rolling-circle plasmid pkym re-initiates dna replication

DNA RESEARCH 4, 193-197 (1997)

Rolling-Circle Plasmid pKYM Re-initiates DNA Replication

Hiroo YASUKAWA1 and Yukito MASAMUNE2'*

Division of Life Sciences, Graduate School of Natural Science and Technology, Kanazawa University1 andDepartment of Microbiology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kanazawa 920,Japan2

(Received 30 April 1997; revised 9 June 1997)

Abstract

It is believed that rolling-circle plasmids are incapable of re-initiation since they have to maintain theircopy number and this is one of the differences between plasmids and phages as phi-xl74. To examinewhether a rolling-circle plasmid pKYM is incapable of re-initiating DNA replication, we constructed aplasmid that carries both the pKYM origin (fragment 13, 173 bp) and its truncated origin (fragment 32,56 bp) in the same orientation. This plasmid yielded two smaller plasmids in the presence of RepK, aninitiator protein. We showed that RepK can bind to the fragment 13 but not to fragment 32 which lacks the3'- moiety of fragment 13. These results imply that RepK initiates DNA replication from fragment 13 andterminates at fragment 32, then the same RepK is used for re-initiation of replication from the fragment32 region. pKYM is likely to be a unique plasmid that re-initiates DNA replication like a phage phi-xl74.Key words: rolling-circle; pKYM; re-initiation

1. Introduction

In DNA replication by the rolling-circle mechanism,initiation and termination of replication are defined asfollows. Initiation is the introduction of a specific single-strand break in the plus replication origin by a Rep pro-tein encoded by the plasmid. Termination is the nickingand rejoining of the displaced single-strand at the sitewhere the initial single-strand break was introduced.

In phi-xl74 geneA protein (GpA), termination of onereplication cycle is coupled to initiation of the next. Re-initiation would give a advantage to the phages that arenot have to control their copy number. On the otherhand, plasmids have to maintain their copy number at aconstant level. Several mechanisms have been proposedfor the control the copy number of plasmids. The in-hibition of the re-initiation is thought to be one of themechanisms. In the case of the staphylococcal plasmidpT181 that also replicates by the rolling-circle model, itsreplication initiator protein RepC is inactivated after thetermination of DNA replication.1 Therefore, RepC cannot re-initiate DNA replication. Gros M. F. et al.2'3 re-ported that the initiator protein RepA of pC194, whichwas isolated from a Gram-positive bacterium and repli-cates via a rolling-circle mechanism, can not re-initiateDNA replication. Gros M. F. and Ehrlich S.D.,4 how-

Communicated by Mituru Takanami

* To whom correspondence should be addressed. Tel. +81-76-234-4466, Fax. +81-76-234-4465

ever, demonstrated that replacement of a glutamic acidresidue in RepA with tyrosine results in re-initiation ofDNA replication.

Plasmid pKYM, isolated from a Gram-negative bac-terium Shigella sonnei, is a multicopy plasmid of 2083base pairs.5 pKYM belongs to the pC194/pUB110 plas-mid family of Gram-positive bacteria and replicates viaa rolling-circle mechanism.6'7

We have prepared several pUC18 derivatives carryingvarious fragments of the pKYM origin. Among them,pMO13 that has the minimal ori region (fragment 13,173 bp) can initiate and terminate DNA replication nor-mally, whereas pMO32 that carries a truncated ori region(fragment 32, 56 bp) can terminate but not initiate.8

Here we report that plasmid pKYM re-initiates DNAreplication in the presence of native RepK.

2. Materials and Methods

2.1. Bacteria and plasmidsThe Escherichia coli strains used in the experiments

were JM109,9 WA80210 and WA802 polA which is a DNApolymerase I mutant of WA802. WA802 polA was estab-lished in our laboratory. The plasmids used were thederivatives of pUC18n carrying either the origin or atruncated origin of pKYM. The constructs of pMO13and pMO32 have been previously described.8'11 pMO13carries the entire origin of pKYM (fragment 13; from nu-cleotide number 394 to 566 of pKYM) and pMO32 carries

Dow

nloaded from https://academ

ic.oup.com/dnaresearch/article/4/3/193/429699 by guest on 26 D

ecember 2021

194 Replication of Rolling Circle Plasmid pKYM [Vol. 4,

I—i i-minus on on repK

RepKI T I

5' - TGGTTATTTTTTGCGCAATTCTCXSCGCXSTGftTCCTTGTATTTATACTTAAGGGATAAATGGCGGATATGAAATAGT

133233

HU HUI 1 I IGGrrTTAGCCCAGTAATGACG^GGCTTTGAGTGGGTTTT<3AlGAGGTCAAAGAAAATGGAGGAQAATTGAGG----GAGTGCG

-35 repK promoter -10

13

Figure 1. The physical map of the genome and the origin region of plasmid pKYM. Abbreviations used are as follows: minus ori: theregion required for conversion of single-stranded DNA to double-stranded DNA, ori: the replication origin of double-stranded DNA,repK: the gene encoding the RepK protein which is required for DNA replication. Hp: Hpa I. F: Fsp I. A: Afl II. He: Hindi.E: EcoRI. S: Sph I. The numbers on the physical map of pKYM indicate the recognition sites of the restriction enzymes. Region13 indicates the 173-bp DNA fragment (394-566). Regions 32 and 33 indicate the 58-bp DNA fragment (394-451) and 56-bp DNAfragment (394-449), respectively. The arrowhead indicates the predicted nicking site. The regions protected by RepK and HU areindicated.

a part of the origin (fragment 32; from nucleotide 394 to451). Fragment 33 (from nucleotide 394 to 449), whichis two base pairs shorter than fragment 32, was synthe-sized. The genetic structure and the nucleotide sequencearound the replication origin of pKYM is shown in Fig. 1.

pT13A32 and pT13A33 are the plasmids carrying thefragments 13 and 32 or 33 in the same orientation asshown in Fig. 3. These plasmids carry the tetracyclineresistant (tetT) and ampicilline resistant (ampT) genes.pOPM3702 is a derivative of R6K carrying the repKgene and was used to supply the RepK protein in trans.pOPM3703F which carries repKY237F is a derivative ofpOPM3702. RepKY237F is a mutated RepK in whichTyr237 was exchanged to Phe.6

2.2. Gel shift assayFragments 13 and 32 labeled with 32P were prepared

by polymerase chain reaction (PCR) amplification.12 andused as probes. The reaction mixture (10 fil) for thegel shift assay contained 100 mM NaCl, 10 mM Tris-HC1 (pH 7.5), 1 mM EDTA, 10%(v/v) glycerol, 2 ^gof poly(dl-dC) (Sigma Chemical Co.) and 0.13 pmolof a probe. An aliquot of 2.2 pmol of purified RepK.13

was added to the reaction mixture then incubated for10 min at 30°C. After incubation, the mixtures were elec-trophoresed in 6% polyacrylamide gel at 4°C.

2.3. Southern hybridizationpBR322 was digested with Ssp I, Pst I, EcoRV and

Nru I, then the Ssp l-Pst I fragment which carried apart of the amp1 gene (561 bp) and the EcoRV-Nru Ifragment which contained a part of the tetr gene (787 bp)were purified from agarose gel and used as a probe. Thepreparation of labeled probe, hybridization condition andwash condition are described elsewhere.8

2.4- Enzymes and other methodsEmzymes were purchased from TOYOBO CO.,

(Japan) and TAKARA CO., (Japan), and used withtheir recommendation. Other general procedures wereperformed as described previously.14

3. Results and Discussion

3.1. Th6 binding of RepK to the replication originThe binding of RepK to the pKYM origin was exam-

ined by gel shift assay. The nucleotide sequences of frag-ments 13 and 32 used for the assay are shown in Fig. 1. Asshown in Fig. 2, the purified RepK bound to fragment 13,but no binding was detected with fragment 32. The con-centration of RepK used in this experiment is about 17times greater than that of the probes. We have previously

Dow



ecember 2021

No. 3] H. Yasukawa and Y. Masamune 195

RepK —4. L

Figure 3. The scheme for the detection of re-initiation. Gen-eration of daughter plasmids is schematically illustrated. Theparental plasmids pT13A32 and pT13A33 are converted intothe daughter plasmids pT13 containing fragment 13 (black box)and pA32 containing fragment 32 or pA33 containing fragment33 (shaded box), if RepK is able to re-initiate DNA replicationat fragment 32 or 33. pOPM3702 supplies RepK. pUC18 originis shown as O.

Figure 2. Gelshift analysis of the binding of RepK to fragments13 and 32. The end-labeled DNA fragments were incubatedwith or without purified RepK and were electrophoresed asdescribed in the text. The arrowhead indicates the shift.

reported that plasmid pMO13 could transform E. coliWA802 polA carrying pOPM3702 which expressed RepKin trans but pM015 could not.8 Gel shift assay demon-strate that RepK can not bind to the truncated originefficiently. This may explain why pM0l5 could not ini-tiate DNA replication

3.2. Detection 0} the re-initiation productsThe re-initiation of pT13A32 or pT13A33 was exam-

ined following the scheme shown in Fig. 3. If RepKcan re-initiate DNA replication, RepK initiates replica-tion from fragment 13, terminate at fragment 32 andre-initiates replication from fragment 32. This replica-tion cycle would yield two daughter plasmids, pT13 andpA32, from the parental plasmid pT13A32. Thus, plas-mids pT13A32 and pT13A33 were introduced into E. coliJM109 or JM109 carrying pOPM3702 which expresses

RepK. The transformants were cultivated for 8 h at 37°Cand harvested to extract plasmids. The structure of theplasmids recovered were examined by gel electrophore-sis. As shown in Fig. 4A, replication of pT13A32 gen-erated two smaller plasmids (lane 3) but pT13A33 didnot do so even when RepK was supplied in trans (lane5). We confirmed that these two smaller plasmids cor-respond to pT13 and pA32 by southern hybridization.As shown in Fig. 4B, one of the small plasmids was de-tected when the fragment of the ampT gene was used asa probe (lane 2) and the other one was hybridized to thefragment of tetT gene (lane 4). The plasmids used wereextracted from transformants after 25 h of cultivation.This Southern data indicate that these small plasmidsare pT13 and pA32, respectively. The restriction mapof the plasmids also indicates that these plasmids arepT13 and pA32 (data not shown). These results indicatethat re-initiation occured with pT13A32 but not withpT13A33.

When the parental plasmids were introduced into thecell carrying pOPM3703F, daughter plasmids were notdetected since pOPM3703F expresses inactive RepK pro-tein, RepKY237F, in which Tyr237 has been substitutedby Phe (Fig. 4C). Therefore, the generation of daughterplasmids is due to the RepK activity but not the recom-bination reaction.

3.3. DiscussionRepK could not bind to fragment 32, however, gen-

erated two daughter plasmids from a parental plasmid,

Dow



ecember 2021

196 Replication of Rolling Circle Plasmid pKYM [Vol. 4.

• wmnw aawwK sum M

B

1 2 3 4 1 2 3

(kbp)4.4

PT13A32or pT13A33 2.3 -

pA32 2 . 0 -

PT13A32

pA32

pT13

pT13A32

Figure 4. Detection of the re-initiation products. A) Gel electrophoresis of recovered plasmids from transformed cells. E. coli JM109and JM109 carrying pOPM3702 were transformed by parental plasmids. Cells were cultivated for 8 h at 37°C and plasmids wererecovered from the same number of cells. Plasmids were loaded onto 0.7% agarose gel and electrophoresed. Lane 1: lambda DNAdigested with Hindlll. Lanes 2 and 4: pT13A32 and pT13A33 DNA recovered from E. coli JM109, respectively. Lane 3: pT13A32,pT13 and pA32 recovered from E. coli JM109 carrying pOPM3702. Lane 5: pT13A33 recovered from E. coli JM109 carryingpOPM3702. B) Detection of daughter plasmids by Southern hybridization. Cells were cultivated for 25 h at 37°C and plasmidswere recovered from the same number of cells. Plasmids were run through 0.7% agarose gel, transfered to a nitrocellulose filter afterdenaturation and hybridized with part of the ampT gene (lanes 1 and 2) or tet1 gene (lanes 3 and 4). Lanes 1 and 3: pT13A32 DNArecovered from E. coli JM109. Lanes 2 and 4: pT13A32 was introduced into JM109 carrying pOPM3702. Plasmids were recoveredfrom transformant. C) E. coli JM109 and JM109 carrying pOPM3703F were transformed by the parental plasmid pT13A32. Cellswere cultivated for 8 h at 37°C and harvested to extract plasmids. Lane 1: Lambda DNA digested with Hindlll. Lane 2 : pT13A32was introduced into JM109 and extracted fron transformant. Lane 3: pT13A32 was introduced into JM109 carrying pOPM3703Fand recovered from transformant.

pT13A32. These results suggest that RepK initiatedDNA replication from fragment 13 of parental plasmidpT13A32 and terminated at fragment 32 to yield plasmidpT13, then re-initiated from fragment 32 and terminatedat fragment 13 to make plasmid pA32. Since fragment32 is active in termination of DNA replication, this resultindicates that the initiation step requires the interactionbetween RepK and the origin to be much stronger thanthat required for the termination step. In the reinitia-tion, RepK which was used at the initiation step mightbe re-used because RepK can not bind to fragment 32.This indicates that RepK binds covalently to the 5' endof nicking-sites like a gene A protein (GpA) of phage phi-xl74. The mechanism of action of GpA has been reportedas follows.15 Two active tyrosine residues locate on thesame side of the alpha-helial portion of GpA. In the ini-tiation of DNA replication, one of the tyrosine residuesattacks the nicking site (G ATA) of the replication origin,and GpA binds to the 5' end of the DNA strand via atyrosyl-phosphodiester bond. After one round of replica-tion, the other tyrosine residue attacks the same site ofthe newly synthesized strand.

Recently it has been reported that a mutated Rep A,which aquired two active tyrosine residues like a GpA,

re-initiated DNA replication.4 Unlike the mutant RepAor GpA, the native RepK does not have two active tyro-sine residues on the same side of the alpha- helial por-tion (Fig. 5). Nevertheless, it re-initiates DNA replica-tion. Although we have shown that the tyrosine residue(Y237) of RepK is essential for DNA replication,6 onemore amino acid residue which contributes to DNA repli-cation is still unknown. It is also necessary to exam-ine whether RepK forms a homodimer or not. Since aRepK homodimer, if it is formed, would have two tyrosineresidues, one Y237 would be able to initiate replicationand the other one would be available for re-initiation.

Fragments 13 and 32 have the ability to form a stem-loop structure including the predicted initiation site 5'-GATA. To examine whether this structure was impor-tant for re-initiation, the plasmid pT13A33 which con-tained fragment 33 instead of 32 was prepared. The stemformed in fragment 33 was shorter and less stable thanthat formed in fragment 32. As shown in Fig. 4A, re-initiation was not observed with fragment 33. This mayprovide evidence that the stem structure is important forre-initiation.

The ability of the replication initiator proteins to re-initiate DNA replication would be beneficial to bacte-

Dow



ecember 2021

No. 3] H. Yasukawa and Y. Masamune 197

pKIM SAVAETLKYSVKPEDMA

pUBUO SAIDETAKYPVKDTDFM

pC194 KELYEMAKYSGKDSDYL

phi-xl74 MVGFYVAKYVNKKSDMD

208 229 245 257 277

RepK

Figure 5. Active sites of GpA and Rep proteins of rolling-circleplasmids. The conserved regions in Rep proteins of thepUB110/pC194 family are represented as hatched boxes. Thenumbers indicate the position of amino acid residues of RepK.Tyr residues which attack the replication origin are shown inbold. Glu and Ser which were exchanged to Tyr and Ala, re-spectively, in RepA are indicated by stars.4

riophages which do not have to control their copy num-ber. On the contrary, plasmids have to maintain theircopy number constantly. pKYM has the three followingmechanisms to control the amounts of RepK: 1) inhibi-tion of transcription by the binding of the HU proteinsto the repK promoter, 2) attenuation of RepK mRNAlike a pT181, 3) inhibition of translation by sequester-ing the repK Shine-Dalgamo (16 and our observation).The copy number of pKYM would be controled by theamounts of RepK.

The efficiency of re-initiation would be low since theparental plasmid pT13A32 was still detected after 8 h ofcultivation (Fig. 4A, lane 3). This low efficiency wouldcontribute to maintain the copy number.

Seery L. T. et al.17 and Waters V. W. et al.18 pro-posed the idea that pKYM provides the missing link be-tween Gram-positive and Gram-negative bacterial plas-mids. pKYM may provide the missing link between plas-mids and phages.

Acknowledgments: We thank Dr. S. D. Ehrlich forhelpful suggestions and E. Viller for critical readingof this manuscript. We also thank Dr. E. Ozaki, K.Nakahama, R. Joraku, Y. Terashima, and A. Nishikawafor helpful support to the work.

References

1. Avraham, R. and Novick, R. P. 1993, Replication-specific inactivation of the pT181 plasmid initiator pro-tein, Science, 262, 1048-1050.

2. Gros, M. F., te Riele, H., and Ehrlich, S. D. 1987, Rollingcircle replication of single-stranded DNA plasmid pC194,EMBO J., 6, 3863-3869.

3. Gros, M. F., te Riele, H., and Ehrlich, S. D. 1989, Repli-cation origin of a single-stranded DNA plasmid pC194,EMBO J., 8, 2711-2716.

4. Gros, M. F. and Ehrlich, S. D. 1996, Change of a cat-alytic reaction carried out by a DNA replication protein,Science, 274, 777-780.

5. Sugiura, S., Nakatani, S., Mizukami, Y., Hase, T.,Hirokawa, H., and Masamune, Y. 1984, Characteriza-tion of a mini plasmid isolated from Shigella sonnei, J.Biochem., 96, 1193-1204.

6. Yasukawa, H., Hase, T., Sakai, A., and Masamune, Y.1991, Rolling-circle replication of the plasmid pKYM iso-lated from a Gram-negative bacterium, Proc. Natl. Acad.Sci. USA, 88, 10282-10286.

7. Hase, T., Watanabe, M., Yasukawa, H., and Masamune,Y. 1992, In vitro DNA replication of plasmid pKYM, J.Gen. Appl. Microbiol., 38, 353-361.

8. Yasukawa, H., Ozaki, E., Morito, S., and Masamune, Y.1994, Initiation and termination of DNA replication ofplasmid pKYM via a rolling-circle mechanism, J. Gen.Appl. Microbiol., 40, 377-388.

9. Yanisch-Perron, C, Vieria, J., and Messing, J. 1985, Im-proved M13 phage cloning, vectors and host strains; nu-cleotide sequences of the M13mpl8 and pUC19 vectors,Gene, 33, 103-119.

10. Wood, W. B. 1966, Host specificity of DNA produced byEscherichia coli: bacterial mutations affecting the restric-tion and modification of DNA, J. Mol. Biol, 16, 118-133.

11. Yasukawa, H., Hase, T., and Masamune, Y. 1993, Themutational analysis of the plus origin and the identifi-cation of the minus origin of the plasmid pKYM whichreplicates via a rolling-circle mechanism, J. Gen. Appl.Microbiol, 38, 353-361.

12. Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White,T. J. 1990, PCR PROTOCOLS: A guide to methods andapplications. (Academic press, inc. Harcourt Brace Jo-vanovich, Publishers.)

13. Ozaki, E., Yasukawa, H., and Masamune, Y. 1994, Pu-rification of pKYM-encoded RepK, a protein required forthe initiation of plasmid replication, J. Gen. Appl. Mi-crobiol, 40, 365-375.

14. Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989,Molecular Cloning: A Laboratory Manual, Second Edi-tion (Cold Spring Harbor, New York; Cold Spring HarborLaboratory Press)

15. Hanai, R. and Wang, J. C. 1994, The mechanism ofsequence-specific DNA cleavage and strand transfer byphi-x 174 gene A protein, J. Biol. Chem., 268, 23830-23836.

16. Yasukawa, H., Ozaki, E., Nakahama, K., and Masamune,Y. 1997, HU protein binds to the replication origin ofrolling circle plasmid pKYM to enhance DNA replication,Mol. Gen. Genet, in press

17. Seery, L. T., Nolan, N. C, Sharp, P. M., and Devine,K. M. 1993, Comparative analysis of the pC194 group ofrolling circle plasmids, Plasmid., 30, 185-196.

18. Waters, V. G. and Guiney, D. G. 1993, Processes at thenick region link conjugation, T-DNA transfer and rollingcircle replication, Mol. Microbiol, 9, 1123-1130.

Dow



ecember 2021

Dow



ecember 2021

rolling-circle plasmid pkym re-initiates dna replication

Documents