JOURNAL OF VIROLOGY, Sept. 1992, p. 5190-51990022-538X/92/095190-10$02.00/0Copyright X 1992, American Society for Microbiology

Second-Site Suppressor Mutations Assist in Studying theFunction of the 3' Noncoding Region of Turnip

Yellow Mosaic Virus RNAtCHING-HSIU TSAI',2 AND THEO W. DREHER' 2,3*

Program in Genetics, 1 Center for Gene Research and Biotechnology,3 and Department ofAgricultural Chemistry,2 Oregon State University, Corvallis, Oregon 97331-7301

Received 6 April 1992/Accepted 19 May 1992

The 3' noncoding region of turnip yellow mosaic virus RNA includes an 82-nucleotide-long tRNA-likestructure domain and a short upstream region that includes a potential pseudoknot overlapping the coatprotein termination codon. Genomic RNAs with point mutations in the 3' noncoding region that result in poorreplication in protoplasts and no systemic symptoms in planta were inoculated onto Chinese cabbage plants inan effort to obtain second-site suppressor mutations. Putative second-site suppressor mutations were identifiedby RNase protection and sequencing and were then introduced into genomic cDNA clones to permit theircharacterization. A C-57--U mutation in the tRNA-like structure was a strong suppressor of the C-55---Amutation which prevented both systemic infection and in vitro valylation of the viral RNA. Both of thesephenotypes were rescued in the double mutant. An A-107--C mutation was a strong second-site suppressorof the U-96-->G mutation, permitting the double mutant to establish systemic infection. The C-107 and G-96mutations are located on opposite strands of one helix of a potential pseudoknot, and the results support afunctional role for the pseudoknot structure. A mutation near the 5' end of the genome (G+92- A), at position-3 relative to the initiation codon of the essential open reading frame 206, was found to be a general potentiatorof viral replication, probably as a result ofenhanced expression of open reading frame 206. The A+92 mutationenhanced the replication of mutant TYMC-G96 in protoplasts but was not a sufficiently potent suppressor topermit systemic spread of the A+92/G-96 double mutant in plants.

Turnip yellow mosaic virus (TYMV) has a positive-sensesingle-stranded RNA genome 6.3 kb long. The entire ge-nomes of a European isolate (27) and an Australian isolate(21) have been sequenced, and we have reported the se-quence of TYMC, the Corvallis strain of TYMV, which isclonally propagated in cDNA form in pTYMC (10). Incommon with several other plant viruses, including bromemosaic virus (BMV) and tobacco mosaic virus (TMV), the3'-terminal region of TYMV RNA comprises a tRNA-likestructure (recently reviewed in reference 25). In TYMVRNA, this structure is 82 nucleotides long (Fig. 1) and can bespecifically recognized by several tRNA-associating proteinssuch as valyl-tRNA synthetase and (CTP, ATP):tRNA nu-cleotidyltransferase from wheat germ, yeast cells, or Esch-erichia coli (11, 17, 25) and by elongation factor EF-Tu fromE. coli (18) or EF-lao from wheat germ (19). The tRNA-likestructures are thought to play a role in viral RNA replication(12), and for TYMV there is a strong correlation between thevaline acceptance and replication in vivo of RNAs withmutations in the tRNA-like structure (37). The mechanismby which the ability to be valylated contributes to successfulreplication remains unclear, however.A second readily recognizable feature of the 3' noncoding

region of BMV and TMV RNAs is the presence of one or

more pseudoknots upstream of the tRNA-like structure.Three consecutive pseudoknots are present at this locationin TMV RNA (40), and mutations that delete or disruptsecondary structural elements of the downstream pseudo-knot result in a loss of replication in tobacco plants or cells

* Corresponding author.t Technical report 9862 from the Oregon Agricultural Experiment

Station.

(35). In the 3' noncoding region of BMV RNA3, there arefour consecutive pseudoknots (31), and deletion studies haveindicated the importance of this region for successful viralreplication in barley protoplasts (22a). In TYMV RNA, apotential pseudoknot overlaps the termination codon of thecoat protein gene (32) (Fig. 1), but no experiments haveinvestigated the role of this part of the TYMV genome invirus viability. Pseudoknots have recently become recog-nized as structural elements involved in the regulation ofgene expression, such as translational read-through (42) andframeshifting (2, 4, 8). It is possible that the recognition andbinding of proteins to pseudoknots is involved in regulatoryevents (30, 34, 36), and the interaction of one or moreproteins with the pseudoknots present in the 3' noncodingregions upstream of the tRNA-like structures of TMV andBMV RNAs may participate in events controlling viral RNAreplication.Our previous studies have characterized the decreased

replication that results from certain substitutions in the 3'tRNA-like structure of TYMV RNA (37). During thosestudies, it was noticed that in rare cases systemic symptomsappeared (with considerable delay) when mutants normallyincapable of supporting systemic infection were inoculatedonto Chinese cabbage plants. The symptoms were consid-ered to derive from the replication of a novel mutant virusthat had arisen from the inoculum by acquiring one or more

mutations as a result of polymerase error during the limitedreplication the mutants were capable of supporting. TheRNA-dependent polymerases of viruses are known to berelatively error prone (9). In the studies reported here, ouraim was to explore the ability of such plant inoculationexperiments to yield novel mutants with second-site sup-pressor mutations that might open up new avenues for

5190

Vol. 66, No. 9

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

SECOND-SITE SUPPRESSOR MUTATIONS OF TYMV RNA 5191

A.

/CUCU\A CCCG-CCC UCGdAACCA3'

A i II I|.

I Ii\I -iC GGGC GGG-AGCCUG U -40 \ CA -20

uCAU G -ro

U A U AUlA C AAUA-sGG-C A A CC-G U A-UG-C-so U-AA-U C-GG-C AUU-G-C UCUUGUC 5'G -107 StpU-A CC-GU-AG-CU-AC-G ,,UC C-53C AC AC/-57 55A

B.

AU>\AA C1-\A-UU-AC-G \_\

AUUG-CUCUUGAAUC- 107 Stop

C.

A 0A CA-UU-AC-G

AUUG-CUCUUGCAUC-107

FIG. 1. Secondary structure model of the 3' noncoding region of TYMV RNA. (A) The L conformation of the tRNA-like structure ofwild-type TYMC RNA. A pseudoknot is present in the amino acid acceptor stem near the 3' end. The base pairs contributing to a potentialpseudoknot upstream of the tRNA-like structure are also shown, together with the coat protein termination codon (Stop), which it overlaps.The various mutations in the 3' noncoding region studied in this investigation are indicated. (B) Disruption of the potential pseudoknot inmutant TYMC-G96 RNA. (C) The potential pseudoknot of mutant TYMC-C107/G96 RNA, similar to that of TYMC RNA. The C-107mutation causes an extension of the coat protein ORF, to terminate as indicated. Nucleotides are numbered from the 3' end and are precededby a minus sign to differentiate from nucleotides near the 5' end (Fig. 2).

studying the role of the 3' noncoding region (including thepotential pseudoknot) and tRNA-like structure of TYMVRNA. We show that second-site suppressor mutations can

be readily isolated, and we present results based on such a

mutation that support a role for a pseudoknot immediatelyupstream of the tRNA-like structure.

MATERIALS AND METHODS

Materials. Chinese cabbage (Brassica pekinensis cv.Wong Bok or Spring A-1) plants were grown in a growthchamber under 16-h day length at 21°C. The hybrid cultivarSpring A-1 was used in most experiments and was preferredover Wong Bok because of its greater genetic uniformity.Plasmid pTYMC (41), from which infectious genomic RNA(TYMC) can be transcribed with T7 RNA polymerase, isshown in Fig. 2. T7 RNA polymerase and reverse tran-scriptase were purchased from Life Sciences, m7GpppG capanalog was purchased from New England Biolabs, Inhibit-Ace RNase inhibitor was purchased from 5 Prime-3 Prime,Inc., T7 DNA polymerase (Sequenase) was purchased fromUnited States Biochemical, Thermus aquaticus DNA poly-merase was purchased from Promega, and restriction en-

zymes were purchased from GIBCO-BRL, BoehringerMannheim, and New England Biolabs. Macerase and Cellu-lysin were purchased from Calbiochem. Synthetic deoxyoli-gonucleotides were made by automated phosphoramiditesynthesis and purified on 20% polyacrylamide-7 M urea gels.

Protoplast and plant inoculations. Young healthy leaves (3to 4 g) were taken from 6-week-old Chinese cabbage plantsthat had been held in the dark for 3 days to deplete starchgrains. Protoplasts were prepared and inoculated (5 jig of

transcript RNA per 4 x 105 cells) as described previously(41) except that protoplasts were released after incubation ofleaf slices in the hydrolytic enzymes overnight at 25°C.Inoculated protoplasts were incubated under constant lightat 25°C for 48 h prior to harvest.Three-week-old Chinese cabbage plants with two true

leaves were used for inoculations of whole plants. Each leafwas mechanically inoculated with 10 ,ul of RNA transcript(0.25 mg/ml) in 50 mM glycine-30 mM K2HPO4 (pH 9.2)-1%bentonite-1% celite. At times, plants were inoculated with asuspension of lysed protoplasts harvested 48 h postinocula-tion (5 x 104 cells per leaf).

Virion RNA extraction and characterization. Virus wasisolated from infected plants by polyethylene glycol precip-itation according to Lane (23) and quantitated spectrophoto-metrically. Virion RNA was prepared from virus by doublephenol-chloroform extraction, one chloroform-isoamyl alco-hol extraction, and ethanol precipitation. To assess thestability of mutated sequences during replication in plants,the regions encompassing the relevant mutations were re-verse transcribed and amplified by polymerase chain reac-tion (PCR) using the oligomers described below. The pres-ence of mutations was determined either directly bysequencing the PCR products (43) or by digesting withdiagnostic restriction enzymes that cleaved the wild-type butnot mutant sequence.

Cloning and transcription. In the preparation of severalmutants, PCR was used to generate small fragments forsubstitution into pTYMC. Each fragment was completelysequenced prior to subcloning, in order to verify the pres-ence of only the desired mutations. Sequences with muta-tions in the 3' noncoding region were PCR amplified as

VOL. 66, 1992

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

5192 TSAI AND DREHER

ORF-69 Arg-HisORF-206 Val-lie+1460 G--A

! Eag ICCGUACGC

T7promoter ORF-69--I

1.0 2.0EcoRl Ncol PstlI Bafurhil

i+92 G-A

ORF-69 Ser-Asn

CP

II

3.0 4.0 5.0 6.0Sst I Pst I smlHInd II

-53 C-->U-55 C--A-57 C--U-96 U->G-107AC

FIG. 2. Diagram of pTYMC, the genomic cDNA clone from which infectious transcripts can be generated with T7 RNA polymerase. Themutations from the 5' region of the genome that were studied in this investigation are indicated, together with the effect that each substitutionhas on ORFs. The mutations in the 3' noncoding region are summarized (see Fig. 1 for more detail). The three ORFs of TYMC RNA (ORF-69,ORF-206, and the coat protein ORF [CP]) are indicated, and restriction sites used for cloning are shown. Nucleotides toward the 5' end arenumbered conventionally and marked +, while those near the 3' end are numbered from the 3' end and marked -.

260-bp fragments, using the 5' oligomer d(GGGTCAAAGATTCGATTC) and the 3' oligomer d(TTCGAGCTCAAGCTTGGTTCCGATG), which includes a HindIlI site positionedat the 3' end of the genomic sequence (39). Mutant pTYMC-U53 was made in this way from cDNA clone mpTY-U53,which was used for in vitro valylation studies (13). MutantspTYMC-U57/A55 and pTYMC-C107/G96 were generatedfrom mutant virion RNA or total RNA isolated from infectedtissue, respectively, by PCR amplification after reversetranscription primed by the 3' oligomer described above(20). The amplified mutant fragments were treated with E.coli Klenow polymerase to remove non-base-paired termini,digested with Hindlll, and subcloned into the SmaI (6062)and HindIll (3') sites of pTYMC (Fig. 2).Mutant pTYMC-G96 was generated via 3' PCR amplifica-

tion as described above. After amplification of 260-bp frag-ments from wild-type pTYMC and from the fortuitouslyisolated mutant clone pTYMC-U53/G96, each was digestedwith AluI (which cleaves 82 nucleotides from the 3' end ofthe genomic sequence). The purified 5' fragment frompTYMC-U53/G96 and 3' fragment from pTYMC were thenreligated and subcloned into the SmaI (6062) and HindIII (3')sites of pTYMC.Mutant pTYMC+A92 was also created via reverse tran-

scription and PCR from mutant virion RNA. PCR to createpTYMC+A92 used a 5' 59-mer oligomer corresponding to a5' EcoRI site and the T7 promoter fused to TYMC nucleo-tides 1 to 35 and the 3' oligomer d(ATGGTAATACATCAGG) to produce a 564-bp fragment. The mutant fragmentwas substituted into the EcoRI (5') and NcoI (210) sites ofpTYMC. To make pTYMC+A1460, full-length cDNA wasmade from mutant virion RNA by using the 3' genomicoligomer, and second-strand DNA was made by primingwith the 5' 59-mer. The mutant fragment was substituted intopTYMC by subcloning between the PstI (1309) and BamHI(1755) sites. [PCR analysis for the A+1460 mutation used the5' oligomer d(CCTGAGGCAACATTGG) to prime at nucle-otide 1240 and the 3' oligomer d(AGCATGGACTTCTGTTCG) to prime opposite nucleotide 1573.]The combinatorial mutants pTYMC-G96+A92, pTYMC-

G96+A1460, pTYMC-G96/U53+A92, and pTYMC-G96/

U53+A1460 were made by subcloning fragments, usingrestriction sites shown in Fig. 2.

Plasmid DNAs were prepared from 50-ml bacterial cul-tures, and the mutant sequences were confirmed by double-stranded DNA sequencing (5). Capped genomic transcriptslabelled with [a-32P]UTP (0.1 Ci/mmol) were prepared withT7 RNA polymerase from DNA templates linearized withHindlIl and analyzed as described previously (41) prior toinoculation.

Analysis of viral products by Western immunoblotting andNorthern (RNA) blotting. The levels of coat protein inharvested protoplasts were analyzed in Western blots, usinghorseradish peroxidase-labelled secondary antibody and thechromogenic substrate 4-chloro-1-naphthol (detection limitof 2 ng of coat protein) as described previously (41). Resultswere quantitated by scanning laser densitometry with refer-ence to a dilution series of virus (37).RNA was extracted from protoplasts, glyoxalated, elec-

trophoresed through 1% agarose, and transferred to nylonmembranes as described previously (41). The hybridizationprobe was a 32P-labelled RNA transcript complementary to0.9 kb at the 3' end of TYMV RNA (PstI-HindIII fragment;Fig. 2), permitting the detection of both genomic and subge-nomic RNAs (37). RNA levels were quantitated by scanninglaser densitometry or with a ,B-emission radioisotope scanner(Ambis Systems, San Diego, Calif.).RNase protection assays. Antisense RNA probes (minus

strand) were prepared by transcription with T7 or T3 RNApolymerase after subcloning appropriate fragments frompTYMC into the vector pT7/T3a-18, which contains the T3and T7 promoters (GIBCO-BRL). Probes representingTYMC sequences between the following restriction siteswere used: full-length (Hindlll [3']-EcoRI [5']), HindIII(3')-NcoI (210), HindIII (3')-BamHI (1755), HindIII (3')-SstI(3286), BamHI (1755)-NcoI (210), and BamHI (1755)-EcoRI(5'). Virion RNAs (2 ,ug) were mixed with antisense RNAprobes (1 R,g) and denatured at 85°C for 5 min in the presenceof 40 mM piperazine-N,N'-bis(2-ethanesulfonic acid)(PIPES; pH 6.7), 0.4 M NaCl, 1 mM EDTA, and 80%formamide (in a 30-pI reaction). After hybridization over-night at 55°C, 300 RI of RNase solution containing 10 mM

%irIF-gavu LTLILIMILIMM- J. VIROL.

NR)F=onr%

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

SECOND-SITE SUPPRESSOR MUTATIONS OF TYMV RNA 5193

TABLE 1. Second-site suppression of the G-96 mutationa

Mutant Relative coat Appearance of Scored Sequence ofprotein systemic symptomsc progenye

TYMC (wild type) 1.0 7 5/5 Wild typeTYMC-U53 1.1 7 2/2 U-53TYMC-G96 0.02-0.3 14-21 14/21 (rf, U-96TYMC-G96/U53 0.02 21 1/5 (r)9TYMC-C107/G96 0.45 7 5/5 C-107/G-96TYMC+A92 1.6 7 3/3 A+92TYMC-G96+A92 0.21 7 (11)h 9/9 A+92/U-96TYMC-G96/U53+A92 0.02 ND ND NDTYMC+A1460 0.9 7 1/1 A+ 1460TYMC-G96+A1460 0.02-0.3 14-21 10/12 A+1460/U-96TYMC-G96/U53+A1460 0.02 ND ND ND

a All data represent averages of at least three experiments. ND, not determined.b Coat protein levels determined in Western blot analyses of extracts from Chinese cabbage protoplasts harvested 48 h postinoculation; error, =20%.c Time of appearance (days postinoculation) of recognizable symptoms in the upper leaves of inoculated Chinese cabbage plants.d Number of Chinese cabbage plants with systemic symptoms/number of plants inoculated.Sequences at the mutant loci of viral RNA in fully symptomatic systemically infected leaves.

f (r) refers to the delayed appearance of systemic infection in two plants (genotypes found to be A+92/G-96 and C-107/G-96; see text). The remaining 12symptomatic plants were infected with the revertant U-96 genotype.g (r) refers to the delayed appearance of systemic infection in one plant (genotype found to be A+1460/U-53; see text).h Symptoms were observed in eight plants after 7 days and in one plant after 11 days (see text).

Tris-HCl (pH 7.5), 0.3 M NaCl, 5 mM EDTA, RNase A (32,ug/ml), and RNase T1 (1.6 ,ug/ml) was added to the samples,which were incubated at 30°C for 1 h (16, 24, 28). RNaseswere removed by treatment with 50 ,ug of proteinase K perml in the presence of 0.5% sodium dodecyl sulfate (SDS) at37°C for 30 min. After phenol-chloroform extraction, thesamples were ethanol precipitated and then analyzed byelectrophoresis on agarose or polyacrylamide gels.

In vitro valylation of transcripts. Fragments (264 nucleo-tides long) corresponding to the 3' region of TYMC andderivative mutant RNAs were synthesized by transcriptionfrom BstNI-linearized cDNA clones and used in studies onvalylation kinetics as described previously Q13). Valylationwas determined by the incorporation of [ H]valine by avalyl-tRNA synthetase activity present in an extract fromwheat germ (13).To permit the synthesis of full-length genomic RNA tran-

scripts capable of aminoacylation, the restriction overhangsgenerated by HindIII linearization of pTYMC and selectedmutant derivatives were removed by treatment with mungbean nuclease (11). The treated DNAs were extracted withphenol-chloroform and ethanol precipitated and then used astemplates for the synthesis of genomic transcripts by T7RNA polymerase (as described above except that the capanalog was omitted). The resultant transcripts were valy-lated to determine the moles of valine bound per mole ofmutant RNA relative to wild-type RNA.

RESULTS

Recovery of variants capable of systemic infection afterinoculation with replication-deficient TYMC mutants. Ourprevious studies on the replication of TYMC RNAs withmutations in the tRNA-like structure yielded two instancesof phenotypic reversion after the inoculation of Chinesecabbage plants with protoplasts infected with poorly repli-cating TYMC mutants (37). TYMC-A55 replicated poorly inprotoplasts and usually produced no systemic infection inplants, but delayed systemic symptoms appeared in one ofthree plants inoculated. In the second instance, delayedsystemic symptoms were reported in one of five plantsinoculated via protoplasts with RNA containing a U-53

mutation (37). Since the viruses responsible for both of thesephenotypic reversions appeared to harbor second-site sup-pressor mutations, we have characterized these mutants andfurther explored the potential for obtaining second-site mu-tations capable of suppressing deleterious mutations in the 3'noncoding region of TYMV RNA.The plant with symptoms originating from a TYMC-A55

RNA inoculum developed systemic symptoms after 3 to 4weeks, whereas symptoms appeared 7 days after inoculationwith wild-type TYMC. Virion RNA was prepared and re-verse transcribed by using a primer hybridizing to the 3' end.The 3' region was amplified by PCR to yield a 260-bpfragment, whose sequence revealed a C-57---U mutation inthe wobble position of the anticodon in addition to theoriginal A-55 mutation (Fig. 1). The U-57 mutation thusappeared to suppress the poor replication phenotype result-ing from the A-55 mutation.The plant with symptoms reported to have originated from

TYMC-U53 RNA inoculum developed systemic symptoms 3to 4 weeks after inoculation. As described in an authors'correction (38), we subsequently became aware of an inad-vertent U-96---G mutation in the 3' noncoding region thathad been introduced via PCR into our pTYMC-U53 clone.The systemic symptoms were thus derived from a TYMC-G96/U53 RNA inoculum, which in most cases does not giverise to systemic infection (Table 1). The sequence of the 3'region of the virion RNA, obtained after PCR amplificationas described above, revealed the presence of only the U-53mutation. RNase protection experiments using antisenseRNA probes indicated the presence of a novel mutation inthis virion RNA (Fig. 3) that was shown by sequencing of theappropriate PCR-amplified fragment to be a G+1460->Asubstitution. As shown in Table 1, TYMC-U53 replicateslike wild-type TYMC in both Chinese cabbage protoplastsand plants. It thus appeared possible that the A+1460mutation was able to partially suppress the G-96 mutation,although the latter had reverted to wild type prior to fullsymptom development.Two further mutations with potential second-site suppres-

sor activity were isolated after inoculation of plants withprotoplasts infected with TYMC-G96 RNA. Fourteen oftwenty-one plants developed systemic symptoms 14 to 21

VOL. 66, 1992

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

5194 TSAI AND DREHER

WT R

1 2 3 4 5

-- 2036-- 1635

-- 1018

-- 516

344

298

FIG. 3. Localization of the A+ 1460 mutation by RNase protec-tion analysis. Virion RNAs from plants infected with wild-typeTYMC (lanes 1 and 2) or a genetic variant arising from theTYMC-G96/U53 inoculum (lanes 3 and 4) were annealed to theindicated antisense RNA probes and digested with a mixture ofRNases. The products were electrophoresed on a 1% agarose geland stained with ethidium bromide. Lanes: 1, wild-type RNAprobed with the EcoRI (5')-BamHI (1755) probe (1.75 kb); 2,wild-type RNA probed with the NcoI (210)-BamHI (1755) probe(1.55 kb); 3, mutant RNA probed with the EcoRI (5')-BamHI (1755)probe; 4, mutant RNA probed with the NcoI (210)-BamHI (1755)probe; 5, DNA markers (1 kb; GIBCO-BRL), with sizes indicated inbase pairs. The cleavage pattern of the mutant RNA indicates a

mutation about 310 nucleotides upstream of the 3' end of the probe,i.e., at about nucleotide 1445; sequence analysis revealed theA+1460 mutation.

days after inoculation, while no symptoms developed in theremaining seven plants (Table 1). Total RNAs were ex-

tracted from the symptomatic tissue of the 14 plants andreverse transcribed with the TYMC-specific 3' primer, andthe 3' 260-bp fragments were PCR amplified as describedabove. Digestion of the amplified fragments with the restric-tion enzyme DraI, which cleaves the wild-typeT-96TTAAA-91 but not the mutant G-96TTAAA-91sequence, followed by sequencing of Dral-resistant frag-ments, showed that the G-96 mutation was retained in 2 ofthe plants but had reverted in the remaining 12. The virion

RNA from one of the plants that retained the G-96 mutationcontained an A- 107--C mutation. Virion RNAs from theother plant were subjected to RNase protection analysisfollowed by PCR amplification and sequencing, resulting inthe detection of a G+92->A mutation (the wild-type G+92sequence was present also). The novel mutations from thesetwo plants appeared to be suppressors of the G-96 muta-tion.The U-57 mutation suppresses the defective valylation and

replication caused by the C-55-->A mutation. The U-57/A-55 double mutation was transferred into pTYMC as

described above to yield pTYMC-U57/A55. The replicationof TYMC-U57/A55 in Chinese cabbage protoplasts andplants was studied by inoculation with capped transcriptsmade from HindIII-linearized plasmid DNA with T7 RNApolymerase and compared with that of wild-type TYMC andof the parent mutants TYMC-U57 and TYMC-A55 (Table 2).Protoplasts inoculated with TYMC-U57/A55 RNA accumu-

lated coat protein (detected on Western blots) to a level 85%of that of protoplasts inoculated with wild-type TYMCRNA; accumulations of genomic and subgenomic RNAs,determined from Northern blots, were 65 and 45%, respec-tively, of the wild-type levels (Table 2). Inoculation of plantsresulted in systemic symptoms indistinguishable from thoseproduced by the wild type, and virions could be isolatedfrom infected tissue in a yield similar to that from wild-typeinfections (Table 2). Comparison of these results with thosedescribing the replication of TYMC-A55 RNA (Table 2)clearly shows that the U-57 mutation is a potent suppressorof the deleterious effect of the A-55 mutation with regard toreplication.

Table 2 also summarizes our studies reported elsewhere(13) on the valylation properties of a 3' fragment of TYMVRNA that carries the UAA anticodon (U-57/A-55 doublemutation). TY-U57/A55 RNA could be valylated to comple-tion by wheat germ valyl-tRNA synthetase and had a

VmaxlKm (a measure of the efficiency of valylation) of 0.075relative to wild-type RNA. By contrast, TY-ASS RNA couldbe only 13% valylated and had a relative VmaxlKm of 0.0046(13) (Table 2). With regard to valylation, the U-57 mutationalso strongly suppresses the effect of the A-55 mutation.

Replication of TYMC-G96 and TYMC-G96/U53 in proto-plasts. To characterize the replication properties of thesetwo mutants that gave rise to the suspected second-site

TABLE 2. U-57 suppression of the A-55 phenotype'

In vitro valylation properties Replication in Chinese cabbage relative to wt (genomic RNA as inocula)

Mutant (264-nt-long 3' RNAs)" Protoplasts harvested 48 hpi Plants

mol of valmol Relative Coat Genomic Subgenomic Relative Systemic symptomsof RNAC Vm.,,/Km proteind RNAe RNAC virion yieldf scoreg

wt 1.0 1.0 1.0 1.0 1.0 1.0 9/9TY-ASS 0.13 0.0046 0.02& Dh 1(r)/3hTY-U57 1.0 1.1 105h°.9 0.8h 1.8h 5/5hTY-U57/A55 1.0 0.075 0.85 0.65 0.45 1.0 3/3

a All data are averages of three or more experiments. nt, nucleotide; hpi, hours postinoculation; wt, wild type; D, double-stranded genomic RNA detected byin vivo labelling (37) in place of quantitation of single-stranded genomic RNA, the very low level of which for this mutant resulted in interference by inoculumRNA; -, none detected; (r), reversion of phenotype resulting from acquisition of second-site suppressor mutation.

bValylation by wheat germ valyl-tRNA synthetase, summarized from reference 13; error for Vmax/K,,, determination is "20%.c Extent of valylation after 60 min at 0.6 ,uM RNA (3'-CCA species).d Coat protein levels determined in Western blots; error, "20%.e RNA levels determined in Northern blots; error, "20%.f Virion yields determined after purification from systemically infected leaves.g Number of plants with systemic symptoms/number of plants inoculated.h Data from reference 37.

J. VIROL.

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

SECOND-SITE SUPPRESSOR MUTATIONS OF TYMV RNA 5195

G-96wr U-53 A+92 G-96 G-96 U-53 C-107 G-96

U-53 A+92 G-96 A+92

FIG. 4. Coat protein accumulations in Chinese cabbage proto-plasts inoculated with wild-type (wt) and mutant TYMC transcripts.Representative experiments that have contributed to the data shownin Table 1 are shown. Protoplasts were harvested 48 h afterinoculation with the indicated derivatives of TYMC RNA. Extractswere separated on a 14% polyacrylamide-SDS gel, blotted, andprobed with anti-TYMV antiserum. The blot was developed byusing horseradish peroxidase-linked second antibodies and 5-chloro-1-naphthol color reagent.

suppressor mutations described above, capped genomictranscripts were prepared from pTYMC-G96 and pTYMC-G96/U53 and inoculated onto Chinese cabbage protoplasts.These clones were verified to contain only the indicatedmutations by sequencing the mutant SmaI (6062)-HindIII(3') fragments (Fig. 2) that had been introduced into pTYMC(Materials and Methods). Chinese cabbage protoplasts inoc-ulated with TYMC-G96 RNA accumulated highly variableamounts of coat protein, ranging between 0.02 and 0.3relative to the wild-type level (Fig. 4; Table 1). In the courseof these studies, we inoculated 10 separate batches ofprotoplasts (principally cultivar Spring A-1) with TYMC-G96 RNA, in some cases making triplicate inoculations withthe same preparation of transcript RNA. The results ap-peared to vary, depending on the batch of protoplasts ratherthan on other variables such as the transcript preparation orthe particular inoculation. In previous experiments (37, 41),we have never observed such variability.

Since virus amplified in isolated protoplasts is not able tospread and infect other cells (spread in plants being via theplasmodesmatal connections between cells), it is unlikelythat a spontaneous mutant capable of efficient replicationcould give rise to the higher levels of replication observedwith some TYMC-G96 inoculations. Such mutations arerelatively rare events and would need to occur indepen-dently in many cells, since the Western signals in protoplastinoculation experiments are the result of viral replication inat least 80% of the cells. Nevertheless, we PCR amplifiedand sequenced the 3' region of RNAs extracted from proto-plast batches that supported relatively high levels of coatprotein synthesis and found the G-96 mutation (and nowild-type sequence) to be present in all cases. The frequentreversion to U-96 on inoculation of the infected protoplaststo plants (Table 1) is consistent with the absence of second-site suppressor mutations in the RNAs replicated in theprotoplasts. Taken together, these data lead us to concludethat the replication levels determined from Western blotsrefer to the replication of TYMC-G96 and not of somealtered genotype. With regard to the variable levels ofreplication in protoplasts, we suggest that the deleteriouseffect of the G-96 mutation is sensitive to variations in thestatus of the host cells that we currently do not understand.

Protoplasts inoculated with TYMC-G96/U53 RNA accu-mulated coat protein to levels 0.02 of the wild-type level(Fig. 4; Table 1), as previously reported (reference 37, inwhich the mutant is incorrectly identified as TYMC-U53).Unlike the results with TYMC-G96 inoculations, the yields

of coat protein were consistent between experiments. Table1 and Fig. 4 also show the replication properties of TYMC-U53, which has a phenotype in plants similar to the wild-typephenotype.The C-107 mutation is a potent second-site suppressor of

the G-96 mutation. The C-107/G-96 double mutation wasintroduced into pTYMC to yield pTYMC-C107/G96. Theabsence of other mutations in the 3' noncoding region wasverified by sequencing. The ability of genomic transcriptsfrom this clone to support replication in protoplasts andsystemic infection of plants was then studied and comparedwith that of wild-type TYMC and mutant TYMC-G96 tran-scripts. Protoplasts inoculated with TYMC-C107/G96 RNAconsistently accumulated coat protein to levels 45% of thoseof TYMC-inoculated protoplasts (Fig. 4; Table 1). Whenplants were inoculated with protoplasts infected withTYMC-C107/G96, normal systemic symptoms developedwith no delay relative to infection with the wild type. Thedouble mutation sequence has been stably maintained aftertwo serial passages through B. pekinensis cv. Spring A-1plants. By contrast, systemic TYMC-G96 infection wasnever observed, and TYMC-G96 replication in protoplastswas variable but never as efficient as that of TYMC-C107/G96. The C-107 mutation is thus an efficient suppressor ofthe G-96 mutation.The U-96---G mutation is positioned to disrupt base

pairing that is part of a potential pseudoknot overlapping theUAA codon that terminates the coat protein open readingframe (ORF) (Fig. 1 and 2). The spontaneously recoveredA-107--C mutation rescues the ability for the pseudoknotto form in TYMC-G96 RNA, by replacing the A-108AG-106/-97CUU-95 stem of the wild-type RNA withA-108CG-106/-97CGU-95 in the TYMC-C107/G96 dou-ble mutant (Fig. 1). In addition to its positioning within thepotential pseudoknot, the C-107 mutation falls within thenatural coat protein termination codon U-105AA- 107. Thesubstitution of UAA with UAC is expected to result in theaddition of a five-amino-acid extension (Tyr-Val-Leu-Asp-Arg) to the 140-residue wild-type coat protein, with termi-nation occurring at the U-94AA-92 codon (Fig. 1). Prelim-inary results suggest that the C-terminal extension results inless stable virions (36a).The rescued replication of the double mutant relative to

TYMC-G96 suggests a function for the pseudoknot. We havepreviously reported that sequences between nucleotides -82and -159 are involved in obtaining optimal valylation rates(11), although this result has been disputed (26). To deter-mine whether altered valylatability, which is crucial forreplication (37), might explain the replication properties ofmutants with substitutions affecting the potential pseudo-knot, the valylation of these mutant RNAs was studied. Thekinetics of valylation by wheat germ valyl-tRNA synthetasewas studied in detail on mutant RNAs containing the 3' 258nucleotides of viral RNA as described previously (13). Theresults presented in Table 3 show that the G-96 mutation(mutants TY-G96 and TY-G96/U53) had very little effect onvalylation kinetics, less than did the U-53 mutation (mutantTY-U53), which had no detectable effect on the viral phe-notype in vivo.Uncapped genomic RNAs with 3'-CCA termini compati-

ble with valylation were prepared for these mutants todetermine whether the mutations in the potential pseudoknotcould affect valylation in the context of the 6.3-kb genomicRNA. A possible role for the pseudoknots upstream of thetRNA-like structures in TYMV, TMV, and BMV RNAsmight be as a spacer arm to ensure the spacial separation of

VOL. 66, 1992

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

5196 TSAI AND DREHER

TABLE 3. In vitro valylation properties of 3' genomic fragmentsa

Mutant mol of Val/mol Apparent Relative Relativeof RNAb Km. (nM) Vmax Vma.xlK.

TY (wild type) 1.0 31 1.0 1.0TY-G96 0.98 72 1.3 0.54TY-U53C 1.1 183 1.9 0.32TY-G96/U53 1.0 212 2.4 0.35

a Valylation kinetics were determined by using wheat germ valyl-tRNAsynthetase and 264-nucleotide-long transcripts that include the 3' noncodingregion of TYMV RNA. RNA concentrations refer to the proportion of3'-CCA-terminating transcripts present (13). Errors for Km and Vmax are 20%.wt, wild type.

b Extent of valylation after 60 min at 0.6 ,uM RNA.c Data taken from reference 13.

the 3' tRNA-like domain from the remaining genomic RNA,ensuring accessibility to the relevant aminoacyl-tRNA syn-thetase and other proteins needed for replication. Onlyminor differences in the in vitro valylation by wheat germvalyl-tRNA synthetase were observed between wild-typeTYMC, TYMC-G96, TYMC-C107/G96, and TYMC-G96/U53 (Fig. 5). Thus, altered valylation does not explain thereplication behavior of mutants containing the C- 107 andG-96 mutations.

Mutation A+92 as a potential second-site suppressor ofmutation G-96. Mutants TYMC+A92, TYMC-G96+A92,and TYMC-G96/U53+A92 were constructed and verified bysequencing to contain only the indicated mutations. Proto-plasts inoculated with TYMC+A92 RNA accumulated coatprotein to levels 1.6 times that present in wild-type infections(Fig. 4; Table 1), and inoculation of plants resulted insystemic infections indistinguishable from wild type but withhigher virion yields (1.8 relative to the wild type). Themutant sequence was stable in plants. The G+92--A muta-tion lies between the tandem initiation codons at the 5' endof the TYMV RNA (Fig. 2) (10) and results in a Ser-*Asnsubstitution of the second codon of ORF-69, which encodesa protein that is necessary for cell-to-cell movement in plantsbut not for replication in protoplasts (1). The A+92 mutationalso places a more optimal nucleotide in the -3 positionrelative to the AUG codon that initiates ORF-206 (3, 22).The improved replication ofTYMC+A92 relative to the wildtype might thus be due to more efficient translation ofORF-206, which encodes proteins essential for replication

c

30

Ea.0

(41), although no clear enhancement of translation wasobserved in vitro by using a reticulocyte lysate (not shown).

Protoplasts inoculated with TYMC-G96+A92 and TYMC-G96/U53+A92 RNAs accumulated coat protein to levels0.21 and 0.02, respectively, relative to the wild-type level(Fig. 4; Table 1). The variable replication characteristic ofTYMC-G96 was not observed. Both mutations were shownby sequence analysis after PCR amplification to be retainedin the protoplasts inoculated with TYMC-G96+A92 (notshown). When protoplasts infected with TYMC-G96+A92were inoculated onto plants, systemic symptoms appearedafter 7 days in eight plants and after 11 days in the remainingplant inoculated (Table 1). RNA from the systemicallyinfected tissues was assayed for the retention of the G-96mutation by PCR-mediated amplification of 3' sequencesfollowed by DraI digestion of the amplified fragment. In allbut the plant with delayed symptoms, there was a reversionof G-96 to the wild type U-96 sequence (Table 1), while ineach of five plants tested, the A+92 mutation was retained.Even in the plant with delayed symptoms, G-96 was presentonly in early systemic infection, being replaced by the U-96revertant by the time symptoms had fully developed. Thereplication of RNA with the G-96 mutation in early symp-tomatic leaves remote from the inoculated leaf suggests thatthe defect resulting from this mutation affects some aspect ofviral infection other than movement in the plant.The results presented above indicate that the A+92 mu-

tation can act as a potentiator of viral replication, both in thewild type and in the TYMC-G96 mutant, perhaps by virtue ofincreased translational expression of ORF-206. The A+92-mediated suppression of the poor replication phenotype thatresults from the G-96 mutation is not sufficient, however, tosupport systemic spread in plants, which occurred only afterreversion of the G-96 mutation. Reversion did neverthelessoccur more frequently and more rapidly in the presence ofthe A+92 mutation (compare TYMC-G96 and TYMC-G96+A92 in Table 1).

Mutation A+1460 as a potential second-site suppressor ofmutation G-96. Mutants TYMC+A1460, TYMC-G96+A1460, and TYMC-G96/U53+A1460 were constructed andverified to contain only the indicated mutations. Protoplastsinoculated with TYMC+A1460 RNA accumulated coat pro-tein to levels of 0.9 relative to the wild-type level, and theTYMC+A1460 inoculum supported normal systemic symp-tom formation in planta (Table 1). The G+1460- A muta-

TYMC-G96/C107--4-

TYMC (wt)

TYMC-G96

7YMC-G96/U53

rime (min)FIG. 5. Comparative in vitro valylation of wild-type (wt) and mutant genomic RNAs. The full-length genomic RNAs indicated (0.2 ,uM)

were valylated (shown as counts per minute of [3H]valine bound per aliquot) with wheat germ valyl-tRNA synthetase.

J. VIROL.

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

SECOND-SITE SUPPRESSOR MUTATIONS OF TYMV RNA 5197

tion, which results in an Arg--His substitution in ORF-69and a Val-Ile substitution in ORF-206, thus had no notice-able phenotype.

Protoplasts inoculated with TYMC-G96+A1460 andTYMC-G96/U53+A1460 RNA accumulated coat protein tolevels of 0.02 to 0.3 and 0.02 relative to the wild-type level,respectively (Table 1). The variability of viral replicationafter inoculation with TYMC-G96+A1460 was like thatfollowing inoculation with TYMC-G96 RNA. Plants inocu-lated with lysates of protoplasts infected with TYMC-G96+A1460 developed systemic symptoms in 10 of the 12plants inoculated, with symptoms appearing 14 to 21 daysafter inoculation. Dral digestion of the 3' 260-bp fragmentsamplified from total RNA extracted from the symptomaticleaves after reverse transcription and PCR showed that theG-96 mutation had reverted to the wild-type U-96 in all 10plants. The presence of the A+ 1460 mutation was studied inthe systemic tissue by reverse transcription and PCR ampli-fication, followed by digestion with the EagI restrictionenzyme, which cleaves the wild-type C1459GTACG1464,but not the mutant C1459ATACG1464 sequence. In all fiveprogeny RNAs tested, the PCR products were EagI resis-tant, indicating the retention of the A+1460 mutation. Be-cause the replication behaviors of TYMC-G96 and TYMC-G96+A1460 are similar, and similarly variable, it is clear thatthe A+ 1460 mutation has no detectable activity in modifyingthe phenotype of the G-96 mutation and is not a usefulsecond-site suppressor.

DISCUSSION

In an error-prone viral replication system, a mutant with apoor replication rate has the potential to give rise to fitter,more successfully replicating variants that will rapidly out-grow and replace the original mutant inoculum. The newvariant genomes will occasionally harbor second-site sup-pressor mutations that can help shed light on the defect ofthe original mutation, often in unexpected ways. We haveexplored this approach for studying the role of the 3'noncoding region of TYMV RNA, using mutant RNAsTYMC-A55, TYMC-G96, and TYMC-G96/U53 as the origi-nal inocula. These RNAs replicate detectably in protoplasts,so that there is significant potential for the generation ofmutations by polymerase error. They do not, however,support systemic infection in plants (Tables 1 and 2), so thata more successful revertant or second-site suppressor mu-tant that outgrows the inoculum to produce systemic symp-toms is easily detected. We have investigated four novelmutations generated in this way. Two are potent second-sitesuppressors that provide new insights, discussed below. Thethird mutation (A+92) is a weak second-site suppressor ofthe G-96 mutation that probably functions nonspecificallyby enhancing the expression of the essential ORF-206. Thefourth mutation (A+1460) does not detectably suppress theG-96 mutation (from which inoculum it was recovered) andappears to be a silent mutation under our experimentalconditions. Thus, either it was recovered entirely by acci-dent, or perhaps the mutation did act to weakly suppress theeffects of the G-96 mutation in the particular conditionspresent in the inoculated plant (in a way that we have notbeen able to reproduce). In any case, the inability of theA+1460 mutation to prevent the reversion of the coupledG-96 mutation shows that it is not a useful second-sitesuppressor.Anticodon recognition by valyl-tRNA synthetase and the

TYMV replication system. The recovery of the U-57 muta-

tion as a suppressor of the poor replication phenotype thatresults from the A-55 mutation has provided an importantstrengthening of our previously determined correlation be-tween valylation and viral replication (37). The two muta-tions were combined in the genomic mutant TYMC-U57/A55, which replicates systemically to generate virion yieldssimilar to those of the wild type, and in a short transcriptrepresenting the 3' 258 nucleotides of the viral RNA that canbe conveniently used for in vitro valylation studies withwheat germ valyl-tRNA synthetase (13). As discussed morefully by Dreher et al. (13), the short TY-U57/A55 mutant,with a UAA anticodon, is unexpectedly well valylated, asjudged from the valylation activities of the single mutantsTY-U57 and TY-A55. We have postulated from the antico-operativity that exists between the two mutations that valyl-tRNA synthetase is sensitive to the conformation of thephosphate backbone as well as functional groups on thebases of the anticodon (13). This is quite unlike the recogni-tion of the tRNAG'ln anticodon by E. coli glutaminyl-tRNAsynthetase, shown by X-ray crystallography to involvehighly specific contacts to the base of each anticodon nucle-otide (33) in such a way that the anticooperativity betweentwo mutations such as we have observed could not exist.The unexpectedly efficient valylation observed for the

U-57/A-55 double mutant has thus suggested a novelrecognition of the RNA by the valyl-tRNA synthetase. Morepertinent to our viral studies, however, is the correlationbetween the viral replication and valylation for TYMV RNAwith the deleterious A-55 mutation and TYMV RNA withthe rescued U-57/A-55 double mutation. This resultstrongly suggests that an interaction with valyl-tRNA syn-thetase, either as a catalyst that adds valine to the 3' end andthen plays no further role or as a less transient ligand andsubunit of the replication complex, is crucial for the replica-tion of TYMV RNA. This interpretation is to differentiatefrom the theoretical but unlikely possibility that one of theviral proteins essential for replication has an RNA bindingdomain much like that of valyl-tRNA synthetase, a domainthat might have been recruited from the host gene and usedin minus-strand promoter binding. In fact, no homologies toaminoacyl-tRNA synthetases are known in TYMV-encodedORFs, and it seems inconceivable that a viral protein inter-acting with the tRNA-like structure in an essential functioncould duplicate the properties observed for the A-55 andU-57/A-55 mutations as well as the several anticodonmutations previously studied (37).

Evidence for the existence of a pseudoknot upstream of thetRNA-like structure. The G-96 mutation is clearly detrimen-tal to the successful replication of TYMV. The mutationdisrupts one of the stems of a potential pseudoknot justupstream of the tRNA-like structure (Fig. 1). A stable,strong second-site suppressor mutation that overcomes theeffect of the G-96 mutation and permits the virus to infectplants systemically is the C-107 mutation. The C-107/G-96 double mutant RNA would be expected to contain apseudoknot similar to that of the wild-type RNA, with aC. G rather than a U. A base pair. Although further mu-tants will need to be analyzed, it appears likely that thesuggested pseudoknot exists in TYMC RNA and is involvedin some step that is important for the successful replicationof the virus. It is unlikely that the extension of the coatprotein ORF that results from the C-107 mutation accountsfor the suppressor phenotype, since the larger coat proteinappears to form virions that are unstable during normal virusisolation (36a). The extension to the coat protein ORFshould thus be considered a detrimental mutation, and it may

VOL. 66, 1992

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

5198 TSAI AND DREHER

be responsible for the modestly suboptimal levels of coatprotein detected in protoplasts infected with TYMC-C107/G96.

Nuclease cleavage and chemical accessibility studies areconsistent with the presence of the suggested pseudoknot,although they are also consistent with a different conforma-tion (14, 32). The short helical stems impart only a marginalstability, such that the pseudoknot may need to be stabilizedby the binding of some factor in vivo. Analysis of thesequences of other tymoviral RNAs shows the potential fortwo pseudoknots upstream of the tRNA-like structure inononis yellow mosaic virus RNA (6), but no potentialpseudoknots have been located (30a) in the RNAs ofkennedya yellow mosaic virus (7) or eggplant mosaic virus(29). Clearly, the relevance of the putative pseudoknot inTYMV RNA requires further experimental support. In TMVRNA, the existence of three pseudoknots upstream of thetRNA-like structure is supported by nuclease mapping ex-

periments (15, 41), and an important function in some aspectof the replication cycle has been demonstrated (35).

Functional interaction between the G-96 and U-53 muta-tions. The U-53 mutation appears to be a neutral mutationwith respect to replication in protoplasts and plants (Table1). In combination with G-96, however, the U-53 mutationhas an influence on the viral phenotype. In comparisons ofTYMC-G96 with TYMC-G96/U53 and TYMC-G96+A1460with TYMC-G96/U53+A1460, the presence of U-53 re-

sulted in a loss of the highly variable replication in proto-plasts, with replication occurring at the lower levels ob-served in the absence of U-53. This consistently lowerreplication (by virtue of the lower opportunity for polymer-ase errors) presumably explains the observation that TYMC-G96/U53 inoculum was more stable in plants, with a lowerrate of reversion to U-96 than for TYMC-G96 inoculum(Table 1). In a comparison of TYMC-G96+A92 with TYMC-G96/U53+A92, the U-53 mutation reversed the suppressoreffect of the A+92 mutation, since TYMC-G96/U53+A92replicated to only 0.02 times the level of the wild type inprotoplasts, as judged by coat protein accumulation.No secondary structural interaction between G-96 and

U-53 appears feasible (Fig. 1), but if such an interactionwere to exist, it would presumably interfere with the valy-lation of the viral RNA and decrease the efficiency ofreplication. The genetic interaction between these two mu-

tant nucleotides is sufficiently strong to overcome the effectof the A+92 mutation in stabilizing a higher replication. Themolecular explanation for these effects will require furtherstudies that may uncover unknown functional properties ofthe 3' noncoding region of TYMV RNA. The emergence ofthis and the other questions discussed in this report from a

search for second-site suppressor mutations illustrates theusefulness of this approach in studying the roles of the 3'regions of viral RNAs.

ACKNOWLEDGMENT

This work was supported by NSF grant DMB-9019174.

REFERENCES1. Bozarth, C. S., J. J. Weiland, and T. W. Dreher. 1992. Expres-

sion of ORF-69 of turnip yellow mosaic virus is necessary forviral spread in plants. Virology 187:124-130.

2. Brierley, I., P. Digard, and S. C. Inglis. 1989. Characterizationof an efficient coronavirus ribosomal frameshifting signal: re-

quirement for an RNA pseudoknot. Cell 57:537-547.3. Cavener, D. R., and S. C. Ray. 1991. Eukaryotic start and stop

translation sites. Nucleic Acids Res. 19:3185-3192.

4. Chamorro, M., N. Parkin, and H. E. Varmus. An RNApseudoknot and an optimal heptameric shift site are required forhighly efficient ribosomal frameshifting on a retroviral messen-ger RNA. Proc. Natl. Acad. Sci. USA 89:713-717.

5. Chen, E. Y., and P. Seeburg. 1985. Supercoil sequencing: a fastand simple method for sequencing plasmid DNA. DNA 4:165-170.

6. Ding, S.-W., P. Keese, and A. Gibbs. 1989. Nucleotide sequenceof the ononis yellow mosaic tymovirus genome. Virology 172:555-563.

7. Ding, S.-W., P. Keese, and A. Gibbs. 1990. The nucleotidesequence of the genomic RNA of kennedya yellow mosaictymovirus-Jervis Bay isolate: relationships with potex- andcarlaviruses. J. Gen. Virol. 71:925-931.

8. Dinman, J. D., T. Icho, and R. B. Wickner. 1991. A - 1ribosomal frameshift in a double-stranded RNA virus of yeastforms a gag-pol fusion protein. Proc. Natl. Acad. Sci. USA88:174-178.

9. Domingo, E., and J. J. Holland. 1988. High error rates, popula-tion equilibrium and evolution of RNA replication systems, p.3-36. In E. Domingo, J. J. Holland, and P. Ahlquist (ed.), RNAgenetics, vol. III. CRC Press, Boca Raton, Fla.

10. Dreher, T. W., and K. L. Bransom. 1992. Genomic RNAsequence of turnip yellow mosaic virus isolate TYMC, a cDNA-based clone with verified infectivity. Plant Mol. Biol. 18:403-406.

11. Dreher, T. W., C. Florentz, and R. Giege. 1988. Valylation oftRNA-like transcripts from cloned cDNA of turnip yellowmosaic virus RNA demonstrate that the L-shaped region at the3' end of the viral RNA is not sufficient for optimal aminoacy-lation. Biochimie 70:1719-1727.

12. Dreher, T. W., and T. C. Hall. 1988. RNA replication in bromemosaic virus and related viruses, p. 91-113. In E. Domingo, J. J.Holland, and P. Ahlquist (ed.), RNA genetics, vol. I. CRCPress, Boca Raton, Fla.

13. Dreher, T. W., C.-H. Tsai, C. Florentz, and R. Giege. Biochem-istry, in press.

14. Florentz, C., J. P. Briand, P. Romby, L. Hirth, J. P. Ebel, andR. Giege. 1982. The tRNA-like structure of turnip yellow mosaicvirus RNA: organization of the last 159 nucleotides from the3'-OH terminus. EMBO J. 1:269-276.

15. Garcia-Arenal, F. 1988. Sequence and structure at the genome3' end of the U2-strain of tobacco mosaic virus, a histidineaccepting tobamovirus. Virology 167:201-206.

16. Grange, D. K., G. S. Gottesman, M. B. Lewis, and J. C. Marini.1990. Detection of point mutations in type I collagen by RNasedigestion of RNA/RNA hybrids. Nucleic Acids Res. 18:4227-4236.

17. Joshi, S., F. Chapeville, and A. L. Haenni. 1982. Length require-ments for tRNA-specific enzymes and cleavage specificity at the3' end of turnip yellow mosaic virus RNA. Nucleic Acids Res.10:1947-1962.

18. Joshi, R. L., H. Faulhammer, F. Chapeville, M. Sprinzl, andA. L. Haenni. 1984. Aminoacyl RNA domain of turnip yellowmosaic virus Val-RNA interacting with elongation factor Tu.Nucleic Acids Res. 12:7467-7478.

19. Joshi, R. L., J. M. Ravel, and A. L. Haenni. 1986. Interaction ofturnip yellow mosaic virus Val-RNA with eukaryotic elongationfactor EF-la. EMBO J. 5:1143-1147.

20. Kawasaki, E. S. 1990. Amplification of RNA, p. 21-27. In M. A.Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCRprotocols: a guide to methods and applications. AcademicPress, Inc., San Diego, Calif.

21. Keese, P., A. MacKenzie, and A. Gibbs. 1989. Nucleotidesequence of the genome of an Australian isolate of turnip yellowmosaic tymovirus. Virology 172:536-546.

22. Kozak, M. 1987. At least six nucleotides preceding the AUGinitiator codon enhance translation in mammalian cells. J. Mol.Biol. 196:947-950.

22a.Lahser, F., and T. C. Hall. Personal communication.23. Lane, L. 1986. Propagation and purification of RNA plant

viruses. Methods Enzymol. 118:687-696.24. Lopez-Galindez, C., J. A. Lopez, J. A. Melero, L. D. L. Fuente,

J. VIROL.

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

SECOND-SITE SUPPRESSOR MUTATIONS OF TYMV RNA 5199

C. Martinez, J. Ortin, and M. Perucho. 1988. Analysis of geneticvariability and mapping of point mutations in influenza virus bythe RNase A mismatch cleavage method. Proc. Natl. Acad. Sci.USA 85:3522-3526.

25. Mans, R. M. W., C. W. A. Plei, and L. Bosch. 1991. tRNA-likestructures: structure, function and evolutionary significance.Eur. J. Biochem. 201:303-324.

26. Mans, R. M. W., P. W. G. Verlaan, C. W. A. Plei, and L.Bosch. 1990. Aminoacylation of 3' terminal tRNA-like frag-ments of turnip yellow mosaic virus RNA: the influence of 5'nonviral sequences. Biochim. Biophys. Acta 1050:186-192.

27. Morch, M.-D., J.-C. Boyer, and A. L. Haenni. 1988. Overlap-ping open reading frames revealed by complete nucleotidesequencing of turnip yellow mosaic virus genomic RNA. Nu-cleic Acids Res. 15:6157-6173.

28. Myers, R. M., Z. Larin, and T. Maniatis. 1985. Detection ofsingle base substitutions by ribonuclease cleavage at mis-matches in RNA:DNA duplexes. Science 230:1242-1246.

29. Osorio-Keese, M. E., P. Keese, and A. Gibbs. 1989. Nucleotidesequence of the genome of eggplant mosaic tymovirus. Virology172:547-554.

30. PleU, C. W. A. 1990. Pseudoknots: a new motif in the RNAgame. Trends Biochem. Sci. 15:143-147.

30a.Plej, C. W. A. Personal communication.31. Plet, C. W. A., J. P. Abrahams, A. van Belkum, K. Rietveld,

and L. Bosch. 1987. The spatial folding of the 3' noncodingregion of aminoacylatable plant viral RNAs, p. 299-316. InM. A. Brinton and R. R. Rueckert (ed.), Positive strand RNAviruses. Alan R. Liss, Inc., New York.

32. Rietveld, K. 1984. Ph.D. thesis, p. 118. State University ofLeiden, Leiden, The Netherlands.

33. Rould, M. A., J. J. Perona, and T. A. Steitz. 1991. Structuralbasis of anticodon loop recognition by glutaminyl-tRNA syn-

thetase. Nature (London) 352:213-218.34. Schimmel, P. 1989. RNA pseudoknots that interact with com-

ponents of the translation apparatus. Cell 58:9-12.35. Takamatsu, N., Y. Watanabe, T. Meshi, and Y. Okada. 1990.

Mutational analysis of the pseudoknot region in the 3' noncod-ing region of tobacco mosaic virus RNA. J. Virol. 64:3686-3693.

36. Tang, C. K., and D. E. Draper. 1989. Unusual mRNApseudoknot structure is recognized by a protein translationalrepressor. Cell 57:531-536.

36a.Tsai, C.-H. Unpublished data.37. Tsai, C.-H., and T. W. Dreher. 1991. Turnip yellow mosaic virus

RNAs with anticodon loop substitutions that result in decreasedvalylation fail to replicate efficiently. J. Virol. 65:3060-3067.

38. Tsai, C.-H., and T. W. Dreher. 1992. Author's correction. J.Virol. 66:3977.

39. Tsai, C.-H., and T. W. Dreher. In vitro transcription of RNAswith defined 3' termini from PCR-generated templates. Bio-Techniques, in press.

40. van Belkum, A., J. P. Abrahams, C. W. A. Plei, and L. Bosch.1985. Five pseudoknots are present at the 204 nucleotides long3' noncoding region of tobacco mosaic virus RNA. NucleicAcids Res. 13:7673-7686.

41. Weiland, J. J., and T. W. Dreher. 1989. Infectious TYMV RNAfrom cloned cDNA: effects in vitro and in vivo of point substi-tutions in the initiation codons of two extensively overlappingORFs. Nucleic Acids Res. 17:4675-4687.

42. Wills, N. M., R. F. Gesteland, and J. F. Atkins. 1991. Evidencethat a downstream pseudoknot is required for translationalread-through of the Moloney murine leukemia virus gag stopcodon. Proc. Natl. Acad. Sci. USA 88:6991-6995.

43. Winship, P. P. 1989. An improved method for directly sequenc-ing PCR-amplified material using dimethyl sulfoxide. NucleicAcids Res. 17:1266.

VOL. 66, 1992

on April 20, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from