ORIGINAL PAPER

Seed-Specific Expression of AINTEGUMENTA in Medicagotruncatula Led to the Production of Larger Seeds and ImprovedSeed Germination

Massimo Confalonieri & Maria Carelli & Valentina Galimberti &Anca Macovei & Francesco Panara & Marco Biggiogera &

Carla Scotti & Ornella Calderini

# Springer Science+Business Media New York 2014

Abstract The increase of seed size is of great interest inMedicago spp., to improve germination, seedling vigourand, consequently, early forage yield as well as for optimizingseeding techniques and post-seeding management. This studyevaluated the effects of the ectopic expression of theAINTEGUMENTA (ANT) cDNA from Arabidopsis thaliana,under the control of the seed-specific USP promoter fromVicia faba, on seed size, germination and seedling growth inbarrel medic (Medicago truncatula Gaertn.). All the transgen-ic T2 barrel medic lines expressing ANT produced seedssignificantly larger than those of control plants. Microscopicanalysis on transgenic T3 mature seeds revealed that cotyledon

storage parenchyma cells were significantly larger andcontained larger storage vacuoles than those of the untrans-formed control. Moreover, the percentage of germination wassignificantly higher and germination was more rapid in trans-genic than in control seeds. Our results indicate that the seed-specific expression of ANT in barrel medic led to larger seedsand improved seed germination, and revealed a regulatory rolefor ANT in controlling seed size development.

Keywords AINTEGUMENTA . Cell expansion .

Medicago truncatula . Seed germination . Seed size

Introduction

The growth rate and final size of plant organs are driven byboth genetic control and environmental influence (Bögre et al.2008). Two basic cellular processes contribute to organ growthand final size: cell proliferation and cell expansion. Cell prolif-eration occurs initially in the whole organ primordium anddetermines the increase in cell number. Cell expansion gradu-ally takes over often determining the dramatic increase in thefinal organ size (Johnson and Lenhard 2011). Genes regulatingboth proliferation and expansion were identified in differentspecies, including Arabidopsis. Differently from other plantorgans, the genetic control of seed size requires a strict coordi-nation of zygotic (embryo and endosperm) andmaternal tissues(integuments) (Van Daele et al. 2012).

Seed size in higher plants is an important trait influencingmany aspects of plant ecology, evolution and domestication(Linkies et al. 2010). Crops domesticated for the consumptionof their seeds often produce significantly larger seeds thantheir wild ancestors. However, even for crops grown for usesother than edible seeds, seed size seems to have increased

M. Confalonieri and M. Carelli contributed equally to this work.

Electronic supplementary material The online version of this article(doi:10.1007/s11105-014-0706-4) contains supplementary material,which is available to authorized users.

M. Confalonieri (*) :M. Carelli : C. ScottiConsiglio per la Ricerca e Sperimentazione in Agricoltura, Centro diRicerca per le Produzioni Foraggere e Lattiero-Casearie, 26900 Lodi,Italye-mail: massimo.confalonieri@entecra.it

V. Galimberti :A. Macovei :M. BiggiogeraDepartment of Biology and Biotechnology “L. Spallanzani”,University of Pavia, 27100 Pavia, Italy

F. Panara :O. CalderiniCNR, Istituto di Genetica Vegetale, 06128 Perugia, Italy

Present Address:A. MacoveiInternational Center for Genetic Engineering and Biotechnology(ICGEB), Aruna Asaf Ali Marg, 110067 New Delhi, India

Present Address:F. PanaraENEA Centro Ricerche TRISAIA, 75026 Rotondella, Matera, Italy

Plant Mol Biol RepDOI 10.1007/s11105-014-0706-4

during domestication, probably due to indirect selection forgreater seedling vigour and germination uniformity (Orsi andTanksley 2009). Several studies have shown positive relation-ships between seed size and genome size within species andacross species within the same genus or family (Knight andAckerly 2002; Grotkopp et al. 2004; Knight et al. 2005).Morerecently, Beaulieu et al. (2007) suggested that genome dimen-sion could be related to seed size through cell size effectswithin seed organs. Seed size varies dramatically amongdifferent plant species: angiosperms have a size that rangesover 10 orders of magnitude (Harper et al. 1970); gymno-sperms have larger seeds and less seed size variation thanangiosperms (Linkies et al. 2010). Although seed size can beconsidered a rather constant trait within species (Harper et al.1970), seed size is also negatively correlated with seed num-ber (Venable 1992; Leishman 2001).

Variation in seed size implies significant agronomic andecological consequences. Large seed size is positively associ-ated with a greater percentage germination, ease of seedprocessing (Tanska et al. 2008) and optimization of seedingtechniques and post-seeding management. It is also positivelycorrelated with greater seedling establishment, survival, toler-ance to adverse environmental conditions, growth and devel-opment (Krannitz et al. 1991; Gjuric and Smith 1997;Koelewijn and Van Damme 2005). Therefore, the manipula-tion of seed size by conventional breeding and/or geneticengineering represents an attractive target to improve differentcharacters besides increasing seed production.

Studies on the genetic and ecophysiological control of seedproduction have been carried out in alfalfa (Medicago sativaL.),one of the most important forage crop worldwide (Gallardoet al. 2006). Alfalfa is a relatively small-seeded legume withlimited variation in commercial cultivars for both size andweight of seeds (Haas and Thomas 2004; Scotti and Gnocchi2004). Attempts to increase seed size in alfalfa have beenundertaken by recurrent selection for this trait (Haas andThomas 2004) and, more recently, by introgression of the “largeseed” character from Medicago arborea showing promisingresults (Bingham et al. 2009). The increase of seed size wasproposed as an indirect method to improve the meadow struc-ture in alfalfa (Rotili et al. 1999) as larger seeds could also betteraccommodate precision-sowing techniques. In fact, under fieldconditions, an uncontrolled plant density is responsible for theuneven distribution of plants, thereby reducing the homogeneityof the meadow structure. Precision sowing could allow thecontrol of plant spacing and the achievement of an optimal fielddensity thus reducing plant interferences and maximizing yield.

Among Medicago species, barrel medic (Medicagotruncatula Gaertn.) represents an attractive model forunravelling the cellular and molecular biology of legume spe-cies (Cook 1999). In particular, the genome sequence covering94 % of genes was recently published (Young et al. 2011), thelatest version being Mt4.01 at http://www.jcvi.org/medicago/,

and large mutant collections are available (Porceddu et al.2008; Tadege et al. 2008; Rogers et al. 2009). Genetic trans-formation is feasible (Cosson et al. 2006; Confalonieri et al.2009) allowing the genetic manipulation of important traits.Understanding seed size regulation in Medicago spp. can takeadvantage from the genomic tools available for M. truncatula,also considering that barrel medic is highly prolific, producinghundreds of seeds from an individual plant.

Genetic analysis in different species has revealed severalkey genes controlling the size of plant organs. Some of thesegenes have a general effect but few were proven to influenceseed size alone. In particular, the loss of function ofAINTEGUMENTA (ANT) (an AP2 transcription factor) resultsin a reduction of the number and size of leaf and floral organs(Elliott et al. 1996; Klucher et al. 1996; Mizukami and Fischer2000), due to a decrease in cell number but not in cell size.Conversely, the ectopic expression of ANT under a constitu-tive promoter increases the size of floral organs, leaves andseeds (Krizek 1999; Mizukami and Fischer 2000). ANT-over-expressing plants showed an increase in cell number resultingin a dramatic increase of the size of all shoot organs both inArabidopsis and tobacco transgenic plants. More recently,ectopic expression of ANT AIL5 and AIL6 genes resulted inlarger floral organs, similar to that obtained from ectopicexpression of ANT (Nole-Wilson et al. 2005; Krizek andEaddy 2012). In the case of AIL6 transgenic plants, the alter-ations in flower development also included changes in floralorgan morphology. However, AIL6 transgenic seeds weresometimes larger than wild type.

To elucidate the role of ANT on seed size and seed germi-nation of barrel medic, the Arabidopsis ANT gene was ectop-ically expressed inM. truncatula under the control of the seed-specific promoter UNKNOWNSEED PROTEIN (USP) fromVicia faba (Bäumlein et al. 1991; Zakharov et al. 2004).Transgenic plants produced larger seeds and did not displaynegative pleiotropic effects in a greenhouse environment.Furthermore, ANT transgenic seeds exhibited an enhancedability to complete germination than those of the untrans-formed control. To our knowledge, this is the first reportdescribing a positive regulatory role of ANT in controllingseed development for a legume species and represents apotentially useful tool for biotechnological approaches toincrease seed size and improve germination in plants.

Materials and Methods

Plant Material and Growth Conditions

M. truncatula genotype R108-1, selected by Trinh et al.(1998) due to its high tissue-culture potential, was used in thisstudy. To obtain the flowers required for the genetic transfor-mation experiment, individual plants were grown in pots

Plant Mol Biol Rep

containing a mixture of peat and soil (1:2) in a growth cham-ber with the following conditions: 16-h day length and tem-perature of 22 °C by day and 20 °C by night. In vitro cultureswere kept in a growth chamber at 24/22 °C under a 16-hphotoperiod with a fluorescent light (65–75 μmol m−2 s−1

intensity). Untransformed control and ANT transgenic plantlines, both undergoing tissue culture and in vitro regenerationvia somatic embryogenesis, derived from the same and uniquetransformation experiment. The regenerated control and trans-genic plant lines were maintained in vitro and propagated asdescribed by Scaramelli et al. (2009).

The fully grown in vitro transgenic and untransformedcontrol plants (T0 generation) were transplanted into 12-cm-diameter pots containing a mixture of peat and soil (1:2) andgrown under growth chamber conditions at a temperature of22/20 °C with 16 h of light and 8 h of darkness. Selfed seedsfrom T0 transgenic and control plants were collected andgerminated on agar medium in Petri dishes for 2–3 days at25 °C. Germinating T1 seedlings were transferred into potsand grown under the same growing conditions. T2 seedsresulting from the self-pollination of selected T1 parents weregerminated, and the seedlings were grown in a greenhousefrom April to June under the natural photoperiod until theproduction of T3 seeds. Afterwards, the T3 transgenic andcontrol plants were grown under the growth chamber condi-tions as described above.

Vector Construction and A. tumefaciens-MediatedTransformation

The ANT cDNA of Arabidopsis was obtained from theArabidopsis Biological Resource Center (ABRC, cloneU11873). The USP promoter was kindly provided by Dr H.Bäumlein, IPK, Gatersleben, Germany. The USP promoterwas amplified from the original plasmid by polymerase chainreaction (PCR) with primers: USPPR5’HindIII (AAGCTTCTGCAGCAAATTTACACATTGCCAC) and USPPR3’XbaI(TCTAGATTGACTGGCTATGAAGAAATTATAATCG).The PCR product was cloned in pGEMTEasy vector(Promega) and sequenced. The USP promoter was subse-quently excised by restriction with HindIII and XbaI andcloned into the HindIII and XbaI sites of the binary vectorpBI121, thus replacing the 35S promoter; the vector wasnamed pBIUSP. Similarly, the ANT complementary DNA(cDNA) was amplified with primers ANT5’SmaI (GGAATTCCCGGGTCAAGGCCA) and ANT3’UTRSacI (CACTCGAGTTGATCAAGAATCAG) from the original plasmid,cloned in pGEMTEasy vector, and sequenced. The cDNAwas excised with SmaI and SacI restriction enzymes andligated to pBIUSP cut with the same restriction endonucleasesto replace the uidA gene. The resulting plasmid (pBI-USPANT) was mobilized in the EHA105 A. tumefaciens

strain and used to transform M. truncatula flower explants(Scaramelli et al. 2009).

Screening of Transformants by PCR Analysis

Screening of putative transgenic lines was carried out on bothT0 plants and T1 segregating population. Plant genomic DNAfor PCR analysis was extracted using the GenElute PlantGenomic Kit (Sigma Aldrich), according to the manufac-turer’s instructions. The 600-bp nptII fragment was amplifiedusing the gene-specific oligonucleotide primers NptIIfw(CTGAATGAACTGCAGGACA) and NptIIrv (ATCTCGTGATGGCAGGTG). Oligonucleotide primers AINT5’(GGAATTCCCGGGTCAAGGCCA) and AINT3’ (CACTCGAGTTGATCAAGAATCAG) were used to amplify the1,700-bp fragment corresponding to the ANT gene. The pres-ence of seed-specific USP promoter in the barrel medic ge-nome was verified by using the promoter-specific oligonucle-otide primers USPHindIII (AAGCTTCTGCAGCAAATTTACACATTGCCAC) and USPXba (TCTAGATTGACTGGCTATGAAGAAATTATAATCG) which amplify the 688-bpUSP fragment. The PCR conditions were the following: initialdenaturation at 95 °C for 5 min and 35 cycles at 95 °C (30 s),60 °C (30 s), 72 °C (1 min) and final elongation at 72 °C(5 min). Amplification products were analysed on 1 % (w/v)agarose gel.

Detection of Transgene Copy Number of T0 Transgenic Plantsby Quantitative Real-Time PCR

To estimate the copy number of ANT and nptII transgenes,quantitative real-time PCR was carried out on genomic DNAextracted from leaves by using the NucleoSpin Tissue Kit(Macherey-Nagel) according to manufacturer’s indications.Quantitative real-time PCR (QRT-PCR) was carried out in aRotor-Gene 6000 PCR apparatus (Corbett Robotics, Brisbane,Australia) by using Maxima SYBR Green qPCR Master Mix(2×) (Fermentas) in a final volume of 25 μl according tosupplier’s indications. The following QRT-PCR conditionswere used: denaturation at 95 °C for 10 min and cycling at95 °C (15 s), 56 °C (30 s) and 72 °C (30 s) for 45 cycles. Thebarrel medic APX gene (Accession Number DY616600) wasused as standard control in the QRT-PCR reactions, since itwas proven to be present in a single copy (Mason et al. 2002).The oligonucleotide primers for ANT, APX and nptII genes,used for the QRT-PCR, were designed using the real-timePCR primer design programme from GenScript (https://www.genscript.com/ssl-bin/app/primer) (Online Resource 1).For each primer set, a no-template water control was used. Allreactions were performed in triplicates. The absolute quanti-fication of the three genes was determined with reference totheir standard curves obtained by plotting the threshold cycle(Ct) values against log-transformed concentrations of serial

Plant Mol Biol Rep

10-fold dilutions (101, 102, 103 and 104 copies μl−1). Therelative copy number was obtained by dividing the absolutecopy number of the endogenous gene by that of the targetgenes (Yi et al. 2008).

Expression Level of ANT by Reverse Transcriptase PCRAnalysis

For each control and transgenic line, total RNA was isolatedfrom pods of two to four T1 randomly chosen plants. Pods inthree different developmental stages were selected and har-vested: just coiled young pod (stage 1), early growth phase(stage 2) and storage phase (stage 3) (Firnhaber et al. 2005).Total RNA was extracted using the RNAeasy plant mini kit(Qiagen) according to the manufacturer’s protocol. Firststrand cDNA was synthetized with SuperScript III reversetranscriptase (Invitrogen) using a polyT 16mer primer. Themessenger RNA (mRNA) level of ANT was determined byRT-PCR: 2.5 μl of first strand cDNA were amplified usingprimers ANTFOR1261 (GAAGCTGCAGAAGCTTACGA)and ANTREV1646 (TCAAGAATCAGCCCAAGCAGCGA) with TaKaRa Ex-Taq according to the manufacturer’sinstructions. The Msc27 gene was used as positive control(Msc27fw: GATGAGCTTCTGTCAGACTC; Msc27rw:GCTACCATCATCATGCATGC) (Pay et al. 1992). PCRproducts were separated on 1 % (w/v) agarose gel.

Transcript Level Analysis by Quantitative Real-Time PCR

QRT-PCR analysis was performed on T2 generation of select-ed transgenic and untransformed control lines. Total RNAswere extracted from three bulks (biological replicates) of 2-week-old pods (one to three pods/bulk) coming from one tothree individual plants. RNA extraction was carried out usingthe Aurum total RNA fatty and fibrous tissue kit (BioRad,Milan, Italy), and cDNA synthesis was then performed withthe iScript cDNA synthesis kit (Bio-Rad). QRT-PCR wascarried out in a total volume of 20 μl, using the SsoFast™EvaGreen® supermix (Bio-Rad) as indicated by the supplier,in a Rotor-Gene 6000 PCR apparatus (Corbett Robotics,Brisbane, Australia). Quantification was carried out usingthe M. truncatula γ-tubulin (DFCI annotation TC130143) asreference gene. The oligonucleotide primers were designed aspreviously described (Online Resource 1). QRT-PCR condi-tions were as follows: denaturation at 95 °C for 30 s andcycling at 95 °C (5 s), 60 °C (10 s) and 72 °C (10 s). For eachprimer set, a no-template water control was used and thereactions were performed in triplicates. The QRT-PCR resultswere interpreted using the LinRegPCR computer software(Ramakers et al. 2003). For each set of PCR reactions, thelogarithm of the initial fluorescence (No) was calculated basedon the individual PCR efficiency. The logarithm of relative

fluorescence unit (LogRFU) was used for graphicrepresentation.

Phenotypic Analysis of Barrel Medic Transgenic Plants

Based on PCR and RT-PCR analyses of T1 plants from each ofthe five T0 transgenic lines, four T2 progenies expressing ANTat high and stable levels and representative of four indepen-dent transformation events were chosen. To evaluate in detailyield components, the T2 homozygous transgenic and controlplants were cultivated in a greenhouse. A total of 40 transgen-ic plants were evaluated corresponding to four independent(ANT-2A, ANT-4A, ANT-5A and ANT-7A) transformantsand 21 untransformed control plants. The trial was organizedin a completely random design with single plants as experi-mental units. The phenotypic traits recorded were the follow-ing: number of pods/plant, number of seeds/plant, number ofseeds/pod, total seed weight (mg) /plant and individual seedweight (mg).

To evaluate whether the ANT expression in seeds wouldaffect other growth parameters, T3 homozygous transgenicand control plants were grown in a growth chamber (16 h oflight at 22 °C and 8 h of dark at 20 °C) for 6 weeks. A total of22 transgenic plants were evaluated, corresponding to four(ANT-2A, ANT-4A, ANT-5A and ANT-7A) independenttransformants and six untransformed control plants. The trialused a completely random design with single plants as exper-imental units. At the end of the experiment, plants wereharvested and dry weight of shoots and roots were evaluated.

Seed Sizing with Image Processing Analysis

The image analysis was carried out on mature T3 dried seeds.Pictures of seeds were taken by a digital camera (CanonPowerShot Pro90 IS) and saved in RGB format for furtheranalyses. Image processing and size measurements were per-formed using the Matlab 7.0.4 software (The MathworksInc.). Average seed size was measured as the area of the seedimage (mm2). Five to 21 independent replications representedby the total T3 seed progeny of each individual T2 homozy-gous plant were evaluated. In total, 2,806 control, 1,170 ANT-2A, 575 ANT-4A, 1,317 ANT-5A and 1,049 ANT-7A trans-genic seeds derived respectively from 21, 17, 5, 10 and 8different T2 plants were analysed.

Seed Volume Determination

For each barrel medic line, 50 seeds were randomly selectedfrom the total T3 seed progeny of each individual T2 homo-zygous plant and weighed. The average seed volume wasdetermined as described by Dutta et al. (1972). Seeds weredropped into a container filled with water. The displaced water

Plant Mol Biol Rep

which is collected and weighed is used to calculate the equiv-alent volume of water and hence the average volume of seeds.

Microscopy

Mature T3 dried seeds from untransformed control as well asfrom the ANT-2A, ANT-4A, ANT-5A and ANT-7A transgen-ic lines were fixed overnight at 4 °C in 2.5 % glutaraldehydeto 2 % paraformaldehyde in PBS, rinsed in PBS, dehydratedin acetone and finally embedded in epoxy resin. The blockswere polymerised at 60 °C for 24 h. Semithin sections, 1.5-μthick, were cut with glass knives on a Reichert OMU-3ultramicrotome, collected on glass slides and stained withtoluidine blue. The seeds were cut longitudinally, and thesections obtained at various levels. Micrographs were takenwith an Olympus BX-51 microscope equipped with a digitalcamera. On images taken with a 40× objective and analysedwith the ImageJ software, an arbitrary area was chosen and thecells therein counted. For each section, seven fields wererandomly examined. The same area was used on all thesections in the different seeds considered. Moreover, on dif-ferent sections, 100 cells per section, randomly distributed,were counted and the area of each cell, measured. As for thenumber and area of storage vacuoles, 30 cells randomlydistributed were analysed.

Total Protein Determination

Mature T3 dried seeds from untransformed control as well asfrom the ANT-2A, ANT-4A, ANT-5A and ANT-7A transgen-ic lines were ground to fine powder in a cyclone mill(Cyclotec, Höganäs, Sweden) and subsequently air-conditioned at 60 °C before analysis. Total nitrogen contentwas determined by dry combustion using a NA 1500 elemen-tal analyser (CE Instruments, Milan, Italy) according to theDumas method (Hansen 1989) and multiplied by 6.25 to givethe percentage of seed protein on dry matter. For each barrelmedic line, two independent replications were tested eachreplication being represented by the total T3 seed progeny ofthree to five individual T2 homozygous plants. All indepen-dent samples were analysed in duplicate.

Seed Germination

To evaluate whether the ANT expression in seeds would affectgermination and seedling vigour, matureT3 dried seeds of thesame age from untransformed control as well as from theANT-2A, ANT-5A, ANT-4A and ANT-7A transgenic lineswere transferred to 9-cm Petri dishes (25 seeds/dish) contain-ing two layers of filter paper and 5 ml of distilled water. ThePetri dishes were sealed with a polyethylene film to preventdrying and placed on a germination cabinet under controlledenvironmental conditions (dark; 20 °C). Before seed

imbibition, seeds were subjected to a mechanical scarificationto bypass physical seed dormancy. Two germination experi-ments were carried out. In the first trial, five independentreplications were analysed for the untransformed controlwhile six and eight independent replications were used forANT-2A and ANT-5A transgenic lines, respectively. In thesecond experiment, four independent replications wereanalysed for control, ANT-4A and ANT-7A transgenic lines.Each replication is represented by 100 T3 seeds randomlychosen from the total seed progeny of individual T2 homozy-gous plants. Seeds showing radicle protrusion from seed coatwere considered germinated. The germinated seeds werescored 1, 2, 3 and 7 days after imbibition, enabling themeasurement of the final germination percentage and of itsdynamics over time. The mean germination time (MGT) wasdetermined using the equation MGT=Σ(ni×ti)/Σn, where niwas the number of newly germinated seeds at time (ti) afterimbibing and n was the total number of germinated seeds. Atthe end of germination experiments, normal viable seedlingswere harvested and the seedling length, the average fresh anddry weight were measured.

Statistical Analysis

Data were subjected to the analysis of variance (ANOVA);mean comparison between untransformed control and ANTtransgenic lines was done using Dunnett’s test at the 1 and 5%levels of probability (SAS Proc GLM, SAS Institute Inc.,Cary, NC). The arcsine square root transformationwas appliedon percentage data.

Results

Production of Transgenic Plants and MolecularCharacterization

Six putative ANT transgenic T0 plant lines (ANT-2A, ANT-4A, ANT-4B, ANT-5A, ANT-7A and ANT-12F, respectively)were regenerated in vitro with a transformation frequency of10.2 %. For further analyses, an untransformed T0 plant line(WT) was randomly selected from different untransformedin vitro regenerated T0 lines that underwent the same experi-mental procedures as the transgenic lines. Compared with theuntransformed control plants, the T0 transformants showednormal development and plant morphology.

Five putatively transgenic T0 plant lines (ANT-2A, ANT-4A, ANT-4B, ANT-5A and ANT-7A) were initially analysedusing PCR amplification to detect the presence of the exoge-nous sequences (nptII, ANT and USP). All the transgenesequences (600-bp band for nptII, 688-bp band for USP and1,700-bp band for ANT) were identified in the tested lines(Fig. 1). PCR analysis on T1 progeny representative of all

Plant Mol Biol Rep

independent transformation events also confirm the presenceof nptII and ANT genes in all the T1 tested plants (data notshown).

To evaluate the transgene copy number, a QRT-PCR anal-ysis was performed using the APX gene encoding the cyto-solic isoform of ascorbate peroxidase as endogenous control.The specificity of QRT-PCR primers was verified by normalPCR amplification of barrel medic genomic DNAs. As shownin Table 1, the nptII and ANT transgenes were estimated to bea single copy in ANT-2A and ANT-4A, while two copies weredetected in ANT-5A and ANT-7A transgenic lines and threecopies in the ANT-4B transgenic line. These results showedthat ANT and nptII genes are integrated into the barrel medicgenome.

As a preliminary control of transgene expression for theANT gene driven by the seed-specific USP promoter, pods ofT1 plants from each of the five transgenic lines were harvestedin three different developmental stages and analysed by RT-PCR. As shown in Fig. 2, a transcript of the ANT gene wasdetected in all the tested transgenic lines, but not in theuntransformed control. T2 progenies from T1 plants of trans-genic lines which showed the highest and most stable expres-sion pattern along all stages were selected for further analyses.

Expression of ANT gene was also validated by QRT-PCRon pods of T2 control and selected transgenic plant lines. The

ANOVA revealed significant differences (p<0.0001) amongthe tested lines for the average level of target mRNA. Theaverage expression level of ANT detected in ANT-2A, ANT-4A, ANT-5A and ANT-7A transgenic lines was significantlyhigher than that observed in the control pods. The highest ANTexpression levels, on average, were observed for ANT-7A(34.6-fold) followed by the ANT-4A (26.6-fold), ANT-2A(21-fold) and ANT-5A (15.2 fold) transgenic lines (Fig. 3).

Expression of ANT Led to the Production of Larger Seeds

To investigate whether seed-specific expression of ANT af-fected seed yield parameters, a greenhouse trial was carriedout using T2 transgenic and control plants. No significantdifferences (p=0.28) in the average number of pods per plantwere observed between ANT transformants and untrans-formed control (Table 2). On average, this seed-yield compo-nent ranged from 17.8 to 22.6 pods per plant. Seed production(expressed as the number of seeds per plant and total seedweight per plant) was significantly reduced in the T2 progenyof the transgenic line ANT-2Awhen compared to the control

Fig. 1 PCR analysis on five putative transgenic barrel medic plant lines(T0 generation). Presence of nptII gene (a), USP promoter (b) and ANTgene (c), respectively. ANT-2A, ANT-4A, ANT-4B, ANT-5A and ANT-7A: transgenic barrel medic lines; WT: untransformed control; MK:marker 1Kb (Fermentas); C+: plasmid pBI-USPANT

Table 1 Evaluation oftransgene nptII and ANTcopy number in ANTtransgenic lines carriedout by QRT-PCR

Transgenicline

nptII copynumber

ANT copynumber

ANT-2A 1.12±0.09 1.05±0.16

ANT-4A 1.27±0.12 1.33±0.10

ANT-4B 2.97±0.09 3.15±0.21

ANT-5A 2.07±0.17 1.76±0.04

ANT-7A 1.98±0.13 1.73±0.05

Fig. 2 RT-PCR analysis of ANT transcript level in pods collected at threedifferent developmental stages from T1 plants. ANT-2A, ANT-4A, ANT-5A, ANT-7A and ANT-4B: transgenic barrel medic lines; WT: untrans-formed control; MK: marker 1Kb (Fermentas); C+: plasmid pBI-USPANT; C–: plasmid pBI121

Plant Mol Biol Rep

progeny. On the other hand, the same transgenic line showed asignificant increase in individual seed weight (4.2 mg) com-pared to the control (3.7 mg). No significant differencesbetween the other ANT transgenic lines and the untransformedcontrol were observed for either seed yield per plant or indi-vidual seed weight. The ANOVA revealed significant differ-ences (p<0.0001) among the tested lines for the averagenumber of seeds per pod. The transgenic line ANT-2A showeda significant reduction in the number of seeds per pod com-pared to the control, while ANT-5A produced a significantlyhigher seed number per pod (Table 2).

Image analysis was applied to mature dried seeds collectedfrom untransformed control and transgenic T2 plants to assessthe average seed sizemeasured as the area (mm2) of individualseed images (Fig. 4). Significant differences (p<0.0001)

among the tested lines for the average area of individual seedswere observed. As shown in Table 3, a significant increase inthe average area of individual seeds was recorded in all theANT transgenic lines (from 5.6 to 6.1 mm2) when compared tothat evidenced in control seeds (5.2 mm2). As far as theindividual seed volume is concerned, no significant differ-ences (p=0.60) among tested lines were observed (Table 3).

To evaluate whether ANT expression could affect thegrowth performance of transgenic plants, a trial was carriedout in a growth chamber using transgenic and control plants ofthe T3 generation. Compared to the untransformed control, theANT-expressing transgenic lines showed similar phenotypiccharacteristics. No significant differences between control andANT transformants were found at the end of the growth periodfor shoot or root dry weight (Online Resource 2).

Therefore, the seed-specific expression of ANT in barrelmedic led to the production of larger seeds, but the transgenehad no significant overall effect on individual seed weight.Besides, T3 larger transgenic seeds produced plants withgrowth performances not significantly different from thoseof the control plants of the same generation.

Larger Seeds of ANT Transformants Is Related to an Increasein Cotyledon Cell Size

To elucidate the mechanism by which individual seed arearesulted enlarged in the ANT transformants, mature T3 dryseeds from untransformed control as well as from the ANT-2A, ANT-4A, ANT-5A and ANT-7A transgenic lines wereexamined using a high-resolution light microscopy. The stor-age parenchyma cells of cotyledons were examined as they arethe main contributors to seed size: the cells were round and theintracellular organization appeared generally uniform, thestorage vacuoles being the most prominent feature (Fig. 5a,

Fig. 3 Results from QRT-PCR analyses carried out on pods of T2

selected transgenic and untransformed control plants. ANT-2A, ANT-4A, ANT-5A and ANT-7A: transgenic barrel medic lines and WT:untransformed control. For each line, values are expressed as means±SE from three independent replications. LogRFU, logarithm of relativefluorescence unit. Two asterisks indicates significant differences fromWT at 1% according to Dunnett’s test

Table 2 Yield components of untransformed control (WT) and transgenic barrel medic plant lines expressing the Arabidopsis AINTEGUMENTA (ANT)-encoding gene

Plant line Number ofpods per plant

Number ofseeds per plant

Total dry weightof seeds (mg) per plant

Dry weightof seed (mg)

Number ofseeds per pod

WT 22.6±1.2 133.6±8.2 490±30 3.7±0.08 5.9±0.17

ANT-2A 20.6±1.4 68.8±3.7** 290±20** 4.2±0.09** 3.5±0.18**

ANT-4A 22.2±3.6 115±17.1 400±60 3.6±0.13 5.3±0.4

ANT-5A 17.8±1.2 131.7±10 510±40 3.8±0.06 7.4±0.17**

ANT-7A 22.4±2.4 131.1±13.7 460±50 3.5±0.05 5.9±0.23

F 1.3 11.74 7.91 10.72 51.14

df 4 4 4 4 4

Probability 0.28 <0.0001 <0.0001 <0.0001 <0.0001

For each line, data represent the mean values ±SE from 21 (WT), 17 (ANT-2A), 5 (ANT-4A), 10 (ANT-5A) and 8 (ANT-7A) T2 homozygous plants

F F significance test, df degrees of freedom

**Means significantly different from WT at 1 % according to Dunnett’s test

Plant Mol Biol Rep

b). ANOVA revealed significant differences (p<0.0001) in thecotyledon cell area among the tested lines (Table 4). Theaverage area of cotyledon cells of ANT-2A, ANT-4A, ANT-5A and ANT-7A transgenic seeds was significantly highercompared to the control, according to Dunnett’s test. Asexpected, all ANT transformants had significant fewer cellsper unit area than the control (Table 4). Microscopic analysiswas further carried out on radicle columnar parenchyma cellsof both untransformed control and representative ANT-5Atransgenic lines. Although ANT-5A did not display thehighest ANT expression level, it was selected among ANTtransformants because it produced the largest seeds. No sig-nificant differences (p=0.38 and p=0.98, respectively) wereobserved in the average cell area and cell number per unit area

between untransformed control (158.9 μm2 and 96.3, respec-tively) and ANT-5A transgenic line (153.1 μm2 and 96.1,respectively).

We measured the area occupied by storage vacuoles insidethe parenchyma cotyledon cells. The quantitative image anal-ysis showed that all ANT transgenic lines showed a significantincrease in the average area of storage vacuoles when com-pared to the untransformed control (Table 5). The average areaof storage vacuoles in cotyledon cells was 7.6 μm2 for theuntransformed control and 13.9, 17.2, 13.5 and 14.9 μm2 forANT-2A, ANT-4A, ANT-5A and ANT-7A, respectively. TheANOVA also revealed significant differences (p<0.0001)among the tested lines for the average number of storagevacuoles per cell. According to Dunnett’s test, the transgenicline ANT-5A showed a significantly greater number of storagevacuoles per cell (Table 5).

Total protein content in dry seeds of untransformed andANT transgenic lines was analysed by dry combustion. Nosignificant (p=0.63) differences between ANT transformantsand untransformed control were observed (Online resource 3).

Based on these evidences, we concluded that the ANTexpression in transgenic T3 mature seeds enhanced signifi-cantly the size of cotyledon storage parenchyma cells and ofthe intracellular storage vacuoles.

Effect of ANT Expression on Seed Germination and SeedlingGrowth

To study the role of ANT in seed germination, the germinationpercentage of ANT transgenic T3 seeds was evaluated during a7-day germination assay. As shown in Fig. 6, the percentageof seeds with an emerged radicle was consistently greaterthroughout the trials in ANT transformants than in the untrans-formed control. ANOVA revealed significant differences

Fig. 4 Mature T3 dried seedsfrom untransformed control (WT)and transgenic (ANT2A, ANT-4A, ANT-5A and ANT-7A) barrelmedic lines. Bars=1 mm

Table 3 Seed area and seed volume of untransformed control (WT) andtransgenic barrel medic plant lines expressing the ArabidopsisAINTEGUMENTA (ANT)-encoding gene

Plant line Seed area(mm2)

Seed volume(mm3)

WT 5.2±0.06 5.43±0.14

ANT-2A 5.7±0.12** 5.16±0.32

ANT-4A 5.7±0.18** 5.50±0.06

ANT-5A 6.1±0.07** 5.48±0.09

ANT-7A 5.6±0.07** 5.49±0.08

F 10.63 0.70

df 4 4

Probability <0.0001 0.60

For each line, data represent the mean values±SE of the total T3 seedprogeny (seed area) or fifty T3 seeds (seed volume) from five to 21different T2 plants

F F significance test, df degrees of freedom

**Means significantly different from WT at 1 % according to Dunnett’stest

Plant Mol Biol Rep

among the tested lines for the average germination percentage(Table 6). According to Dunnett’s test, the final germinationpercentage of ANT-4A, ANT-5A and ANT-7A transgenicseeds was significantly higher compared to the control.

Furthermore, the ectopic expression of ANT in transgenicbarrel medic also influenced the mean time of germination(MTG). In the first trial, ANOVA revealed significant differences(p=0.02) among the tested lines for MTG which was signifi-cantly lower for ANT-2A (1.7 days) and ANT-5A (1.6 days)compared to the untransformed control (1.9 days). Similarly, inthe second experiment, ANOVA revealed significant differences(p=0.03) among the tested lines. According to Dunnett’s test,MTG was significantly lower for ANT-7A (1.1 days) comparedto the untransformed control (1.4 days). Moreover, ANT-4Ashowed a lower (1.2 days) MTG than those of control seeds.

Concerning the percentage of normal viable seedlings re-corded 7 days after seed imbibition, only ANT-4A and ANT-7A produced significantly higher percentage of normal viableseedlings than control seeds, according to Dunnett’s test(Online resource 4 and 5). As far as seedling fresh weight isconcerned, ANOVA revealed significant differences amongthe tested lines (Online resource 4 and 5). According to

Dunnett’s test, the average fresh weight of ANT-2A, ANT-5A and ANT-7A transgenic seedlings was significantly great-er than that observed for the untransformed control while nosignificant differences were observed for seedling dry weight.Furthermore, ANT-7A produced seedlings significantly lon-ger than untransformed control (Online resource 4 and 5).

These data suggested a role for ANT in positively regulat-ing the seed germination process in barrel medic. As forseedling development, overall, the only effect observed wasrestricted to the seedling fresh weight that is related to thewater content of the seedling tissues.

Discussion

Seed size is an important trait in higher plant species, inparticular in forage crops such as Medicago spp., Seeds areformed by the coordinated growth of maternal (seed coat) andzygotic (the diploid embryo and the triploid endosperm) tis-sues that develop simultaneously in the seed (Van Daele et al.2012). The size of seeds is known to be influenced by

Fig. 5 Microscopic observationof longitudinal sections ofMedicago truncatula mature T3seeds. a and b Cotyledonparenchyma cells stained withtoluidine blue fromuntransformed control and ANT-transgenic lines, respectively.Bar=10 μM

Table 4 Cell area and cell number per unit area of cotyledon cells ofuntransformed control (WT) and ANT transgenic T3 seeds

Plant line Cell area(μm2)

Cell numberper unit area

WT 93.7±2.4 149.1±3.6

ANT-2A 237.7±8.3** 84.4±9.2**

ANT-4A 131.9±3.9** 77.4±7.6**

ANT-5A 139.9±4.4** 102.7±8.4**

ANT-7A 120.2±3.5** 92.0±6.2**

F 123.7 15.2

df 4 4

Probability <0.0001 <0.0001

For each barrel medic line, data represent the mean values±SE (n=100cells)

F F significance test, df degrees of freedom

**Means significantly different from WT at 1 % according to Dunnett’stest

Table 5 Average area and number of storage vacuoles in cotyledon cellof untransformed control (WT) and ANT transgenic T3 seeds

Plant line Area of storagevacuoles (μm2)

N. of storagevacuoles per cell

WT 7.6±0.4 9.7±0.4

ANT-2A 13.9±0.6** 11.1±0.7

ANT-4A 17.2±1.0** 10.8±0.5

ANT-5A 13.5±0.4** 12.1±0.7*

ANT-7A 14.9±1.2** 8.0±0.5

F 14.16 8.47

df 4 4

Probability <0.0001 <0.0001

For each barrel medic line, data represent the mean values±SE (n=30cells)

F F significance test, df degrees of freedom

*Means significantly different from WT at 5 % according to Dunnett’stest; **means significantly different from WT at 1 % according toDunnett’s test

Plant Mol Biol Rep

parent-of-origin effects, and the final seed size is determinedby the coordinated progression of cell proliferation and cellenlargement during seed growth and development. Severalgenes that regulated final seed size through their effects oncell production and/or cell expansion have been identified andcharacterized (Linkies et al. 2010; Sun et al. 2010). In partic-ular, the ectopic expression of AINTEGUMENTA (ANT), anAP2 transcription factor, increased cell proliferation inArabidopsis and tobacco and led to larger organs, includingseeds (Mizukami and Fischer 2000).

To investigate the role of ANT on seed development, wehave produced and characterized transgenic barrel medic(M. truncatula Gaertn.) lines in which the Arabidopsis ANTgene was expressed under the control of the seed-specificUSPpromoter from V. faba. The USP promoter has been tested tomediate seed-specific gene expression in various plant species(Saalbach et al. 2001; Zakharov et al. 2004; Scheller et al.

2006). Our results confirmed these observations. Under thecontrol of the seed-specific USP promoter, the ANT gene wasexpressed in transgenic barrel medic pods and the expressionlevels varied in the different transgenic lines. The absence oflinear correlation between copy number and gene expressionin some ANT transformants could be due to transcriptionaland/or post-transcriptional gene silencing phenomena (Butayeet al. 2005; Singer et al. 2012).

Single gene mutations or ectopic expression of genes thataffect seed size often cause potentially undesiderable pleiotro-pic effects on plant development. For example, ARF2mutantsproduced larger seeds but also displayed pleiotropic effects onvegetative and floral development and reduced fertility(Schruff et al. 2006). In our trials, either in greenhouse orgrowth chamber environments, no negative pleiotropic effectwas evidenced as all the T2 and T3 homozygous transgenicplants showed morphological characteristics similar to theuntransformed control plants. Moreover, the transgenic barrelmedic lines did not differ from the control for fertility traitswith the exception of ANT-2A that showed a significantdecrease of pod fertility resulting in an enhanced individualseed weight. On the contrary, according to Mizukami andFischer (2000) ectopic ANT expression in Arabidopsis result-ed in male and female sterility. Nole-Wilson et al. (2005)showed that ectopic expression of AIL5 increased floral organsize but transgenic Arabidopsis plants exhibited a reducedfertility, which appeared to be correlated with the organ sizephenotype, as transformants with the largest floral organsproduce the fewest seeds. Overall, the absence of pleiotropiceffects in our transgenic lines might be related to the differentexperimental conditions (seed-specificUSP promoter vs. con-stitutive 35SCaMV promoter) and also influenced by thedifferent types of plant materials (T2 and T3 barrel medicplants vs. T1 Arabidopsis and R0 tobacco plants).

Previous studies, performed on Arabidopsis thaliana andtobacco, showed that the ANT gene expression, driven by the35SCaMV promoter, determines the production of larger seeds(Mizukami and Fischer 2000). However no quantitative dataand statistics about the seed phenotype was provided. More

Table 6 Average germination percentage of untransformed control (WT)and ANT transgenic T3 seeds, 7 days after seed imbibition

I° experiment II° experiment

Plantline

Germination(%)

Plantline

Germination(%)

WT 63.8±2.3 WT 63.5±7.0

ANT-2A 72.2±1.0 ANT-4A 84.1±2.9*

ANT-5A 73.8±3.1* ANT-7A 92.1±0.6**

F 3.68 F 12.76

df 2 df 2

Probability 0.04 Probability 0.002

In the first experiment, data represent the mean values±ES from five(WT), six (ANT-2A transgenic line) and eight (ANT-5A transgenic line)independent replications while in the second trial four independent rep-lications were used for each barrel medic line. Each replication is repre-sented from 100 seeds

F F significance test, df degrees of freedom

*Means significantly different from WT at 5 % according to Dunnett’stest; **means significantly different from WT at 1 % according toDunnett’s test

Fig. 6 Germinationperformances of ANT transgeniclines. a Average germinationpercentage of untransformedcontrol (WT), ANT-2A and ANT-5A. b Average germinationpercentage of untransformedcontrol (WT), ANT-4A and ANT-7A

Plant Mol Biol Rep

recently, Van Daele et al. (2012) carried out a comparativeseed parameter analysis inA. thalianamutants and transgenicsand, relatively to Arabidopsis ANT transformants they pro-duced, did not confirm these findings. Our experimental dataclearly demonstrated that in all transgenic T2 barrel mediclines ectopically expressing the ANT gene, mature seeds weresignificantly enlarged by 8–16 %. Except for ANT-2A, podfertility of ANT transgenic barrel medic lines was not reduced,indicating that the increase in individual seed area was mainlydue to altered seed development. The enhanced seed areaobserved is related with the ANT transcription level.However, this relationship was not linear, since the transgenicline with the largest seeds (ANT-5A) did not also display thehighest expression level. Previous studies showed that mRNAaccumulation is sometimes a poor indicator of the correspond-ing protein levels and/or phenotype (Jack et al. 1994; Cloughet al. 1995; Endo et al. 2005). Poor correspondence betweenmRNA transcript levels and phenotypic effects might be dueto translational and post-translational processes and/or inter-actions between ectopically expressed ANT and endogenousgenes related to seed development.

In Arabidopsis ectopically expressing the ANT transcrip-tion factor, the size of vegetative organs was normal, whilefloral organs were enlarged (Krizek 1999). The increased sizeof sepals is the result of enhanced cell division while theincreased size of petals, stamens and carpels was attributedto the presence of larger cells. However, it remains unclearwhy the mechanisms at the basis of the increase in sizediffered in different floral organs. Mizukami and Fischer(2000) examined the effects of gain of ANT function ontobacco and Arabidopsis organ growth and demonstrated thatectopic ANT expression is sufficient to enhance organ size byincreasing cell proliferation. During organogenesis, ANT me-diates cell proliferation and organ growth by maintaining themeristematic competence of cells, thereby prolonging theperiod in which cells are able to divide. Conversely, the lossof ANT function reduced the duration of cell proliferation andthus resulted in smaller organs. Furthermore, ectopic expres-sion of ANT (AIL5) gene in Arabidopsis resulted in largerfloral organs, similar to that resulting from ectopic expressionof ANT, and suggest that AIL5, like ANT, might promotegrowth within developing floral organs (Nole-Wilson et al.2005). More recently, expression of the ANT (AIL6) gene hasbeen shown to increase the growth of floral organs (Krizekand Eaddy 2012). AIL6 transgenic plants also displayedchanges in organ morphology. These phenotypic observationsare associated with alterations in the pattern and duration ofcell divisions within developing organs. Finally, ectopic ex-pression of ANT (PnANTL1 and PnANTL2, respectively)genes from Populus nigra has been shown to increase leafsize in transgenic tobacco by affecting cell expansion (Kuluevet al. 2012). In conclusion, both cell proliferation and cellexpansion were proven to play a role in organ size increase

mediated by ANT or ANT-like genes. The fact that ectopicexpression of ANT in barrel medic led to seed area enhance-ment evidence that ANT may play an important role in organsize also in this legume species. The increased seed area ofANT transformants could be the consequence of increased celldivision, increased cell expansion or combination of the two.Since the localization of USP protein in V. faba seeds has beendemonstrated in parenchyma cells of cotyledons (Van Sonet al. 2009), it is reasonable to expect that the ANT expression,driven by USP promoter, would be confined to storage paren-chyma cells of seed cotyledons and influence their growth.Microscopic measurements on mature seeds showed that cot-yledon storage parenchyma cells, which account for the majorpart of the seed, were significantly larger (1.3 to 2.5-fold) in allANT transgenic lines than those in the untransformed control,suggesting that enhanced cell expansion is mainly responsiblefor the production of larger seeds. It could be noticed thecotyledon cell area increase in ANT transformants (68 % onaverage) was much higher than the increase in the area ofindividual seeds (11 % on average). Consequently, a possibledirect influence of ANT on cotyledon cell number and/orindirect effect on endogenous genes controlling cell prolifer-ation in seeds cannot be excluded. However, our experimentaldata clearly showed that the ectopic expression ofANT gene intransgenic barrel medic seeds affected cell enlargement.Differences observed among the above reported studies mayreflect differences in the origin of promoter employed andtissue-specific differences in ANT expression as well as genet-ic variation among the species examined. Seed-specific ex-pression of ANT also affects the storage vacuoles: the signif-icant differences in the average area of storage vacuoles inANT transgenic cells might be a secondary effect because ofthe alterations in seed development.

To evaluate the potential of ANT to affect seed size andyield, we have tested T2 transgenic barrel medic lines undergreenhouse experimental conditions. Despite the positive ef-fects of ANT on seed area, in general, ANT transformants didnot lead to higher yield in terms of total seed weight per plantand individual seed weight. In addition, there were no signif-icant differences in the average volume of individual seedsbetween untransformed control and ANT transgenic lines.However, the ANT-2A transgenic line showed under green-house conditions a significant increase (14 %) in individualseed weight; this gain did not result in an increased total seedyield per plant because the average number of seeds per plantand per pod were significantly lower than in the untrans-formed control. The enhanced seed weight observed mightbe an indirect effect of the reduced within-pod competition forresources due to the decrease of seed number per pod. Thistrade-off between seed number and seed weight is supportedby the common sharing of a limited supply of resourcesamong yield components (Venable 1992). A negative corre-lation between seed number and seed size has been frequently

Plant Mol Biol Rep

documented in crop species (Kiniry et al. 1990; Borrás andOtegui 2001). Relatively, to the overall significant increase inseed area not resulting in seed volume and seed weight en-hancement, some possible explanations could be advanced:due to the spiral structure of pod and to the seed position in it,seed planar expansion is limited only by the width of the coilwhile volume expansion is hampered by the tight spirallingand contraction of mature pod. On the other hand, the abilityof ANT transgenic plants to supply nutrients to seeds notsignificantly different in number from the control plants(Table 2) and significantly larger (Table 3) could be a limitingfactor. Consistently with this hypothesis, the only transgenicline showing a significant seed weight increase is ANT-2Awith a significantly lower number of seeds per pod and plant.

Enhancing the potential for large seed sizes representsone of the most promising and less-explored avenues forsignificant increases in agricultural yields (Sun et al. 2010).In many plant species, seed size has been implicated as animportant determinant in seed germination, seedling survivaland vigour which are crucial steps for stand establishment ofcrops (Rao 1981; Leishman et al. 2000; Westoby et al.2002). During the recent years, considerable efforts by ge-netic engineering or mutant studies have been made inplants, particularly in Arabidopsis, to address fundamentalquestions related to the molecular mechanisms underlyingseed development and size control (Linkies et al. 2010; Sunet al. 2010; Van Daele et al. 2012). Relative to legumespecies, many studies have focused on seed developmentby using omics techniques (Le et al. 2007; Thompson et al.2009). To date, no information is available in legume speciesabout the effects of seed-specific expression of transcription-al regulators on seed development and the relationship withseed germination and seedling growth. Using a seed-specificUSP promoter from V. faba coupled to an Arabidopsis ANTgene, we have obtained transgenic barrel medic lines whichproduced larger seeds leading to significantly greater per-centages of germination. Large seeds have been demonstrat-ed to have a competitive advantage over smaller seeds byhaving greater germination percentages and greater nutrientreserves for the young seedlings (Westoby et al. 2002; Wuand Du 2007; Easton and Kleindorfer 2008; Hojjat 2011). Apossible explanation of the greater germination percentagesobserved in ANT transgenic seeds could be related to thepresence of larger seeds and larger parenchyma cotyledoncells which contained larger storage vacuoles. These cellscould supply more resources, in particular nitrogenous com-pounds which represent the major reserves in M. truncatulaseeds (Djemel et al. 2005), to support seed germination andearly seedling growth. However, no positive relationshipbetween germination performances and the total proteincontent of seeds was found in our study. On the other hand,composition of storage proteins and/or specific protein con-tents such as those related to the mobilization and

conversion of the stored nitrogen reserves could be moreappropriate for establishing correlations with germinationperformances (Gardarin et al. 2011). Mobilization of nitro-gen reserves as a source of energy and nutrients has beendescribed as a crucial process related to seed germinationand seedling establishment (Garciarrubio et al. 1997; Tan-Wilson and Wilson 2012). This process contributes to pro-duce a complete spectrum of amino acids that can be usedeither as protein building blocks or precursors for key me-tabolites and that can play determinant roles in control ofgermination and seedling development (Gallardo et al. 2002;Glevarec et al. 2004). Furthermore, ANT transgenic seedsgerminate more rapidly than control seeds. Gardarin et al.(2011) hypothesized that germination timing partlydepended on the time required for seed imbibition.Imbibition should be faster in seeds with a large area forwater to enter relative to seed water demand, probablylinked to seed mass. The larger parenchyma cotyledon cellscould act positively on the extent and dynamics of waterimbibition in this seed tissue as suggested by the higherwater content (fresh weight) of the ANT transgenic barrelmedic seedlings. Our phenotypic observations are consistentwith previous studies that showed a negative relationshipbetween seed size and time of germination under controlledenvironmental conditions (Jurado and Westoby 1992;Simons and Johnston 2000). Based on these results, it isreasonable to assume that the ANT gene may be one of theimportant genetic factors associated with seed germination.High positive correlation between seed size and early seed-ling growth was reported in alfalfa (Beveridge and Wilsie1959; Carleton and Cooper 1972). Conversely, Cooper et al.(1979) observed higher seedling emergence in alfalfa fromsmall seeds than from large seeds. Although ANT transgenicseeds produced higher percentage of normal viable seedlingsthan untransformed control, no significant differences inseedling dry weight were observed.

In conclusion, our study shows that the ectopic expressionof ANT gene in barrel medic (M. truncatula) seeds promotedcell expansion, leading to enlarged seed production and im-proved seed germination. These results demonstrate a regula-tory role of ANT in controlling seed development and provideimportant insights into genetic factors that control seed size incrop plants.

Acknowledgments The authors thank Dr. Stefania Barzaghi for theseed image analysis and Dr. Luciano Pecetti for the critical reading of themanuscript. We are grateful to Francesco Lascala, Massimo Sari andAnnalisa Seminari (CRA-FLC, Lodi) and Giancarlo Carpinelli andMarco Guaragno (CNR-IGV, Perugia) for the excellent technical assis-tance. The scientific support of Dr. Efisio Piano (CRA-FLC, Lodi) andDr. Sergio Arcioni (CNR-IGV, Perugia) during the completion of theproject is greatly acknowledged. The research was supported by fundsfrom “Programma di ricerca speciale: Incremento della Produzione diProteine Vegetali per l’Alimentazione Zootecnica (legge 49/2001)”.

Plant Mol Biol Rep

References

Bäumlein H, Boerjan W, Nagy I, Bassüner R, Van Montagu M, Inzé D,Wobus U (1991) A novel seed protein gene from Vicia faba isdevelopmentally regulated in transgenic tobacco and Arabidopsisplants. Mol Gen Genet 225:459–467

Beaulieu JM, Moles AT, Leitch IJ, Bennett MD, Dickie JB, Knight CA(2007) Correlated evolution of genome size and seed mass. NewPhytol 173:422–437

Beveridge JL, Wilsie CP (1959) Influence of depth of planting, seed size,and variety on emergence and seedling vigor in alfalfa. Agron J 51:731–734

Bingham E, Armour D, Irwin J, Jayaraman D, Ané JM (2009) Report onprogress hybridizing herbaceous Medicago sativa and woodyM. arborea. Medicago Genetic Reports. http://www.medicago-reports.org/. Accessed 17 Feb 2014

Bögre L, Magyar Z, López-Juez E (2008) New clues to organ size controlin plants. Genome Biol 9:226

Borrás L, Otegui ME (2001) Maize kernel weight response to post-flowering source-sink ratio. Crop Sci 49:1816–1822

Butaye KMJ, Cammue BPA, Delaure SL, De Bolle MFC (2005)Approaches to minimize variation of transgene expression in plants.Mol Breed 16:79–91

Carleton AE, Cooper CS (1972) Seed size effects upon seedling vigor ofthree forage legumes. Crop Sci 2:183–186

Clough RC, Casal JJ, Jordan ET, Christou P, Vierstra RD (1995)Expression of functional oat phytochrome A in transgenic rice.Plant Physiol 109:1039–1045

Confalonieri M, Cammareri M, Biazzi E, Pecchia P, Fevereiro P,Balestrazzi A, Tava A, Conicella C (2009) Enhanced triterpenesapogenin biosynthesis and root nodulation in transgenic barrelmedic (Medicago truncatula Gaertn.) expressing a novel ß–amyrinsynthase (AsOXA1) gene. Plant Biotechnol J 7:172–182

Cook DR (1999) Medicago truncatula—a model in the making! CurrOpin Plant Biol 2:301–304

Cooper CS, Ditterline RL, Welty LE (1979) Seed size and seeding rateeffects upon stand density and yield of alfalfa. Agron J 71:83–85

Cosson V, Durand P, d'Erfurth I, Kondorosi A, Ratet P (2006)Medicagotruncatula transformation using leaf explants. Methods Mol Biol343:115–127

Djemel N, Guedon D, Lechevalier A, Salon C, Miquel M, Prosperi J-M,Rochat C, Boutin J-P (2005) Development and composition of theseeds of nine genotypes of the Medicago truncatula species com-plex. Plant Physiol Biochem 43:557–566

Dutta SK, Nema VK, Bhardwaj RK (1972) Physical properties of gram. JAgric Eng Res 12:128–137

Easton LC, Kleindorfer S (2008) Germination in two Australian speciesof Frankenia L., F. serpyllifolia Lindl. and F. foliosa J. Black(Frankeniaceae). Effects of seed mass, seed age, light, and temper-ature. Trans R Soc S Aust 132:29–40

Elliott RC, Betzner AS, Huttner E, Oakes MP, Tucker WJ, Gerentes D,Perez P, Smyth DR (1996) AINTEGUMENTA, an APETALA2-likegene ofArabidopsiswith pleiotropic roles in ovule development andfloral organ growth. Plant Cell 8:155–168

Endo T, Shimada T, Fujii H, Kobayashi Y, Araki T, Omura M (2005)Ectopic expression of an FT homolog from citrus confers an earlyflowering phenotype on trifoliate orange (Poncirus trifoliata L.Raf.). Transgenic Res 14:703–712

Firnhaber C, Pühler A, Küster H (2005) EST sequencing and time coursemicroarray hybridizations identify more than 700 Medicagotruncatula genes with developmental expression regulation inflowers and pods. Planta 222:269–283

Gallardo K, Job C, Groot SPC, Puype M, Demol H, Vandekerckhove JD(2002) Importance of methionine biosynthesis for Arabidopsis seedgermination and seedling growth. Physiol Plant 116:238–247

Gallardo K, Lesignor C, DarmencyM, Burstin J, ThompsonR, Rochat C,Boutin J-P, Kuester H, Buitink J, Leprince O, Limami A, GrusakMA (2006) Seed biology ofMedicago truncatula. In: Mathesius U,Journet EP, Sumner LW (eds) The Medicago truncatula handbook.http://www.noble.org/MedicagoHandbook/. Accessed 17 Feb 2014

Garciarrubio A, Legaria JP, Covarrubias A (1997) Abscisic acid inhibitsgermination of mature Arabidopsis seeds by limiting the availabilityof energy and nutrients. Planta 203:182–187

Gardarin A, Dürr C, Colbach N (2011) Prediction of germination rates ofweed species: relationships between germination speed parametersand species traits. Ecol Model 222:626–636

Gjuric R, Smith SR (1997) Inheritance in seed size of alfalfa: quantitativeanalysis and response to selection. Plant Breed 116:337–340

Glevarec G, Bouton S, Jaspard E, Riou M-T, Cliquet J-B, Suzuki A,Limami AM (2004) Respective roles of the glutamine synthetase/glutamate synthase cycle and glutamate dehydrogenase in ammoni-um and amino acid metabolism during germination and post-germinative growth in the model legume Medicago truncatula.Planta 219:286–297

Grotkopp E, Rejmanek M, Sanderson MJ, Rost TL (2004) Evolution ofgenome size in Pines (Pinus) and its life-history correlates: supertreeanalyses. Evolution 58:1705–1729

Haas TJ, Thomas EM (2004) Survey of seeds per gram of individualalfalfa plants. Medicago Genetic Reports. http://www.medicago-reports.org/. Accessed 17 Feb 2014

Hansen B (1989) Determination of nitrogen as elementary N, an alterna-tive to Kjeldhal. Acta Agric Scand 39:113–118

Harper JL, Lovell PH, Moore KG (1970) The shapes and sizes of seeds.Annu Rev Ecol Syst 1:327–356

Hojjat SS (2011) Effects of seed size on germination and seedling growthof some Lentil genotypes (Lens culinarisMedik.). Int J Agric CropSci 3:1–5

Jack T, Fox GL, Meyerowitz EM (1994) Arabidopsis homeotic geneAPETALA3 ectopic expression: transcriptional and posttranscrip-tional regulation determine floral organ identity. Cell 76:703–716

Johnson K, Lenhard M (2011) Genetic control of plant organ growth.New Phytol 191:319–333

Jurado E, Westoby M (1992) Germination biology of selected centralAustralian plants. Aust J Ecol 17:341–348

Kiniry JR, Wood CA, Spanel DA, Bockholt AJ (1990) Seedweight response to decreased seed number in maize. AgronJ 54:98–102

Klucher KM, Chow H, Reiser L, Fischer RL (1996) TheAINTEGUMENTA gene of Arabidopsis required for ovule and fe-male gametophyte development is related to the floral homeoticgene APETALA2. Plant Cell 8:137–153

Knight CA, Ackerly DD (2002) Variation in nuclear DNA content acrossenvironmental gradients: a quantile regression analysis. Ecol Lett 5:66–76

Knight CA,Molinari NA, Petrov DA (2005) The large genome constrainthypothesis: evolution, ecology, and phenotype. Ann Bot 95:177–190

Koelewijn HP, Van Damme JMM (2005) Effects of seed size, inbreedingand maternal sex on the offspring performance of gynodioeciousPlantago coronopus. J Ecol 93:373–383

Krannitz PG, Aarssen LW, Dow JM (1991) The effect of geneticallybased differences in seed size on seedling survival in Arabidopsisthaliana (Brassicaceae). Am J Bot 78:446–450

Krizek BA (1999) Ectopic expression of AINTEGUMENTA inArabidopsis plants results in increased growth of floral organs.Dev Genet 25:224–236

Krizek BA, Eaddy M (2012) AINTEGUMENTA-LIKE6 regulates cellulardifferentiation in flowers. Plant Mol Biol 78:199–209

Kuluev BR, Knyazev AV, Iljassowa AA, Chemeris AV (2012) Ectopicexpression of the PnANTL1 and PnANTL2 black poplar genes intransgenic tobacco plants. Russ J Genet 48(10):993–1000

Plant Mol Biol Rep

Le BH, Wagmaister JA, Kawashima T, Bui AQ, Harada JJ, Goldberg RB(2007) Using genomics to study legume seed development. PlantPhysiol 144:562–574

Leishman MR (2001) Does the seed size⁄number trade-off model deter-mine plant community structure? An assessment of the modelmechanisms and their generality. Oikos 93:294–302

LeishmanMR,Wright IJ,Moles AT,WestobyM (2000) The evolutionaryecology of seed size. In: Fenner M (ed) Seeds—the ecology ofregeneration in plant communities. CAB International,Wallingford, pp 31–57

Linkies A, Graeber K, Knight C, Leubner-Metzger G (2010) The evolu-tion of seeds. New Phytol 186:817–831

Mason G, Provero P, Vaira AM, Accotto GP (2002) Estimating thenumber of integrations in transformed plants by quantitative real-time PCR. BMC Biotechnol 2:1–10

Mizukami Y, Fischer RL (2000) Plant organ size control:AINTEGUMENTA regulates growth and cell numbers during organ-ogenesis. Proc Natl Acad Sci U S A 97:942–947

Nole-Wilson S, Tranby TL, Krizek BA (2005) AINTEGUMENTA-like(AIL) genes are expressed in young tissues and may specify meri-stematic or division-competent states. Plant Mol Biol 57:613–628

Orsi CH, Tanksley SD (2009) Natural variation in an ABC transportergene associated with seed size evolution in tomato species. PLoSGenet. doi: 10.1371/journal.pgen.1000347

Pay A, Heberle-Bors E, Hirt H (1992) An alfalfa cDNA encodes a proteinwith homology to translationally controlled human tumor protein.Plant Mol Biol 19:501–503

PorcedduA, Panara F, Calderini O,Molinari L, Taviani P, Lanfaloni L, ScottiC, Carelli M, Scaramelli L, Bruschi G, Cosson V, Ratet P, deLarambergueH,DucG, PianoE,Arcioni S (2008)An Italian functionalgenomic resource forMedicago truncatula. BMC Res Notes 1:129

Ramakers C, Ruijter JM, Deprez RH, Moorman AFM (2003)Assumption-free analysis of quantitative real-time polymerase chainreaction (PCR) data. Neurosci Lett 339:62–66

Rao SK (1981) Influence of seed size on field germination, seedlingvigour, yield and quality in self pollinated crops—a review. AgricRev 2:95–101

Rogers C, Wen J, Chen R, Oldroyd G (2009) Deletion-based reversegenetics in Medicago truncatula. Plant Physiol 151:1077–1086

Rotili P, Gnocchi G, Scotti C, Zannone L (1999) Some aspects ofbreeding methodology in alfalfa. In: Proceedings of The AlfalfaGenome Conference, Madison, WI, USA, www.naaic.org/TAG/TAGpapers/rotili/rotili.html. Accessed 17 Feb 2014

Saalbach I, Giersberg M, Conrad U (2001) High-level expression of asingle chain Fv fragment (scFv) antibody in transgenic pea seeds. JPlant Physiol 158:529–533

Scaramelli L, Balestrazzi A, Bonadei M, Piano E, Carbonera D,Confalonieri M (2009) Production of transgenic barrel medic(Medicago truncatula Gaertn.) using the ipt-type MAT vector sys-tem and impairment of recombinase-mediated excision events. PlantCell Rep 2:197–211

Scheller J, Leps M, Conrad U (2006) Forcing single-chain variablefragment production in tobacco seeds by fusion to elastin-like poly-peptides. Plant Biotechnol J 4:243–249

Schruff MC, Spielman M, Tiwari S, Adams S, Fenby N, Scott RJ (2006)TheAUXIN RESPONSE FACTOR 2 gene of Arabidopsis links auxin

signalling, cell division, and the size of seeds and other organs.Development 133:251–261

Scotti C, Gnocchi G (2004) Seed size and fertility relationships of WI643alfalfa grown at Lodi, Italy. Medicago Genetic Reports. http://www.medicago-reports.org/. Accessed 17 Feb 2014

Simons AM, Johnston MO (2000) Variation in seed traits of Lobeliainflata (Campanulaceae): sources and fitness consequences. Am JBot 87:124–132

Singer SD, Liu Z, Cox KD (2012) Minimizing the unpredictability oftransgene expression in plants: the role of genetic insulators. PlantCell Rep 31:13–25

SunX, Shantharaj D, Kang X, NiM (2010) Transcriptional and hormonalsignaling control of Arabidopsis seed development. Curr Opin PlantBiol 13:611–620

TadegeM,Wen J, He J, Tu H, Kwak Y, Eschstruth A, Cayrel A, Endre G,Zhao PX, Chabaud M, Ratet P, Mysore KS (2008) Large-scaleinsertional mutagenesis using the Tnt1 retrotransposon in the modellegume Medicago truncatula. Plant J 54:335–347

Tanska M, Konopka M, Rotkiewicz D (2008) Relationships of rapeseedstrength properties to seed size, colour and coat fibre composition. JSci Food Agric 88:2186–2193

Tan-WilsonAL,WilsonKA (2012)Mobilization of seed protein reserves.Physiol Plant 145:140–153

Thompson R, Burstin J, Gallardo K (2009) Post-genomics studies ofdevelopmental processes in legume seeds. Plant Physiol 151:1023–1029

Trinh TH, Ratet P, Kondorosi E, Durand P, Kamaté K, Bauer P,Kondorosi A (1998) Rapid and efficient transformation of diploidMedicago truncatula and Medicago sativa ssp. falcata lines im-proved in somatic embryogenesis. Plant Cell Rep 17:345–355

Van Daele I, Gonzalez N, Vercauteren I, de Smet L, Inzé D, Roldán-RuizI, VuylstekeM (2012) A comparative study of seed yield parametersin Arabidopsis thalianamutants and transgenics. Plant Biotechnol J10:488–500

Van Son L, Tiedemann J, Rutten T, Hillmer S, Hinz G, Zank T,Manteuffel R, Bäumlein H (2009) The BURP domain proteinAtUSPL1 of Arabidopsis thaliana is destined to the protein storagevacuoles and overexpression of the cognate gene distorts seeddevelopment. Plant Mol Biol 71:319–329

Venable DL (1992) Size-number trade-offs and the variation of seed sizewith plant resource status. Am Nat 140:287–304

Westoby M, Falster DS, Moles AT, Vesk PA, Wright IJ (2002) Plantecological strategies: some leading dimensions of variation betweenspecies. Annu Rev Ecol Syst 33:125–159

Wu GL, Du GZ (2007) Germination is related to seed mass in grasses(Poaceae) of the eastern Qinghai-Tibetan Plateau, China. Nord J Bot25:361–365

Yi CX, Zhang J, Chan KM, Liu XK, Hong Y (2008) Quantitative real-time PCR assay to detect transgene copy number in cotton(Gossypium hirsutum). Anal Biochem 375:150–152

Young ND, Debellé F, Oldroyd GE et al (2011) The Medicago genomeprovides insight into the evolution of rhizobial symbioses. Nature480:520–524

Zakharov A, Giersberg M, Hosein F, Melzer M, Müntz K, Saalbach I(2004) Seed-specific promoters direct gene expression in non-seedtissue. J Exp Bot 55:1463–1471

Plant Mol Biol Rep