their uniform. Chaplain Cantrell gave the benediction follow-ing the wreath laying to honor the fallen soldiers of the 173d. Steve and his wife, Katherine, make their home in New York where he is currently assigned to the 10th Mountain Division at Fort Drum.

AL TAGAYUNA (93) went to Hawaii following his graduation from the Seminary. The purpose was to plant a Filipino church, but they have now planted two growing congregations. One church has a building and the other meets in a rented facility. Pray that God will provide the finances and location in which the second church may worship.

ELOY (94), VIRGINIA (97) and Zoe NOLIVOS headed northeast to Harvard where Virginia will work on a Master of Education in Human Development and Psychology. She states, “I am very excited and looking forward to this experience and the wealth of knowledge that will be at my fingertips.”

rr--ks f

h

EAUX were dis

CCCC

SSooo

ca

8

DONALD and TRUDY A. PRATT (94) are in pasto-ral ministry in Hixson, TN where they are founders and co-pastors of Armour of Faith Ministries (www.Armou-roffaith.net). Trudy has taught at the extension of Lee University in Ghana, W. Africa for 4 semesters. While there, she evangelized in Ghana and Nigeria, and minis-tered at several national conventions and women’s con-ferences. Both Donald and Trudy are volunteer chap-lains at Memorial Northpark Hospital in Hixson, TN. They have two sons and one grand-daughter.

MARVIN LEON ELLIS (95) pastors Zion’s Temple Church of God in Canton, GA. He earned his Th.D. from Andersonville Baptist Seminary after graduating from the PTS.

SILVIO ROBERTO RIBEIRO (96) is the Church of God national overseer of Brazil.

SAMUEL SADE (96) is pastor for Christian Educa-tion at Lighthouse Christian Community, Muntinlupa City, Philippines. He teaches part-time at the Asian Seminary of Christian Ministries (OT).

D. E. (GENE) MILLS, Jr. (97) was recently appointed to serve as the director of Discipleship College in El-doret, Kenya, East Africa. While raising his budget, he serves on faculty at the University of Tennessee - Chat-tanooga (Philosophy and Religion Department) and Lee University (CAPS program).

JAMES P. WARD, Jr. (97) is an Army chaplain serving with the 1-21 Field Artillery, Fort Hood, TX. He is credentialed with the Pentecostal Holiness Church.

GENE (98) and RUTH (98) BORDEAUX were dis-placed from Louisiana following Hurricane Katrina and relocated to Knoxville, TN where he works as an addic-tion counselor at Behavioral Health Group Knoxville Medical Clinic.

ROBERT PROCTOR (98) graduated with his D.Min. from Azusa Pacific University in 2007. He is senior pas-tor of Southwest Christian Center COG (Bakersfield, CA), critical incident chaplain with the Bakersfield Fire Department, staff chaplain of the San Joaquin Commu-nity Hospital, assistant chair for the Kern County Criti-cal Incident Response Teams, and trauma-critical inci-dent instructor for the Kern County medical reserve corps.

DAVID W. FLEENOR (99) was re-cently certified as an Associate Super-visor with the Association for Clinical Pastoral Education (ACPE). He is the Manager of Pastoral Care and Edu-cation at New York University Lan-gone Medical Center, a partner institution of Health-Care Chaplaincy. He also serves as an assistant priest at Church of the Transfiguration (Episcopal).

ROB (99) and Rhonda MISKOWSKI joined the lead-ership of the Louisiana Church of God State Executive Offices as the Youth and Christian Education Director in November 2009. They have two chil- dren: Arianna and Elijah.

t tititi fffff HHHHHH llllllllthththththththth

9

00’S

TONY (01) and LaShea COLSON pastor City on a Hill Church (Knoxville, TN). They have three girls: Ki-era, Makena, and Aliyah.

RAQUEL ECHEVARRIA (01) is president of the Caribbean Theological College in Puerto Rico which is an Assemblies of God school.

DAVID OFORI (01), college president of the Pan Af-rican Theological College, a Church of God Bible school in Winneba, Ghana, Africa, and another staff member were attacked and robbed at gun point by a gang of men. Three female students became victims of the vio-lence and were abused. Violence and abuse (especially of women) is common in this country. Pray for Ghana.

ILYA OKHOTNIKOV (01) attended Asbury Theo-logical Seminary where he received his D.Min. in Family Ministry and Counseling. He was appointed the rector of the Eurasian Theological Seminary in Moscow, Russia in 2007. ETSM trains over 100 students on the Moscow and other campuses. You can keep up with Ilya, Ange-lika, Daniella and Polina at www.etsmoscow.blogspot.com.

CARLOS CASTRO (02) is pastoring in Mexico.

CECILIA FRANCISCO-LANSANG (02) is cur-rently involved with the Center for Sowing Seeds of Hope, Inc. (based in Makati, Philippines) as Seeds of Hope Coordinator for Europe. The Seeds of Hope (SOH) ministry provides feeding and basic lessons for poor children in various places in Metro Manila. It also helps to provide scholarships for pre-school and elementary students who are poor and in need of help at the differ-ent WORD International Schools located in Metro Ma-nila and provinces.

REGINALD MCCARN (02) and his wife, Karleen, have been in pastoral ministry since May 1960. They re-tired to Cleveland in August 2009.

DAVID L. VANOY (02) pastors New Vision COG (Homerville, GA) and serves as the Southern Command regional director for the Ministry to the Military.

DAVID CALVERT (03) is senior pastor of the Oak Grove Church of God in Cromwell, KY. He is district overseer of the Oak Grove district and on the Kentucky Church of God State Evangelism Board.

KEVIN MENDEL (03) pastors the Grace Communi-ty Church of God in Cleveland, TN, is a chaplain of the Cleveland Police Department, and community spiritual director of the Cleveland Emmaus and Chrysalis Com-munity.

MAURO A. VARGAS (03) is the Church of God na-tional education director of the Church of God in the Dominican Republic. He is also a pastor.

JEFF BARTELS (04) has returned to the states after two deployments to Iraq as an Army chaplain. He is now ministering to incoming soldiers who are in training for their particular job classification. He covers all the avia-tion skills training at Ft. Eustis, VA, which is about 2900 solders and civilians. This opportunity provides him with time to be with his wife, Teresa, and their daughter, Maygan.

TIM CORLEY (04) is hospital chaplain at the White County Medical Center in Searcy, AR.

PATRICK JENSEN (04) began his tenure as chief resident of the inpatient psychiatry ward at Duke Uni-versity Hospital in June. He was voted in unanimously by all the presiding faculty. He and Aubrey (04) have three children: Asher, Charity and Jayken and reside in Durham, NC. Aubrey shares, “Although the entire medi-cal journey has had its challenges, God has been so very faithful through it all, and He has shown us time and again that He has led us in this direction.”

CARLA J. NORTHCUTT (04) is teaching online classes for Patten University (Oakland, CA) and the PTS. She has battled with cancer since January 2005. You can share her journey by keeping up with her blog at http://ariel-walkinginthesprit.blogspot.com. Keep Carla in your prayers.

JOSHUA (05) and Hope ALEX-ANDER BUTCHER have joined the staff of Vertical Church in Chesa-peake, VA. Josh is the pastor of Fam-ily Ministries and Hope is the direc-tor of worship. They joined Brian (2000) and Kelly (2009) Owens who serve as the pastors of Life Develop-ment.

10

www.ptseminary.edu

Pentecostal Theological Seminary Alumni and Friends

LISA ST. MARIE (08) has de-veloped a faith community nurs-ing ministry at New Covenant Church of God (Cleveland, TN). Based on 1 Corinthians 6:19-20, Lisa says, “the faith community nurse is a registered professional nurse who serves the church to provide preventive care and edu-

cation, with a focus on health promotion and physical, mental and spiritual well-being.” Her goal is to encour-age and support parishoners to maintain wellness and wholeness in both spirit and body. Together with Car-rie Walls (06), they have begun the “Inside Out” weight

loss and management program. This is an integration of six components: spiritual growth, nutrition and health education, accountability, fellowship/support, and exer-cise. Pastor Cheryl Johns says, “Lisa is a wonderful pas-toral presence at New Covenant. Her work in the parish nursing program has helped us to evaluate our lifestyles and move toward wholeness. The Inside Out Program led by Carrie and Lisa has been successful, and people have lost weight, started exercising and worked on in-ternal issues.” Lisa integrates her belief that we are to be good stewards of the life, body, and environment and recently led an adult Sunday School series on Caring for Creation. For more information, you can contact Lisa at stmary45@yahoo.com.

KARINA PETCOFF (05) is serving in Bulgaria as a missionary. After graduating from PTS she continued her studies at Lee University where she graduated with a Master in Education (teaching foreign languages). Kari-na lives and ministers in Stara Zagora at the Theological Seminary where she teaches classes in mission and edu-cation. She also helps at the foundation “Care for All” www.careforall.org.

RAYMOND PETTITT (05) is a chaplain (CPT) in the US Army station in Vilseck, Germany. He is being deployed to Afghanistan this summer.

JEREMY MEW (06) is the senior pastor of Dunn Church of God in Delhi, LA.

JEREMY (06) and Katie PARKER now reside in Sur-prise, Arizona where he is the Assistant Principal at Heritage Elementary. Their daughter, Sierr, is 18 months old.

CATHY VAUGHAN (07) is currently a missionary educator at European Theological Seminary in Germany with her husband, Benson (99 & Dmin 04).

JOHN and TASHA EPLEY (08) celebrated the birth of Isabella Grace on October 20, 2009. They are church planting in Salt Lake City, Utah, ministering to the non-churched and ex-Mormons. Pray that God will break the strong-holds of other religions and cults that pervade this region.

JAMES E. SHOPE (08) pastors the Erwin Hill Church of God near Calhoun, GA.

Ella Grace was born to Sabrina and GRADEN (09) KIRKSEY on August 9, a beautiful and healthy baby girl. On the day of her birth, Graden said, “The song that has been on my heart today is ‘I will turn their mourning into joy. I will comfort them and exchange their sorrow for rejoicing.’ Jeremiah 31:13b. Graden serves as youth pas-tor of Smithville (TN) Church of God.

TONY RICHIE defended his Ph.D. thesis in Systematic Theology at London School of Theology. His work is entitled, Speaking by the Spirit: Exploring the Classical Pentecostal Tradition of Testi-mony in Developing a Pneumatological Theology as a Model for the Interreligious Encounter and Dialogue. Pastor Richie is a missionary teacher at SEMISUD, guest lecturer at PTS and Lee Uni-versity, adjunct theology professor for Regent Univer-sity Divinity School and senior pastor of New Harvest Church of God in Knoxville, TN, along with his beloved wife and partner in ministry, Sue. Dr. Richie says he in-tends to continue working and writing in Christian the-ology and interreligious dialogue.

PentStay Connected!

vvvvvvvvviiiiiiiiiCCCCCCCCBBBBBBBBBLLLLLLLLLLnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnppppppppppppp

fffffffffffftitititititititit iiiiiiiithththththththththththt

ccGaCCcccttthhhhhttttttt

iii iiii

11

The Keeper of the SpringKen Davis

Vice President for Institutional Advancement

Once a quiet forest dweller lived high above a village in the Alps. This elderly gentleman had been hired many years before by the town council to clear away debris from the pools of water up in the moun-

-ful, silent regularity, he patrolled the hills, removed the branches, and

Because of the beauty of the spring and its ponds and waterfalls, the village became a popular spot for vacationers. Swans populated clear pools and sightseers enjoyed picturesque views.

Years passed. One evening the town council met for its semi-an-nual meeting. As they reviewed the budget, one man’s eye caught

councilman questioned the necessity of the expense and, because the council did not have a clear understanding of the importance of the gentleman’s service, they unanimously cut his position.

-

-lowish-brown tint in the spring. A few days later, the water was much

reached the village.

-

12

PENTECOSTAL MINISTRY

Charlotte Diane Fawver Peggy Madden Harmann Ralph McKinley Weikel Jr.

PENTECOSTAL MINISTRY BIBLICAL STUDIES

INTERNATIONAL STUDENT LEADERSHIPAMERICAN BIBLE SOCIETY

BIBLICAL TEACHING

José Orlando Valenzuela Darrell Eugene Young

F. J. MAY EXCELLENCEIN PREACHING COUNSELING CARE MINISTRIES

Jonathan Steven Land Jianian Mai (Janet) Daniel Oscar

Reaffirmation of Accreditation

Oliver McMahanVice President for Ministry Formation

The Pentecostal Theological Seminary has recently been recommended for 10-year reaffirmation by both the Southern Association of Colleges and Schools-Commis-sion on Colleges (SACS) and the Association of Theologi-cal Schools in the United States and Canada (ATS). The

reaffirmation from SACS came in December, 2009 and the ATS reaf-firmation came in June, 2010.

Accreditation by both SACS and ATS represent the most recognized forms of accreditation for Seminar-ies in the United States. SACS ac-creditation represents reaffirmation as a graduate education institution.

ATS accreditation represents reaffirmation as a graduate level institution training persons in ministry.

All of the doctoral and masters degrees of the Semi-nary were reaffirmed with commendation. The Seminary offers the Doctor of Ministry, Masters of Divinity, Mas-ters in Discipleship and Christian Formation, Master of Arts in Church Ministry and Masters in Counseling.

ATS decided to use the Seminary’s Self-Study entitled, Transitioning for Global Missional Leadership: An In-stitutional Self-Study, as an example for ATS’s ongoing training of other institutions currently in the self-study process.

The online program of the Seminary was reaffirmed for use in all of the Seminary’s master’s programs. Commen-dations during the accreditation process included both faculty achievements, administrative stability and gradu-ate academic and ministry placements.

Graduates from the Seminary, with accredited degrees, for decades have:

advanced to ministry and leadership positions, pastorates and staff positions around the world

completed PhD’s at major universities and published in peer review articles and texts

been placed in teaching and educational leadership positions around the world

served as military, institutional and community chaplains throughout the globe

Paul C. Stewart Alumnus of the Year

Alumni Scholarships

AvailablePTS graduates are eligible to take one free audit

course per academic year or receive a 50% scholar-ship on tuition for one course per academic year. This applies to online and residential courses.

Applicants must complete a FAFSA and Financial Aid Application to apply for the scholarship. Con-tact Robin Sluder, Financial Aid Director, for more information at 800-228-9126 or 423-478-7727.

Update your contact information and join the email list at ptseminary.edu.

Oliver McMahanViVicece P Preresisidedentnt f foror M Mininisistrtryy FoFormrmatatioionn

TheThTheTheThe PP P Penenenentetetetecococostststalal Th Theooeoloolo igigicacalll SSemiminanaryry h has recen ltly bebebebbeeneneen r rrececomommemendndeded f foror 10-0-yeyear reaaffirffirrmmamatitionon b by bbo hth thheby y bobothth t thehe SSS tttthhhh AAA i titi f C ll d SS h l C i

adadadadadadadvavavavavavavancncncncncncncedededededededed t t t t t t t to o o oo o o o mimimimimimimimininininininininiststststststststryryryryryryryry a a a a a a andndndndndndnd l l l l l l leaeaeaeeaeadedededdersrsrshihihip p popo isititions, papapapapapapaapastststststsststtstorororororororororatatatatatatatatatteseseseseseseseseses a a a a a a a a a andndndndndndndndndndnd s s s s s s s ss statatatatatatatatatataff ff ff ff ff ffff ff ffff ff popopopopopopopopoposisisisiisisisisititititititititiononononononons s ss s s arararararararououuouououo ndndndndnd t theh worldld

cococococococococococompmpmpmpmpmpmpmpmpmpmmpleleleleleleleleleleeleteteteteteteteteteteted d d d d d d d d d d PhPhPhPhPhPhPhPhPhPhPhPhD’D’D’D’D’D’D’D’D’D’D’s s s s s s s s s s s atatatatatatatatatatat m m m m m m m m m mm majajajajajajajajajaja ororororororororor u u u u u u u uuninininininininiveveveveveveversrsrsrsrsrsitititititieieieies ss s anaanand d pupupupupupupupupuupupublblblbblblblblblblblblisisisisisisisisisisisheheheheheheheheheheheheed d d d d d d d ddd d ininininininininininin p p p p p p p p pp pppeeeeeeeeeeeeeeeeeeeeer rr rr r r r r rr rererererererererrerr viviviviviviviivivivviewewewewewewewewewewww a a a a a a a aa aartrtrtrtrtrtrtrtrtr icicicicicicici leleleleleleleleles s s s s s ananananana d d d d tetetetextxtxtxtssss

bebebebebebebebebebebebebebeenenenenenenenenenenenenenen p p p p p p p p p p pppplalalalalalalalalalalalalalacecececececececececececececed d d d d d d dd d d dd d inininininininininininininin t t t t t t t t t t t ttteaeaeaeaeaeaeaeaeaeaeaeaeaeachchchchchchchchchchchchchchinininininininininininininng g g g g g g g g g gg ananananananananananananannd d d d d d d d dd d d ededededededededdede ucucucucucucucucu atatatatatatatioioioioiioionanananananal l l l l l leleleleleadadadadaderererererpopopopopopopopopopopoop sisisisisisisisisisisiissititititititititititititionononononononononononns s s s s s s ss s s ararararararararararararouououououououououououndndndndndndndndndndndndd t t t t t t t t t t tthehehehehheheheheheheheh w w w w w w w wwwwworororororororororororldldldldldldldldldldldl

seseseseseseseseseseseseeseservrvrvrvrvrvrvrvrvrvrvrvrvrrvededededededededededededededed a a a a a a a a a aaa as s s s s s s s s ssss s s mimimimimimimimimimimimimimiimilililiilililililililiilililitatatatatatatatatatatatatatatataryryryryryryryryryryryryryyrry, , , ,,, ,, ,,, , ininininininininininiinininststststststststststststststststititititititititititititiitutututututututututututtu ioioioioioioioioioioioioi nananananananananananal l l l l l l l l l ananananananananananannd dd d d d d d d ddd cocococococococococococommmmmmmmmmmmmmmmmmmmmmununununununununununiiiiiiiichchchchchchchchchchhchchchapapapapapapapapapapapapaplalalalalalalalalllalalaaainininininininininiinininins s s s s s ss s s s ss ththththtthththththththhththrororororororororororororougugugugugugugugugugugugug ohohohohohohohohohohohoohohoututututututututututututut t t t t t tt t t t tthehehehehehehehehehhehehe g g g g g g g g gg g glolololololololololollololobebebebebebebebbebbebebee

13

h u-

es,

PTPTPTTS S S S grgrgrgradadadadadadadduauauauauauauauauatetetetetetetetetetes s s s ss ss s ss ararararararararararararare e e e e e e e e e e ee eleleleleleleleleleleleleleligigigigigigigigigigigigigibibibibibibibibibibibibibbblelelelelelelelelelelelelelee t t t t t t ttt t tt t t to o o o oo o o o oo o oo tatatatatatatatatatatatatatatat kekekekekekekekekekekekekekekek o o o o oooo o o o ooonenenenenenenenenenenenenenee f f f f f f f f fff f f ffrererererererererererererereree e e e e e e e e ee e ee auauauauauauauauauauauauauaua dididididididididididididididdit t t t t t tt t tttt ttcccccccccccccocococccccccccccccccccccccccccccccccccccccccccccccccc urururursesesese p p p pppererererererrer a a a a a aaaacacacacacacacacacacadededededededededededeemimimimimimimimimimimimimic c c c c c c c c c ccc yeyeyeyeyeyeyeyeyeyeyeyeyeararararararararararararar o o o o o o o o o o o ooor r r r r r r r r r r rr rr rererererererererererererereer cecececececececececececececeeivivivivivivivivivivivivivivivve e e e e e e e e e ee e eee a a a a a a a a a a a a a a 5050505050505050505050505055050% % % % % % % % % % % % %%% scscscscscscscscscscscscscss hohohohohohohohohohohohohohoholalalalalalalalalalalalalalarrrrrrrrrrrrrrrr-------------sssssssshshshssshssssssssssssss ipipipip o o o oon nn nn n tutututututututuitititititititititioioioioioioioioioioon n n n n n n n n nn fofofofofofofofofofofofofor r r rr rr rr r rr r ononononononononononononone e e e e e e e e ee e e cocococococococococococococoourururururururururururururursesesesesesesesesesesesesees p p p p p p p p p p p p pppppererererererererererererererr a a a a a a a aa a a a aacacacacacacacacacacacacacacadededededededededededededededdemimimimimimimimimimimimimimimicc c c c cc c c c cccc yeyeyeyeyeyeyeyeyeyeyeyeyeyey arararararararararararararar. ..... . .....ThiThiThiThiThiThis s s s s s apapapapapapapapapplplplplplplplplplieieieieieieieeieies s s s s s s s ss ss totototototototototototo o o o o o o oo o o ooonlnlnlnlnlnlnlnlnlnlnlnlnlininininininininininininine e e e e e e e e e e ee ananananananananananananannd d d d d d d d d d d dd dd rerererererererererererererresisisisisisisisisisisisisiisidedededededededededededededededentntntntntntnntntntntntntntntiaiaiaiaiaiaiaiaiaiaiaiaiaial l l lll l l l l l lllll cocococococococococococococcoourururururururururururururrrseseseseseseseseseseseseseses.s.s.s.s.s.s.s.s.s.s.s.s.ss.

ApApApApApApApApApApplplplplplplplplplplplicicicicicicicicicicicananananananananananananntstststststststststststs m m mm m m m mmm m mmususususususususususususust t t t t t t t t t t tt cococococococococococococoompmpmpmpmpmpmpmpmpmpmpmpmpmppm lelelelelelelelelelelelelel tetetetetetetetetetetetetett a a a a a a a a a a a a aa F F F F F F F F F FF FFAFAFAFAFAFAFAFAFAFAFAFAFAFAFFSASASASASASASASASASASASASASAA a a aa a aaaaa a aa andndndndndndndnddndndndndndndnd F F FF F FF F F F F F F F FFinininininininininininininini ananananananananananananananana ciciciciciicicicicicicicicialalalalalalalalalalalalalalal AiAiAiAiAiAiAiAiAiAiAid d d d d d d d d ddd ApApApApApApApApApApApApApplplplplplplplplplplplplplicicicicicicicicicicicicicatatatatatatatatatatatatatioioioioioioioioioioiooioion nn n n n n n n n n nn tototototototototototototooo a a aa a a a a a a aa aappppppppppppppppppppppppppppppplylylylylylylylylylylylylylyyy f f f f f f f f ff f f f ffororororororororororororororo t tt t t t t t t t tt ttthehehehehehehehehehehehehehehe ss s s s s s s s sss sschchchchchchchchchchchchchchchc ololololololololololololololo ararararararararararararararshshshshshshshshshshshshshshshs ipipipipipipipipipipippipipipip. .. . . .... .. .. CoCoCoCoCoCoCoCoCoCoCoCoCoCoCoC nnnnnnnnnnnnnnnn------------tatatatatatatatatatatatat ctctctctctctctctctctctctt R R R RR R R R R RRR Robobobobobobobobobobobobo ininininininininininninin S S S S S S S SS S SS Slululululululululululululuudedededededededededededededeer,r,r,r,r,r,r,r,r,r,r,r,r,r,r F FF FFF FF F F FF FFFinininininininininininininininananananananananananananananannciciciciciciciciciciciciciciialalalalalalalalalalalalalala A A A A A AA A A AA A AAAAididididididididdididididididi D D D D D D D DD D D D D DDiririririririririririririririrececececececececececececececece tototototototototototototototor,r,r,r,r,r,r,r,r,r,r,r,rr, f ff f ff f ff f f f fffororororororororororororororor m m m m m m m m m m m m mmmororororororororororororororre e e ee e e e e eeeeeinininininininininininininfofofofofofofofofofofofoformrmrmrmrmrmrmrmrmrmrmrmrmmatatatatatatatatatatatattatioioioioioioioioioioioioioon n n n n n n n n n n n n atatatatatatatatatatatatata 8 8 8 88 8 8 8 88 8 8 800000000000000000000000000000-2-2-2-2-2-2-2-2-2-2-2-2-2-22- 28282828282828282828288282828-9-9-9-9-9-9-9-9-99-9-9-9-99121212121212121212121212121211 6666 6 6 6 6 6 6 6 6 6 6 6 ororororororororororororororo 4 4 4 4 4 444 4 4 4 44 444232323232323232323232323232323-4-4-4-4-4-4-444-4-4-4-4-4-4478787878787887878787878787877 -7-7-7-7-7-7-7-7-7-7-7-7-7-77272727272727272727272727272727.7.7.7.7.7.77.7.7.7.7.7.7.

rrrrrshshshshshshs ipipipipipipp

itititititititititiiity y y y y y y yy y yy yyy

14

Colombian Overseer Awaits Seminary Study Opportunity

Arturo Mendieta is an experienced pastor and church leader in his native country of Colom-bia. During his busy ministry over 32 years,

he has attended Bible school, completed a university degree in philosophy, served as a pastor, taught in the national Bible institute, and advanced to become ter-ritorial overseer of Northern Colombia.

One of Mendieta’s goals is to complete a Master of Divinity degree at the Pentecostal Theological Semi-nary. World Missions attempts to identify and bring to the Seminary early- to mid-career church leaders for the purpose of enhancing and enriching their minis-tries. Most will have a teaching ministry in connection with whatever future assignment they fulfill. Mend-ieta has explained “throughout my life I have carried out two main functions: Pastor and Educator. I hope to spend the rest of my life in the training, selecting, preparing, and empowering of new leaders.” In his application letter, Mendieta wrote, “I believe the time has come to equip myself for greater service. One of my principal tasks as an overseer is the ongoing training of our pastors, and I will be limited in accomplishing the work until I study these courses and earn the degree.” The church leader’s former Field Director, Víctor Pagán, identified him as a gifted and dedicated leader whose ministry has been productive and fruitful. Pagán says, “It is es-sential to have a national with the academic credentials to strengthen the ministerial training program. Arturo Medieta is that person.”

He will have to fulfill his dream in the future; at the present time, he is next on the waiting list for a World Missions-assisted scholarship to attend the seminary. He would have come to the seminary in the fall of 2010, but because World Missions needed to reduce their budget this year, World Missions had to significantly cut the amount of funding they were able to send to the seminary this year for international students. World Missions had been funding five international students

at the seminary each year. The difficult news is that

World Missions reports it will have to further cut the

monies sent to the seminary for international students

over the next four years. Fewer international students

coming to the seminary has a ripple effect that affects

the church for many years to come.

“We need to find ways for more international students to come, and we cannot accept a state in

which fewer international students come to the seminary.”

President Land responded to Mendieta’s situation

by saying that it is admirable Mendieta says he will pa-

tiently await his chance to attend the

seminary. Land continued, “However,

I do not know if we can be patient.

Fewer students weakens the interna-

tional bonds of faith and fellowship that

binds us together globally. Friendships

formed at the seminary between stu-

dents and church leaders endure for a

lifetime. It is good for international stu-

dents and good for American pastors

to spend time together at the seminary.

We must find ways to continue to fund international

students coming to the seminary. We do not need to re-

duce the numbers; we need to increase them. We need

leaders like Brother Mendieta who have such passion

and dedication to the Kingdom to continue to come to

the seminary. We need to find ways for more interna-

tional students to come, and we cannot accept a state in

which fewer international students come to the semi-

nary.”

If you would like to contribute to the funds necessary

to continue bringing international students to the sem-

inary, use the enclosed envelope. If you attend a Church

of God, provide the name of your church, and World

Missions will give your church World Missions credit.

15

In MemoriamClarence J. AbbottDr. and Mrs. Fred Abbott

Dr. Donna F. Mills

W. W. BallDr. Winston N. Ball

Esslie and Mary Ellen Dixon Conlay

Ch, Lt Col and Mrs. Paul C. Stewart (Ret)

James A. CrossJoy H. Cross

Len DurhamEasley Church of God Women’s Ministries

Robert E. FisherMrs. Mary Fisher

D. Joe HornAngela Horn

James and Ernestine JohnsCheryl JohnsJackie Johns

S. W. LatimerMrs. Ramona Hyberger

Maggie Nolie O’QuinnMrs. Linda T. Brown

Ann ParkerMr. and Mrs. Bruce F. Parker

Roberto Amparo RiveraAlpha Logistics, Inc.

COG in Mexico/Christian Leadership CenterChurch of God World Missions SA

Editorial EvangélicaLucy Guadalupe

Reverend Alcides MoralesMariela Bernal MuñozNew England Spanish

Northwestern Spanish

José PantojaReverend José Pérez

Reverend Robert E. RodríguezVíctor M. Rodríguez

Reverend Joylita P. TerpstraUniversidad Teológica de Caribe

Rick and Jan Waldrop

Evelyn ScroggsMr. and Mrs. Raymond D. Harrell

Rene’ Triplett-PyeattDr. and Mrs. Bennie S. Triplett

In HonorPansy Bare

Ken and Melissa ArcherCovenant Church of God-Charlottesville

Norm and Nancy BeetlerMelissa and Ken Archer

J. Frank and Kohatha CulpepperDr. and Mrs. Mark L. Williams

Williams Covenant Ministry TeamKen & Debbie Davis

Church of God World MissionsMrs. Lorene Carter

Dr. and Mrs. Ronald Keith CasonMr. and Mrs. Billy D. Culpepper Sr.

Mrs. Mary Fisher

Reverend and Mrs. Wayne W. HeilDr. and Mrs. Ray H. Hughes, Sr

Ms. Carrie HumbertsonMs. Sandra J. JonesMrs. Evelyn Knight

Mrs. Mary LandLowery Ministries International Inc.

Ms. Betty SimonsDr. and Mrs. Donald M. Walker

Joe E. EdwardsMr. Donald G. Bennett

R. Hollis GauseDr. Kimberly E. Alexander

Dr. Sang-ehil HanDr. Chris Thomas

Jack and Mary LandDr. and Mrs. Steven J. Land

Steven Jack LandDr. and Mrs. James Bowers

Reverend and Mrs. Ken DavisDr. and Mrs. Lee Roy MartinDr. and Mrs. Oliver McMahan

Gregg and Denise ModerMs. Victoria Vito

T. L. LoweryDr. Kimberly Alexander

Allan MathuraSouth Metro Ministries

Marshall E. RobersonKen and Debbie Davis

Mack P. Stewart, Jr.Ch, Lt Col and Mrs. Paul C. Stewart (Ret)

Horace WardTracy and Joylita Terpstra

Donald S. and Winona AultmanDr. and Mrs. Kenneth Beard

Dr. and Mrs. Raymond F. CulpepperMr. and Mrs. Thomas Russ DelatourReverend and Mrs. Cecil Ray GuilesReverend and Mrs. Wayne W. Heil

Ramona HybergerMs. Noretta K. MedfordMs. Jennie R. Mullinax

Mrs. Beulah Mae MurphreeMount Paran Church of God – NorthReverend and Mrs. Víctor M. Pagán

Reverend Julian B. RobinsonMr. and Mrs. Raymond D. Schlueter

Douglas SlocumbMr. and Mrs. Claude Bowden

Mr. Michael BrantleyMr. and Mrs. Herbert Buie

Ms. Bonny CainMr. and Mrs. Virgil W. Carmen

Dr. and Mrs. Ronald Keith CasonChattanooga Association for Clinical Pastoral Education

Christian Life Church of God, Dr. Hugh Anthony Bair, Pastor

Church of God FoundationMr. and Mrs. Thomas Russ Delatour

Mr. and Mrs. H. Bernard Dixon Mr. and Mrs. Stanley N. Earls

Mr. and Mrs. George A. FlemingMs. Susan Malone Gault

Mr. Donald GravesMr. Jim Hamilton, Sr.

Reverend and Mrs. Marcus V. HandReverend and Mrs. Wayne W. HeilDr. and Mrs. Ray H. Hughes, Sr.

Dr. Cheryl Bridges JohnsDr. Jackie Johns

Reverend and Mrs. Douglas LeRoyMrs. Ruth C. Lindsey

Dr. and Mrs. J. Anthony LombardMr. and Mrs. Jack R. Malone

Mr. and Mrs. William H. MaloneBen and Carla NorthcuttMr. and Mrs. Alvin O’Neil

Mrs. Edna O’NeilProfessional Building Management,

Dr. and Mrs. Tom A. BillerReverend and Mrs. L. Wayne Roberson

Reverend and Mrs. Marshall E. RobersonMr. and Mrs. Floyd R. Rushton

Reverend and Mrs. W. P. SlocumbDr. and Mrs. Bennie S. TriplettDr. and Mrs. Donald M. Walker

Reverend Lucille WalkerReverend and Mrs. Edward L. Williams

Reverend Bernice S. WoodardReverend and Mrs. Welton J. Wriston

These gifts have been made by donors to the Seminary in honor of, or in memory of, friends and loved ones. Gifts in memory of friends and loved ones can be made to the Pentecostal Theological Seminary Scholarship Fund

P.O. Box 2250 Cleveland, TN 37320-2250

PA I D